This Article Abstract Full Text (PDF) Purchase Article View Shopping Cart Alert me when this article is cited Alert me if a correction is posted Services Email this article to a colleague Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Save to my personal folders Download to citation manager Rights & Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Gasbarri, A. Articles by Bartolazzi, A. Search for Related Content PubMed PubMed Citation Articles by Gasbarri, A. Articles by Bartolazzi, A. Social Bookmarking                            What's this?

Galectin-3 and CD44v6 Isoforms in the Preoperative Evaluation of Thyroid Nodules

From the Department of Pathology and Immunology, National Cancer Institute Regina Elena, Rome, Italy.

Address reprint requests to Armando Bartolazzi, MD, PhD, Molecular and Cellular Tumor Pathology CCK R8:04, Korolinska Hospital, S 171 76 Stockholm, Sweden; email armando.bartolazzi{at}cck.ki.se or bartolazzi@crs.ifo.ito.

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
PURPOSE: Thyroid cancer is the most frequently occurring endocrine malignancy; however, preoperative diagnosis of some lesions, in particular those with follicular histology, is difficult, and a consistent number of nototherwise-specified "follicular nodules" are surgically resected more for diagnosis than therapeutic purposes. In this study, we investigated whether the lectin-related molecules CD44v6 and galectin-3, the expression of which is altered during deregulated cell growth and malignant transformation, could be potential markers for improving the diagnostic accuracy of conventional cytology.

MATERIALS AND METHODS: A comparative immuno-chemical and molecular analysis was performed on 157 thyroid specimens representative of normal, benign, and malignant tissues, and on 36 cytologic samples obtained preoperatively by fine-needle aspiration biopsy from nonselected patients with palpable thyroid nodules.

RESULTS: Normal thyrocytes did not express galectin-3 nor CD44v6. Although the expression of CD44v6 isnegligible in thyroiditis, these molecules are variably detected in benign and malignant proliferative lesions. Interestingly, galectin-3 is never expressed in benign lesions, but it is invariably detected in cancers. A comparative evaluation of CD44v6 and galectin-3 expression in thyroid malignancies demonstrated that these molecules are coexpressed at the messenger RNA and protein level in almost all lesions.

CONCLUSION: Our findings suggest that CD44v6 and galectin-3 could be potential markers to preoperatively identify malignant transformed thyrocytes. Immunodetection of these molecules on cytologic specimens obtained by fine-needle aspiration biopsy is an accurate and improved method for selecting, on a molecular basis, those nodular lesions of the thyroid gland that need to be surgically resected.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
DESPITE THE INCREASING progress in biomedical sciences observed in the last two decades, the diagnosis of thyroid cancer represents an ongoing problem. Nodules in the thyroid have always commanded a great deal of attention because they are sometimes visible, are often palpated by the patient, and always raise the question of cancer. The magnitude of the problem is obvious from the fact that approximately 4% of the United States population between the ages of 30 and 60 years has one or more palpable thyroid nodules. Because most of these lesions are benign, their clinical evaluation should be as selective as possible in the recommendation for surgical removal.¹ In the clinical management of thyroid nodules, fine-needle aspiration biopsy (FNAB) has become an extremely popular technique because it is quick, inexpensive, and involves minimal risk of complications.^2,3 Several large studies have reported a sensitivity and specificity of more than 90%, leading some investigators to recommend FNAB as the initial test in the evaluation of any thyroid nodule.^[z]3

