Advertisement
Journal of Clinical Oncology  
Search for:
Limit by:
  Browse by Subject or Issue
Home Search or Browse JCO My JCO Subscriptions Customer Service Site Map

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Galanis, E.
Right arrow Articles by Rubin, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Galanis, E.
Right arrow Articles by Rubin, J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
Journal of Clinical Oncology, Vol 17, Issue 10 (October), 1999: 3313-3323
© 1999 American Society for Clinical Oncology

Immunotherapy of Advanced Malignancy by Direct Gene Transfer of an Interleukin-2 DNA/DMRIE/DOPE Lipid Complex: Phase I/II Experience

E. Galanis, E. M. Hersh, A. T. Stopeck, R. Gonzalez, P. Burch, C. Spier, E. T. Akporiaye, J. J. Rinehart, J. Edmonson, R. E. Sobol, C. Forscher, V. K. Sondak, B. D. Lewis, E. C. Unger, M. O'Driscoll, L. Selk, J. Rubin

From the Mayo Clinic and Mayo Foundation, Rochester, MN; Arizona Cancer Center, University of Arizona, Tucson, AZ; University of Colorado Cancer Center, Denver, CO; Scott and White Clinic, Temple, TX; Sidney Kimmel Cancer Agency, and Vical Incorporated, San Diego, and Cedar's Sinai Cancer Center, Los Angeles, CA; and University of Michigan Medical Center, Ann Arbor, MI.

Address reprint requests to Evanthia Galanis, MD, Mayo Clinic, 200 First Street SW, Rochester, MN 55905; email: galanis.evanthia{at}mayo.edu


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
PURPOSE: We have completed a phase I study, followed by three phase I/II studies, in patients with metastatic melanoma, renal cell carcinoma (RCC), and sarcoma in order to evaluate the safety, toxicity, and antitumor activity of Leuvectin (Vical Inc, San Diego, CA), a gene transfer product containing a plasmid encoding human interleukin (IL)-2 formulated with the cationic lipid 1,2-dimyristyloxypropyl-3-dimethyl-hydroxyethyl ammonium bromide/dioleyl-phosphatidyl-ethanolamine (DMRIE/DOPE) and administered intratumorally.

PATIENTS AND METHODS: Twenty-four patients were treated in the phase I study. Leuvectin doses were 10 µg, 30 µg, or 300 µg weekly for 6 weeks. In three subsequent phase I/II studies, a total of 52 patients (18 with melanoma, 17 with RCC, and 17 with sarcoma) were treated with further escalating doses of Leuvectin: 300 µg twice a week for 3 weeks, 750 µg weekly for 6 weeks, and 1,500 µg weekly for 6 weeks.

RESULTS: There were no drug-related grade 4 toxicities and only one grade 3 toxicity, but the majority ofpatients experienced mild constitutional symptoms after treatment. In the phase I/II studies, 45 patients were assessable for response (14 with RCC, 16 with melanoma, and 15 with sarcoma). Two patients with RCC and one with melanoma have achieved partial responses lasting from 16 to 19 months and continuing. In addition, two RCC, three melanoma, and six sarcoma patients had stable disease lasting from 3 to 18 months and continuing. The plasmid was detected by polymerase chain reaction assay in the posttreatment samples of 29 of 46 evaluated patients. Immunohistochemistry studies on serial biopsy specimens showed increased IL-2 expression and CD8+ infiltration after treatment in the tumor samples of several patients (12 and 16, respectively).

CONCLUSION: Direct intratumoral injection of Leuvectin is a safe and possibly effective immunotherapeutic approach in the treatment of certain tumor types.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
THE DISCOVERY OF recombinant interleukin (IL)-2 has allowed significant advances in our understanding of the immune response in T-cell biology. In clinical studies, pioneering work by Rosenberg et al1 demonstrated that high doses of recombinant IL-2 resulted in complete and partial antitumor responses in some patients with advanced metastatic malignancies, with the most responsive tumors being malignant melanoma and renal cell carcinoma (RCC).2 The benefits of systemic IL-2 administration, however, are accompanied by significant toxicity. In a recent combined report on all patients treated in phase II studies of high-dose single-agent IL-2 (with over 250 RCC patients), IL-2 treatment was associated with a complete response rate of 4% and a partial response rate of 11%. However, a 4% mortality rate was also observed.3

Complete responses to IL-2 in both malignant melanoma and metastatic RCC are usually long lasting; therefore, despite the low overall response rate and significant toxicity, IL-2 has been approved by the United States Food and Drug Administration for the treatment of patients with metastatic or unresectable RCC4 and recently for patients with metastatic melanoma.4

The failure of IL-2 trials to achieve high response rates in metastatic malignancies after systemic administration, despite encouraging in vitro results,5-9 may be due in part to the failure to achieve adequate intratumoral levels of the immunostimulatory cytokine before systemic, and even potentially lethal, toxicities are incurred. IL-2 gene transfer into tumor cells in vitro or in animal models has the potential to abrogate their tumorigenicity and induce tumor-specific antitumor immunity, possibly by overcoming the lack of the second costimulatory signal as a mechanism of tumor immunologic escape and by bypassing deficiencies in T-cell receptor–mediated signal transduction.9,10

In animal models, gene therapy with the IL-2 gene introduced directly into neoplastic cells has been shown to improve the efficacy of the cytokine immunotherapy without the accompanying toxicity. Preclinical studies by Parker et al11 have demonstrated that transfection with Leuvectin (Vical Inc, San Diego, CA), a plasmid DNA expression vector containing the human IL-2 gene complexed with the cationic lipid mixture 1,2-dimyristyloxyprophyl-3-dimethyl-hydroxyethyl ammonium bromide (DMRIE)/dioleoyl-phosphatidyl-ethanolamine (DOPE), induced IL-2 expression in a variety of target tumor cells, including human cell lines such as A375 (melanoma), A549 (lung), MCF7 (breast), PC-3 (prostate), and SW480 (colon) and the murine cell line B16 (melanoma). Additional preclinical studies by Saffran et al,12 using a murine IL-2 expression vector, demonstrated IL-2 expression in the Renca (RCC) murine cell line. Intratumoral injection of the murine equivalent of Leuvectin in the Renca model in immunocompetent BALB/c mice showed complete tumor regression mediated by CD8+ lymphocytes. Immunity was systemic, long-lived, and Renca-specific, and further, adoptive transfer of splenocytes from treated mice protected naive mice against Renca tumor.12 In addition, intravenous drug safety studies showed no signs of toxicity with Leuvectin doses up to 1,400 times the human dose in mice and up to 100 times the human dose in monkeys.13 Stopeck et al14 demonstrated that transfection of primary tumor cells with Leuvectin produced immunostimulatory levels of IL-2, as determined by increased thymidine incorporation by autologous peripheral-blood mononuclear cells and lymphokine-activated killer cell activity.

On the basis of these promising preclinical results, Leuvectin was taken into clinical trials. The purposes of the phase I study were to determine the safety and toxicity of direct intratumoral injection of escalating doses of Leuvectin and to assess changes in intratumoral IL-2 expression and immune response. The purpose of the subsequent phase I/II studies, in addition to determining the safety of further escalating doses of Leuvectin, was to evaluate efficacy in patients with metastatic melanoma, RCC, and sarcoma.


    PATIENTS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Eligibility Criteria
Phase I study. Eligible patients had metastatic solid tumors or lymphomas and were required to have one injectable metastatic lesion at least 1 cm in diameter. Patients with only bone metastases were not eligible for injection. Patients must have failed or refused standard therapy for their disease. Patients had to be 18 years of age older with a baseline Karnofsky performance score of at least 70 (Eastern Cooperative Oncology Group 0 to 1) and an estimated life expectancy of at least 16 weeks. They were also required to have acceptable bone marrow function (WBC count > 3 x 109/L and platelet count > 100 x 109/L), normal serum direct bilirubin, AST and alkaline phosphatase levels less than three times above the upper limits of normal, serum creatinine levels less than 125% of the upper limit of normal, and a prothrombin time less than 1 second above control. Exclusion criteria include brain metastases, active autoimmune disease, hepatitis, uncontrolled hypertension, uncontrolled diabetes, active infection, immunosuppressive therapy, surgery within the past 2 weeks, and radiation, corticosteroids, or chemotherapy within the past 3 weeks (6 weeks in cases of prior use of mitomycin and nitrosoureas). All patients gave written informed consent before study entry.

Phase I/II studies. Eligibility criteria included histologically confirmed RCC, melanoma, or sarcoma metastases beyond surgical cure. Patients must have had at least two metastases that were measurable in two dimensions, one of which measured at least 1 cm in greatest diameter and was accessible for intralesional injection. The second measurable lesion was to serve as a control to allow for evaluation of a distant response. No metastatic lesion was allowed to be larger than 10 cm in size, in an attempt to limit tumor burden. All patients had received prior standard therapy for their disease without response or had refused to receive standard treatment. The other eligibility and exclusion criteria were similar to those for the phase I study.

Study Drug
The study drug, Leuvectin (VCL-1102) is composed of IL-2 plasmid DNA formulated with the cationic lipid mixture DMRIE/DOPE in an injection vehicle consisting of glycerin and vitamin E in normal saline. All components are stable for at least 8 weeks under recommended storage conditions (-20°C).

The VCL-1102 plasmid DNA is a circular, double-stranded 4,928-base pair plasmid DNA with a molecular weight of 3.38 x 106 (Fig 1). The cDNA encoding human IL-2 has been inserted into a simplified eukaryotic expression vector derived from a PUC18 backbone under the control of the cytomegalovirus promoter. The plasmid also contains the bovine growth hormone terminator and polyadenylation signal sequence for transcriptional termination, as well as the kanamycin resistance gene under the transcriptional control of an ori insertion site.



View larger version (16K):
[in this window]
[in a new window]
 
Fig 1. Plasmid map of Leuvectin. The cytomegalovirus (CMV)-IE promoter drives the expression of the IL-2 cDNA. Abbreviations: BGH term, bovine growth hormone transcription terminator signal; Kanr, kanamycin resistance gene.

 

All injections were performed on an ambulatory basis. One milliliter of the appropriate dose of plasmid/lipid complex was injected into the tumor site at multiple angles using a 22-gauge spinal needle under direct, computed tomography (CT), or sonographic visualization. Before injection and after the placement of the needle, aspiration was applied to the syringe to assure that no material was injected intravenously. Vital signs were measured before and approximately every 15 minutes after the injection for at least 2 hours or until the patient was stable.