With this technique, most papillary carcinomas and most forms of thyroiditis are easily detectable, but the main difficulty is the identification of well-differentiated follicular carcinomas, a task that is often impossible with this method in view of the specific diagnostic criteria required, in particular, capsular penetration and/or vascular invasion.^1,4 In fact, in most instances, the cytology reports fall into one of these two categories: (1) probable benign nodule or (2) follicular nodule not otherwise specified. Consequently, for the definitive diagnosis of follicular adenoma or carcinoma, a complete excision of the lesions is required. The differentiation between adenoma and follicular carcinoma is sometimes difficult also on a histopathologic basis. In fact, it has been recently proposed to designate as "follicular neoplasms of undetermined malignant behavior" those follicular lesions in which only a minimal capsular penetration is demonstrable.¹ Similar diagnostic problems could arise for thyroid lesions in which the cytologic features of a papillary carcinoma (ie, intranuclear pseudo-inclusions, clear nuclei, and groves) are partially represented, but papillary architecture is lacking, as well as for the correct interpretation of ectopic thyroid follicles in cervical lymph nodes.^1,4 Therefore, the identification of molecular markers that may allow an accurate preoperative diagnosis of thyroid malignancies and, consequently, the appropriate clinical treatment of patients with thyroid nodules, is imperative. With this in mind, we considered two groups of lectin-related molecules: the beta-galactoside–binding protein galectin-3 and CD44v, the expression of which is quantitatively and qualitatively altered during cell proliferation, malignant transformation, and tumor progression.^5-9 Lectins are proteins that bind specific carbohydrate structures and can thus recognize particular glycoconjugates among the vast array expressed in animal tissues. Although the precise biologic functions of galectins are still unclear, the general idea is that these molecules might operate in modulating cell-cell and cell-matrix interaction. This has been demonstrated for both galectin-1 and -3, which are able to bind polylactosamine chains on laminin, inhibiting cell adhesion via specific cell surface receptors.^10,11 Galectins that have also been implicated in cell growth and differentiation seem to play a role in malignant transformation and metastasis.^5-7,11 Interestingly, an increased expression of the galactoside-binding protein gene has been demonstrated in transformed thyroid cells and human thyroid carcinomas in vitro,⁷ and recently, high levels of galectin-1 and -3 expression have been described in thyroid malignancies but not in adenomas or in normal thyroid tissue.^12-14

CD44 is a polymorphic family of immunologically related cell surface glycoproteins implicated in cell-cell and cell-extracellular matrix interactions, lymphocyte activation, cell migration, and tumor growth and progression.⁸ CD44 can be expressed as standard molecules (CD44s) that represent the principal cell surface receptor for hyaluronic acid, as well as multiple isoforms (CD44v), each generated by the alternative splicing of up to 10 variant exons (v1 to v10) that encode parts of the extracellular domain of the molecule.¹⁵ In physiologic conditions, the process of alternative splicing of CD44 variant exons is tightly regulated, but a qualitatively and quantitatively altered expression of CD44v has been reported in several diseases characterized by disordered cell growth.⁸ Little is known about the function of CD44v molecules, but the expression of CD44 isoforms that contain a peptide encoded by the variant exon v6 was found to be both necessary and sufficient to confer metastatic potential to a rat pancreatic carcinoma cell line.¹⁶ In the present study, using specific monoclonal antibodies (mAbs) and oligonucleotide primers, we examined at the protein and messenger RNA (mRNA) levels the expression of galectin-3 and CD44v6 isoforms in normal, benign, and malignant thyroid tissues. The aim of this analysis was to verify whether galectin-3 and CD44v6 could be reliable immunocytochemical markers for preoperative detection of thyroid cancers.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Tissue Specimens and Cytologic Smears
Surgical biopsy specimens of normal and neoplastic thyroid tissues were obtained from the Department of Surgical Pathology at the Regina Elena Cancer Institute. Tissue samples were snap-frozen in liquid nitrogen, and 4-µm cryostat sections were obtained and fixed in absolute acetone for 10 minutes. Fixed sections were used in immunohistochemical assays. Nonselected patients with palpable thyroid nodules were subjected to FNAB, and aspirated material was used for conventional cytology, immunocytochemistry, and reverse transcriptase polymerase chain reaction (RT-PCR). A definitive histologic diagnosis was provided by three independent pathologists for lesions that were surgically resected.

mAbs and Immunochemical Assay
mAbs to CD44 and CD44v6 variant exon product used in this study were acquired from R&D System (Minneapolis, MN). Rat mAb M3/38 to galectin-3 was acquired from Boehringer Mannheim Corp (Mannheim, Germany). These reagents were used in immunohistochemistry and immunocytochemistry according to the manufacturers' instructions after antigen-retrieval microwave treatment of the substrates in buffer citrate 0.01 mol/L, pH 6. Immunohistochemistry and immunocytochemistry were performed using an indirect avidin-biotin complex immunoperoxidase method, with commercially available reagents (Vectastain ABC kit; Vector Laboratories, Burlingame, CA). Slides were incubated overnight with selected mAbs at 4°C in a moist chamber. The enzymatic activity was developed using 3-amino-9-ethyl-carbazole as previously reported.¹⁷ Slides were counterstained with Mayer's hematoxylin and mounted in Glycergel (Dako Corporation, Carpinteria, CA) for microscopic evaluation.