Treatment Schedule
Phase I study. Five patients were treated per dose level. Plasmid doses were 10, 30, 100, and 300 µg administered weekly for 6 weeks. The multiple administration schedule was selected based on our preclinical data in a Renca (RCC) mouse model that suggested increased antitumor effect when a multiple injection scheme was used.12 Patients who were stable or responding could receive a second or third 6-week cycle of therapy.

Phase I/II studies. The patients were divided into three groups per tumor type, each consisting of five patients per dose level. The patients in group 1 received 300 µg of the plasmid twice every week for 3 weeks for comparison of the effects of a more frequent dosing regimen at the same dose level given in the first trial. Since a maximum-tolerated dose was not achieved in the first study, the patients in groups 2 and 3 received 750 and 1,500 µg of the plasmid (the highest possible concentration in the DNA/lipid formulation), respectively, weekly for 6 consecutive weeks. All five patients at each dose escalation were observed for toxicity for 3 weeks before the next cohort of patients received treatment. If patients were responding or stable, they were eligible for repeat treatment.

Treatment Assessment
Pretreatment evaluation included history, physical examination, chest radiograph, ECG, standard hematology and chemistry, and contrast-enhanced CT or ultrasound of the involved organ for baseline measurements and disease status evaluation. Patients were subsequently evaluated by a study investigator for toxicity weekly during treatment. Overall disease status and response to treatment were evaluated at weeks, 4, 8, and 16 for the phase I study, every 6 weeks for schedule I of the phase I/II studies, and every 8 weeks for schedules 2 and 3 of the phase I/II studies. Biopsy of the injected lesion was performed at weeks, 1, 4, and 8 for patients in the phase I study, at weeks 1 and 6 in schedule 1 of the phase I/II studies, and at weeks 1 and 8 for patients in groups 2 and 3 of the phase I/II studies. In addition, in the phase I study, patients' plasma samples were collected before and after treatment for measurement of IL-2 levels. Standard oncologic criteria were used for response assessment. Complete regression (CR) was defined as a total disappearance of all evidence of tumor. A partial response (PR) was defined as a >= 50% reduction of the sum of the product of the two perpendicular diameters of all measurable lesions lasting at least 4 weeks with no appearance of new lesions. Progression was defined as 25% or greater increase in the sum of the products of measurable lesions over smallest measurements observed or the appearance of any new lesion. Patients who did not meet criteria for CR, PR, or progression were defined as stable.

Toxicity Evaluation
Before each subsequent injection, patients were evaluated for toxicities related to the prior injection and received treatment only if no grade 3 or higher toxicity had occurred. All toxicities were graded according to the World Health Organization recommendations.

Laboratory Evaluation of Transfection
PCR detection of the plasmid in tumor samples. Genomic DNA was isolated from the core needle biopsy material using the QI'Amp tissue kit (Qiagen, Valencia, CA). Oligonucleotide primers were synthesized corresponding to the cytomegalovirus promoter (sense, 5' CTCCTTGCTCCTAACAGTGG 3') and the human IL-2 gene (antisense, 5' AGTTGCATCCTGTCGATCC 3'). Polymerase chain reaction was performed using 1 to 200 ng of genomic DNA for 45 cycles of denaturation (94°C, 10 seconds), annealing (55°C, 30 seconds), and extension (75°C, 30 seconds) in a programmable thermal controller (MJ Research, Watertown, MA) using an in-sample probe. Sensitivity was determined by dilutional analysis and was estimated at one copy of plasmid DNA. Samples were analyzed by ethidium bromide staining on a 1.5% agarose gel for the expected 400-base pair PCR (DNA) product.

Immunohistochemical detection of IL-2 and CD8 infiltration. Samples were snap frozen for immunohistochemical evaluation of IL-2 antigen on tumor cells and tumor-infiltrating CD8+ cells, using a previously described technique15 with the following modifications: the tissue samples were frozen in OCT compound in -60°C isopentane for 2 minutes, then held at -80°C. Sections were cut in a cryostat, fixed for 10 minutes in cold (4°C) acetone, dried, wrapped in foil, and stored at -80°C until studied. They were then brought to room temperature, unwrapped, fixed in cold acetone for 10 minutes, and dried. The primary antibody, either purified antihuman IL-2 (clone IL2.66; Coulter Corporation, Hialeah, FL) or mouse antihuman CD8 (Leu-2b; Becton-Dickinson, Mountain View, CA), was applied and allowed to incubate in a moist chamber for 25 minutes. The slides were then washed in phosphate-buffered saline (PBS), and biotinylated goat antimouse immunoglobulin G (1/200 dilution; Caltag Laboratories, South San Francisco, CA) was applied, allowed to incubate for 20 minutes in a moist chamber, and then washed off with PBS. Avidin horseradish peroxidase (1/100 dilution; Vector Laboratories, Burlingame, CA) was applied, allowed to incubate for 20 minutes, and then washed off with PBS. A diaminobenzidine/hydrogen peroxidase solution (DAB tablets; Sigma Chemical Co, St Louis, MO) was applied and incubated for 5 minutes in the dark. After a PBS wash and two washes in distilled water, the slides were incubated in a 0.5% copper sulfate in 0.85% NaCl solution for 5 minutes, rinsed two times in distilled water, and incubated in an acetate buffer (pH 5.0) for 5 minutes. They were then counterstained using methyl green, rinsed twice in acetone, and then rinsed in two changes of xylene and coverslipped with mounting medium. The lymph node was used as a positive control for the CD8+ cells. The T-cell leukemia cell line HUT-78 (American Type Tissue Collection, Rockville, MD) was used as the positive control for the IL-2. These cells were grown to log phase, and then all were harvested; cytospin cell buttons were placed on individual slides, which were then individually wrapped in foil and kept at -80°C until needed for study. Substitution of 2% bovine serum albumin for the primary antibody on both control and patient samples served as the negative controls.

Correlation of immunohistochemical results was made to an a hematoxylin and eosin–stained section of the frozen sample. Positivity for IL-2 and CD8 was judged for the tumor cells and for the CD8 in the smaller lymphoid cells. The pathologist (C.S.) was blinded as to diagnosis, tissue location, and the timing of the biopsy in relationship to the treatment. Scoring was semiquantitative. Because some of the samples were quite small, to achieve equivalence across all samples, the following scoring system was used: 0 = negative, no staining; 1+ = 1% to 24% of cells stained; 2+ = 25% to 49% of cells stained; 3+ = 50% to 74% of cells stained; and 4+ = 75% to 100% of cells stained. The entire sample was assessed in making the judgment of how much reactivity there was. If another biopsy sample was submitted, it was sent for routine microscopic evaluation of formalin-fixed, paraffin-embedded, hematoxylin and eosin–stained sections.

Measurement of IL-2 Levels in Plasma
IL-2 levels were measured in EDTA plasma by enzyme-linked immunosorbent assay, using the Interest-2x kit (Genzyme Corp, Cambridge, MA).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Demographics
Phase I. Twenty-four patients were treated, one of whom was considered unassessable for response because she did not receive the required number of injections at her dose level. Twenty-three patients were assessable for response, 17 men and six women with a median age of 59 years (range, 31 to 83 years). Tumor types included melanoma (seven patients), sarcoma (four patients), colorectal cancer (four patients), RCC (three patients), pancreatic cancer (one patient), ovarian cancer (one patient), breast cancer (one patient), metastatic basal cell carcinoma (one patient), and adenocarcinoma of unknown primary tumor (one patient). Locations of the injected lesions included the skin and subcutaneous nodules, lymph nodes, chest wall, lung, liver, and pancreatic and vaginal metastases.

Phase I/II. Fifty-two patients were treated, of whom seven were unassessable for response because of disease progression before completion of the treatment (five patients) or early withdrawal from the study (two patients). Forty-five patients were assessable for response, 16 with melanoma, 14 with RCC, and 15 with sarcoma. Twenty-seven patients were male and 18 were female, with a median age of 57 years (range, 32 to 78 years). Sites of injected lesions included the skin or subcutaneous nodules, liver, lymph nodes, retroperitoneum, lung, kidney, adrenal glands, and peritoneal nodules.

Toxicity
Phase I. Twenty-four patients were assessable for toxicity. No grade 3 or 4 toxicities were observed related to the study drug. Sixteen (66%) of the 24 patients experienced mild discomfort at the injection site, whereas 10 (42%) of the 24 patients had constitutional symptoms after the injection consisting of malaise, low-grade fever, and chills. In addition, five patients developed hemorrhage of the injected lesion and three patients developed transient pneumothoraces as a result of lung lesion injection.

Phase I/II. Fifty-two patients in the phase I/II studies were assessable for toxicity. No grade 4 toxicities related to the study group were observed. Twenty-three patients (44%) experienced pain at the injection site. Twenty-seven patients (52%) experienced mild constitutional symptoms consisting of myalgias, low-grade fever (up to 38°C), and chills after the injection. This syndrome usually started between 3 and 24 hours after the injection and persisted for 2 to 24 hours. The symptoms were usually relieved by nonsteroidal analgesic agents. One patient experienced grade 3 rigors reported as probably related to the study drug after one injection of Leuvectin at the 750-µg dose level. The patient received subsequent injections with no further serious adverse events.

Clinical Responses
Phase I study. Although the end point of this study was primarily safety and toxicity of Leuvectin administration, tumor measurements were also recorded. No patients qualified for PR or CR. However, in five (22%) of 23 patients, response of the injected lesion (between 40% and 70%) was observed. These did not meet the criteria for PR as defined previously. Tumor types for these patients were as follows: melanoma (two patients, 44% and 65% regression of the injected lesions); sarcoma (one patient, 70% regression of the injected lesion); metastatic basal cell carcinoma (one patient, 44% regression of the injected lesion); and ovarian cancer (one patient, 40% regression of the injected lesion). Four patients had stable disease at the time of the completion of the study lasting from 4 to 40 months.

Phase I/II studies. RCC and melanoma were selected to be studied further as part of the phase I/II studies because of their well-established responsiveness to immunologic therapy. Sarcoma was selected because of a minor response seen in one patient in the phase I study. Table 1 summarizes the phase I/II response data in terms of disease status and dose level. In addition to the one melanoma and two RCC patients who met the criteria for PR, three other melanoma patients, two RCC patients, and four sarcoma patients had regression of the injected lesion (>= 25%) but did not qualify for a PR (Table 2). In addition, two melanoma patients had regression of uninjected skin lesions by more than 50%.


View this table:
[in this window]
[in a new window]
 
Table 1. Disease Status in the Phase I/II Trials of Leuvectin
 

View this table:
[in this window]
[in a new window]
 
Table 2. Patients With Regression of the Injected Tumor in the Phase I/II Studies
 

Melanoma. Eighteen patients were enrolled; 16 patients were assessable for response. One PR was observed at the 750-µg dose level. The patient was a 57-year-old white woman with ocular melanoma who presented with three liver metastases for which she underwent wedge liver resections. Six months later, the patient had a new metastatic lesion develop at the site of the previous resection. She refused further treatment, and in the next 5 months, she developed a new peripheral lesion in the liver as well as two lesions in the lower lung lobes bilaterally, while the liver lesion at the site of the initial resection had further increased in size. She began treatment with Leuvectin (750 µg) in May 1997. At the 8-week evaluation, the dominant liver lesion had decreased by 74% (Fig 2), and there was stability of the other liver and lung lesions. This response has persisted to date (16+ months since the first injection) with no interim growth of established lesions and no new lesions having appeared.




View larger version (207K):
[in this window]
[in a new window]
 
Fig 2. Hepatic metastasis of melanoma before (A) and 20 weeks after (B) treatment with Leuvectin.

 

In addition to the PR, there were three patients with stable disease, two at the 300-µg and one at the 750-µg dose level, with the duration of disease stability being 3 months, 18+ months, and 17+ months.

RCC. Seventeen patients were enrolled; 14 patients were assessable for response. Two PRs were observed at the 750- and 1,500-µg dose levels. The first patient was a 65-year-old white man who, after nephrectomy for RCC, presented with a retroperitoneal mass. Exploratory laparotomy showed a retroperitoneal mass that originated anteriorly to the inferior vena cava and was invading into the head of the pancreas. There were also multifocal intraperitoneal recurrences, three of which were excised. The patient began treatment with Leuvectin in February 1997. At week 8, a decrease of 75% was observed in the size of the retroperitoneal mass (Fig 3). The patient, since then, has undergone 18 additional treatments (three cycles). He is currently in PR 19 months after his first injection and remains asymptomatic.




View larger version (268K):
[in this window]
[in a new window]
 
Fig 3. Retroperitoneal metastasis of RCC before (A) and 16 weeks after (B) treatment with Leuvectin.

 

The second patient was a 71-year-old man who, after left nephrectomy, developed several metastatic lung lesions for which he underwent wedge resections. In March 1997, the patient presented with a partial small bowel obstruction, secondary to metastatic disease. In addition, he was found to have three metastatic liver lesions. He began Leuvectin treatment in May 1997 with the largest liver lesion being injected. Eight weeks later, the injected liver lesion had decreased in size by 86% and was replaced radiographically by a necrotic cyst. The patient has since then undergone a total of 24 treatments with Leuvectin (four treatment cycles), and his response has persisted without any new development of metastatic disease for 16+ months (Fig 4).




View larger version (226K):
[in this window]
[in a new window]
 
Fig 4. Hepatic metastasis of RCC before (A) and 16 months after (B) treatment with Leuvectin.

 

In addition, there were two RCC patients who achieved stable disease that persisted for 9 months and 10+ months. The patients received plasmid doses of 750 µg and 1,500 µg, respectively.

Sarcomas. Seventeen patients were enrolled; 15 patients were assessable for response. No objective responses were observed. There were six patients with stable disease (one at the 300-µg, two at the 750-µg, and three patients at the 1,500-µg dose levels). The median duration of stable disease in the sarcoma patients was 6 months.

Laboratory Evaluation of Biopsy Specimens
PCR amplification of tumor DNA for the detection of the IL-2 cDNA was performed on pre- and posttreatment biopsy specimens of 46 patients. The plasmid was detected in 29 patients (see example in Fig 5). Immunohistochemistry studies on serial biopsy specimens were conducted to measure the presence of IL-2 and CD8+ infiltration. Expression of IL-2 has been demonstrated previously in both in vitro and in vivo preclinical studies of Leuvectin.11,12,14,16 In the current phase I and I/II clinical studies, several of the posttreatment biopsy samples showed an increase in IL-2 expression (12 patients, Fig 6) and an increase in CD8+ infiltration (16 patients, Fig 7) as compared with their pretreatment samples, suggesting IL-2 expression. It is of note that the majority of pretreatment samples had no (0) or low (+1) reactivity for IL-2. In the positive posttreatment samples, the tumor cells, rather than the coexisting lymphocytes, were predominantly positive for IL-2. When the tumor was strongly reactive, occasionally a few positive lymphocytes were also seen. There were no instances of lymphocyte reactivity for IL-2, with negative tumor cells. The IL-2 expression by tumor cells is suggestive of in vivo IL-2 transgene expression. Nevertheless, because of the inherent difficulties in obtaining adequate samples with biopsies of deep-seated tumors, an insufficient amount of tissue or a noninformative sample was obtained in most cases and we cannot reliably correlate IL-2 expression and CD8+ infiltration with plasmid dose, incidence of constitutional symptoms, and response to treatment.



View larger version (80K):
[in this window]
[in a new window]
 
Fig 5. PCR of tumor biopsy specimens before (week 0) and after (week 6 and 9) initiation of treatment in two study patients with melanoma (MEL) and RCC demonstrate the presence of the IL-2 plasmid. Positive (plasmid alone) control, negative (water) control, and molecular markers are also shown.

 


View larger version (148K):
[in this window]
[in a new window]
 
Fig 6. Comparative tumor biopsy specimens from a study patient before (A) and 8 weeks after (B) study entry demonstrate increased IL-2 expression after treatment with Leuvectin (x200).

 


View larger version (146K):
[in this window]
[in a new window]
 
Fig 7. Comparative tumor biopsy specimens from a study patient before (A) and 8 weeks after (B) study entry demonstrate increased tumor infiltration by CD8+ lymphocytes after treatment with Leuvectin (x200).

 

For the phase I study only, IL-2 levels were measured in the peripheral blood. No significant differences were noted in serum IL-2 levels between pre- and posttreatment samples.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Systemic use of immunomodulatory cytokines represents the most commonly used form of biologic therapy in the treatment of cancer. Use of high-dose systemic IL-2 has demonstrated a clear benefit in a subpopulation of patients with metastatic RCC and melanoma, inducing durable responses in 15% to 20% of the patients.2,17 However, this response rate is achieved at the expense of significant toxicity. While the antitumor effect of high-dose systemic IL-2 seems to be due, at least in part, to broad-spectrum (nonspecific) killing mediated through natural killer and lymphokine activated killer cells,18 newer biologic therapy approaches, such as cytokine gene transfer, aim to achieve tumor-specific cytotoxic T lymphocyte (CTL)–mediated killing by increasing tumor immunogenicity.

Several phase I/II clinical trials have used autologous allogeneic tumor cells transduced with cytokine genes, such as IL-2,19,20 granulocyte-macrophage colony-stimulating factor,21,22 and interferon-gamma.23 Although tumor-specific CTLs were shown to be induced and delayed-type hypersensitivity developed, the best clinical response observed was one PR in a trial of autologous granulocyte-macrophage colony-stimulating factor gene–transduced tumor vaccine for RCC patients.22 Most clinical responses in other studies were mixed responses.20,23

The complexity of ex vivo manipulations for autologous tumor-cell processing has motivated exploration of in vivo gene transfer strategies that attempt to generate tumor vaccines in situ. The most extensively used approach in this setting is the gene-based introduction of allogeneic major histocompatibility complex molecules. Four phase I clinical trials of intratumoral injection of HLA-B7/DMRIE/DOPE (Allovectin-7; Vical Inc, San Diego, CA) were performed in patients with metastatic melanoma. Overall, there was a 36% (13 of 36) local response rate and a 19% (two of 36) systemic response rate.24 However, using the same approach, no responses were seen in patients with advanced metastatic RCC,25 despite extensive cytotoxic effector cell responses evident in a majority of the tumor biopsy specimens.

In this context, the results of the Leuvectin trials seem promising. A dose effect was observed in the phase I/II trials given the fact that most objective responses and disease stability occurred at the 750- and 1,500-µg dose levels. For the RCC patients, two out of 10 assessable patients treated at the two higher dose levels achieved PRs and another two achieved durable stable disease. Patients who responded had some characteristics in common such as prior nephrectomy and a small (less than five) number of sites of metastatic disease. Although the number of patients in these trials is too small to draw conclusions about prognostic factors for response, the characteristics of limited tumor burden and prior nephrectomy (a factor previously associated with response to immunotherapy26) will be analyzed further in our ongoing studies. If these responses are confirmed in the currently ongoing multicenter phase II trial in patients with metastatic RCC, they would be comparable to results achieved after systemic IL-2 administration in RCC patients but with minimal toxicity, and a phase III comparison study would be justified. For patients with melanoma, one of the 11 assessable patients at the two higher dose levels achieved a PR and a second patient exhibited stable disease for 17+ months.

When response of the injected lesion is taken into consideration, the biologic activity of Leuvectin seems to be even higher. Four (25%) of 16 patients with melanoma, four (29%) of 14 patients with RCC, and four (27%) of 15 patients with sarcoma had regression (> 25% decrease in size) of the injected nodule (Table 2); however, a local response did not always translate into an objective clinical response. The lack of significant tumor regression in noninjected sites in the majority of the patients may be attributable to several reasons. Tumor cells may release immunosuppressive agents, such as transforming growth factor-beta or IL-10, that blunt the immune response or prevent CTL from moving to other tumor sites.18,27 It is possible that different cytokine gene combinations or combined administration of the IL-2 gene with other genes able to increase tumor immunogenicity, such as MHC class I antigens28 or costimulatory molecules such as B7-1, may result in more vigorous, systemic CTL responses.

In RCC and melanoma, spontaneous regression can occasionally occur,29,30 leading to a potential criticism of responses observed in nonrandomized trials. However, in our study, there seems to be a causative relationship between intratumoral injection and response, as indicated by the fact that responding patients had rapidly progressing disease before Leuvectin treatment. For example, our patient with hepatic melanoma metastases underwent three wedge resections only 6 months before the reappearance of several sites of metastatic disease. The treatment effect was also more pronounced in the treated rather than untreated lesions.

In addition, intratumoral administration of the IL-2 gene seems to be safe and well-tolerated. No patient had to discontinue treatment because of side effects. Only one grade 3 and no grade 4 toxicities were seen. The most common adverse effects were discomfort at the injection site and mild constitutional symptoms in approximately half of the patients. The patients were able to tolerate up to four treatment courses (24 intratumoral administrations), even in visceral sites and retroperitoneum (Figs 4 and 5), without difficulty. Our experience with a total of 76 patients in the combined phase I and phase I/II studies indicates that intratumoral administration of transgenes as lipid-formulated plasmids either directly or under ultrasound or CT guidance, even in a repeated administration schedule, is a safe and well tolerated approach. The data also show that this approach to therapy is readily applied in a multicenter setting.

Furthermore, while we cannot definitively conclude that the increase in the presence of IL-2 and CD8 lymphocytic infiltration was due solely to Leuvectin administration, immunohistochemistry results are suggestive of IL-2 transgene expression. It is of note that immunohistochemistry of posttreatment tumor samples showed that tumor cells, rather than the surrounding lymphocytes, were predominantly IL-2–positive. Given the fact that IL-2 in vivo is mainly produced by activated lymphocytes, these results are suggestive of transgene expression.

The constitutional symptoms, consisting of mild malaise, low-grade fever, and chills, that we observed in roughly half of our patients could also be an indicator of transgene expression. In previous phase I studies, using a plasmid with identical backbone associated with DMRIE/DOPE lipid but a different transgene (HLA-B7 gene), no such symptoms were observed in any of the treated patients.31,32

Currently, we are in the process of confirming these results by continuing with a multicenter phase II trial in nephrectomized patients with metastatic RCC. For melanoma patients, given our promising results reported previously with intratumoral injection of the HLA-B7 gene,24,32 we have developed a phase I study combining intratumoral administration of IL-2 and HLA-B7 gene in patients with metastatic disease. The purpose of this approach is to make the tumor more immunogenic (HLA-B7) and at the same time drive CTL proliferation (IL-2).


    ACKNOWLEDGMENTS
 
We thank Jon Norman, PhD, for critical review of the manuscript and Gail Prechel for her help in the preparation of the manuscript.


    NOTES
 
November 30, 1998; accepted July 8, 1999.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
1. Rosenberg SA, Lotze MT, Muul LM, et al: Observations on the systemic administration of autologous lymphokine-activated killer cells and recombinant interleukin-2 to patients with metastatic cancer. N Engl J Med313:1485-1492, 1985[Abstract]

2. Rosenberg SA, Yang JC, Topalian SL, et al: Treatment of 283 consecutive patients with metastatic melanoma or renal cell cancer using high-dose bolus interleukin-2. JAMA271:907-913, 1994[Abstract/Free Full Text]

3. Fyfe G, Fisher RI, Rosenberg SA, et al: Results of treatment of 255 patients with metastatic renal cell carcinoma who received high-dose recombinant interleukin-2 therapy. J Clin Oncol13:688-696, 1995[Abstract/Free Full Text]

4. Proleukin. Emeryville, CA, Chiron Corporation, 1998 (package insert)

5. Golumbek PT, Lazenby AJ, Levitsky HI, et al: Treatment of established renal cancer by tumor cells engineered to secrete interleukin-4. Science254:713-716, 1991[Abstract/Free Full Text]

6. Gansbacher B, Zeir K, Daniels B, et al: Interleukin 2 gene transfer into tumor cells abrogates tumorigenicity and induces protective immunity. J Exp Med172:1217-1224, 1990[Abstract/Free Full Text]

7. Blankenstein T, Qin ZH, Uberla K, et al: Tumor suppression after tumor cell-targeted tumor necrosis factor alpha gene transfer. J Exp Med173:1047-1052, 1991[Abstract/Free Full Text]

8. Colombo MP, Ferrari G, Stoppacciaro A, et al: Granulocyte colony-stimulating factor gene transfer suppresses tumorigenicity of a murine adenocarcinoma in vivo. J Exp Med173:889-897, 1991[Abstract/Free Full Text]

9. Fearon ER, Pardoll DM, Itaya T, et al: Interleukin-2 production by tumor cells bypasses T helper function in the generation of an antitumor response. Cell60:397-403, 1990[Medline]

10. Zier KS, Gansbacher B: IL-2 gene therapy of solid tumors: An approach for the prevention of signal transduction defects in T cells. J Mol Med74:127-134, 1996[Medline]

11. Parker SE, Khatibi S, Margalith M, et al: Plasmid DNA gene therapy: Studies with the human interleukin-2 gene in tumor cells in vitro and in the murine B16 melanoma model in vivo. Cancer Gene Ther3:175-185, 1996[Medline]

12. Saffran DC, Horton HM, Yankauckas MA, et al: Immunotherapy of established tumors in mice by intratumoral injection of IL-2 plasmid DNA: Induction of CD8+ T cell immunity. Cancer Gene Ther5:321-330, 1998[Medline]

13. Parker SE, Vahlsing HL, Serfilippi LM, et al: Cancer gene therapy using plasmid DNA: Safety evaluation in rodents and non-human primates. Hum Gene Ther6:575-590, 1995[Medline]

14. Stopeck AT, Hersh EM, Brailey JL, et al: Transfection of primary tumor cells and tumor cell lines with plasmid DNA/lipid complexes. Cancer Gene Ther5:119-126, 1998[Medline]

15. Spier CM, Grogan TM, Fielder K, et al: Immunophenotypic profiles in well-differentiated lymphoproliferative disorders, with emphasis on small lymphocytic lymphoma. Hum Pathol17:1126-1136, 1986[Medline]

16. Parker SE, Khatibi S, Margalith M, et al: Antitumor efficacy of plasmid DNA encoding the human IL-2 gene. Cancer Gene Ther3:175-185, 1996

17. Rosenberg SA, Yang JC, Topalian SL, et al: Treatment of 283 consecutive patients with metastatic melanoma or renal cell cancer using high-dose bolus interleukin 2. JAMA271:907-913, 1994

18. Hawkins MJ: Interleukin-2 antitumor and effector cell responses. Semin Oncol20:52-59, 1993[Medline]

19. Rosenberg SA: The immunotherapy and gene therapy of cancer. J Clin Oncol10:180-199, 1992[Medline]

20. Belli F, Arienti F, Sule-Suso J, et al: Active immunization of metastatic melanoma patients with interleukin-2 transduced allogeneic melanoma cells: Evaluation of efficacy and tolerability. Cancer Immunol Immunother44:197-203, 1997[Medline]

21. Ellen KAO, O'Rourke MGE, Johnson GR, et al: A case report: Immune responses and clinical course of the first human use of granulocyte/macrophage-colony-stimulating-factor-transduced autologous melanoma cells for immunotherapy. Cancer Immunol Immunother44:10-20, 1997[Medline]

22. Simons JW, Jaffee EM, Weber CE, et al: Bioactivity of autologous irradiated renal cell carcinoma colony-stimulating factor gene transfer. Cancer Res57:1537-1546, 1997[Abstract/Free Full Text]

23. Abdel-Wahab Z, Weltz C, Hester D, et al: A phase I clinical trial of immunotherapy with interferon-gamma gene-modified autologous melanoma cells. Cancer80:401-412, 1997[Medline]

24. Hersh EM, Stopeck AT: Advances in the biological therapy and gene therapy of malignant disease. Clin Cancer Res3:1623-1629, 1997[Abstract]

25. Vogelzang NJ, Sudakoff G: Clinical experience in phase I and phase II testing of direct intratumoral administration with Allovectin-7: A gene-based immunotherapeutic agent. Proc Am Soc Clin Oncol15:235, 1996 (abstr)

26. Mani S, Todd MB, Katz K, et al: Prognostic factors for survival in patients with metastatic renal cancer treated with biological response modifiers. J Urol154:35-40, 1995[Medline]

27. Chen Q, Daniel V, Maher DW, et al: IL-10 is produced by melanoma cells and may have a role in immunosuppression mediated by melanoma. Int J Cancer56:1-6, 1994[Medline]

28. Nabel GJ, Nabel EG, Yang ZY, et al: Direct gene transfer with DNA-liposome complexes in melanoma: Expression, biologic activity, and lack of toxicity in humans. Proc Natl Acad Sci U S A90:11307-11311, 1993[Abstract/Free Full Text]

29. Young RC: Metastatic renal cell carcinoma: What causes occasional dramatic regressions? N Engl J Med338:1305-1306, 1998[Free Full Text]

30. Oliver RTD: Are cytokine responses in renal cell cancer the product of placebo effect of treatment or true biotherapy? What trials are needed now. Br J Cancer77:1318-1320, 1998[Medline]

31. Rubin J, Galanis E, Pitot HC, et al: Phase I study of immunotherapy of hepatic metastases of colorectal carcinoma by direct gene transfer of an allogeneic histocompatibility antigen, HLA-B8. Gene Ther4:419-425, 1997[Medline]

32. Stopeck AT, Hersh EM, Akporiaye ET, et al: Phase I study of direct gene transfer of an allogeneic histocompatibility antigen, HLA-B7, in patients with metastatic melanoma. J Clin Oncol15:341-349, 1997[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Facebook Facebook   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
JCOHome page
A. I. Daud, R. C. DeConti, S. Andrews, P. Urbas, A. I. Riker, V. K. Sondak, P. N. Munster, D. M. Sullivan, K. E. Ugen, J. L. Messina, et al.
Phase I Trial of Interleukin-12 Plasmid Electroporation in Patients With Metastatic Melanoma
J. Clin. Oncol., December 20, 2008; 26(36): 5896 - 5903.
[Abstract] [Full Text] [PDF]


Home page
RadiologyHome page
R. D. Suh, J. G. Goldin, A. B. Wallace, R. E. Sheehan, S. B. Heinze, B. J. Gitlitz, and R. A. Figlin
Metastatic Renal Cell Carcinoma: CT-guided Immunotherapy as a Technically Feasible and Safe Approach to Delivery of Gene Therapy for Treatment
Radiology, May 1, 2004; 231(2): 359 - 364.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
L. Barzon, M. Boscaro, and G. Palu
Endocrine Aspects of Cancer Gene Therapy
Endocr. Rev., February 1, 2004; 25(1): 1 - 44.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
H. Nakanishi, Y. Mizutani, A. Kawauchi, O. Ukimura, T. Shiraishi, M. Hatano, M. Mizuno, J. Yoshida, and T. Miki
Significant Antitumoral Activity of Cationic Multilamellar Liposomes Containing Human IFN-{beta} Gene against Human Renal Cell Carcinoma
Clin. Cancer Res., March 1, 2003; 9(3): 1129 - 1135.
[Abstract] [Full Text] [PDF]


Home page
Br Med BullHome page
D. H Palmer, M.-J. Chen, and D. J Kerr
Gene therapy for colorectal cancer
Br. Med. Bull., December 1, 2002; 64(1): 201 - 225.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Galanis, E.
Right arrow Articles by Rubin, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Galanis, E.
Right arrow Articles by Rubin, J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

About
JCO
 Editorial
Roster
 Advertising
Information
 Librarians &
Institutions
 Rights &
Permissions
 PDA Services

Copyright © 1999 by the American Society of Clinical Oncology, Online ISSN: 1527-7755. Print ISSN: 0732-183X
Terms and Conditions of Use
  HighWire Press HighWire Press™ assists in the publication of JCO Online