Sensitivity, specificity, predictive value, and diagnostic accuracy of the proposed immunocytochemistry assay were assessed as follows. Histomorphologic diagnosis was considered as the gold standard. Sensitivity was defined on the basis of thyroid cancer detection using immunostaining for both galectin-3 and CD44v6 [no. positive/(true positive + false negative)]. Specificity was defined on the basis of benign thyroid lesions detection [no. negative/(true negative + false positive)]. Positive and negative predictive values were computed as no. positive/(true positive + false positive) and no. negative/(true negative + false negative), respectively. Diagnostic accuracy was calculated as [(no. positive + no. negative)/(true positive + false positive + true negative + false negative)].

RT-PCR
Total RNA was obtained from both fresh and formalin-fixed paraffin-embedded tissue specimens, as well as from aspirated cytologic material by the guanidine isothiocyanate method.¹⁸ Single thyroid tissue sections (10 to 15 µm) cut from paraffin-embedded samples were stirred for 20 minutes in 1.5-mL tubes with 1 mL of xylene. After centrifugation, the samples were washed with 0.5 mL of ethanol; air dried; resuspended in 200 µL of solution containing guanidinium thiocyanate 1 mol/L, 25 mmol/L 2-beta-mercaptoethanol, 20 mmol/L Tris-HCl (pH 7.5), 0.5% n-lauroylsarcosine (Sigma, St Louis, MO), and 6 mg/mL proteinase K; and incubated at 45°C for 6 hours. At the end of the incubation, samples were mixed with one volume of phenol-chloroform (70%/30%), centrifuged again, and the aqueous supernatants were transferred in a 0.5-mL tube with 2 µg of glycogen. After addition of one volume of isopropanol, the samples were incubated at -20°C overnight for RNA precipitation and then centrifuged for 15 minutes at 12,000 rpm in an Eppendorf microcentrifuge (Eppendorf, Hamburg, Germany). Pellets were then washed with 70% ethanol and air dried. The extracted material was used in RT-PCR.

Complementary DNA for PCR was prepared by a oligo-p(dT) method. Five micrograms of total RNA previously treated with DNAse RNAse-free (Boehringer Mannheim) was incubated with 0.1 mol/L oligo-p(dT) (18 bases) for 10 minutes at 65°C and placed in ice for 5 minutes. Then, 5 µL of 5 x RT buffer, 40 U of RNAse-Inhibitor, 1 mmol/L deoxynucleotide triphosphates, 25 U of M-MuLV Reverse Transcriptase (all from Boehringer Mannheim), and water to a total volume of 25 µL were added together and incubated for 90 minutes at 37°C. Three microliters of the reaction volume was used for each PCR reaction. The PCR reactions were conducted in a total volume of 100 µL with the following reagents added together: 3 µL of complementary DNA; 1 µL of 10 mmol/L deoxynucleotide triphosphates (Boehringer Mannheim); 0.1 mmol/L of each oligonucleotide; 10 µL of 10 x buffer containing 100 mmol/L Tris-HCl, 15 mmol/L MgCl_2, 500 mmol/L KCl, pH 8.3 (Boehringer Mannheim), and 2.5 U of Taq DNA polymerase (Boehringer Mannheim). The oligonucleotides used as primers in this study for the analysis of CD44s (standard molecule) were: (1) C4F, CCAATGCCTTTGATGGACCA; and (2) C16R, CTGGAATTT-GGGGTGTCCT, complementary to the constant sequence 5' upstream (standard exon 4) and 3' downstream (standard exon 16), the variable portion of CD44 molecule (variant exons v3 to v10), respectively. Exon-specific primers were also designed for CD44 variant exon v6 as follows: (1) V6F, CAGGCAACTCCTAGTAGT; and (2) V6R, AGCTGTCCCTGTTGTCGA, complementary to a sequence inside the variable exon 6 of the CD44 sequence. To minimize the possible occurrence of amplification of genomic DNA, in each PCR reaction, upstream and downstream primers were used on variant and standard exons, respectively. The specificity of amplification products was analyzed in nested PCR using exon-specific primers.¹⁹

Oligonucleotide primers to detect galectin-3 mRNA transcripts were as follows: (1) Gal3F, CCAAACCCTCAAGGATG; and (2) Gal3R, GCAACCTTGAAGTGGTC, complementary to a sequence into exons 3 and 6, respectively, as reported by GeneBank published sequences (accession no. AF031422 and AF031425). A graphic representation of the amplification scheme used for CD44v6 and galectin-3 is shown in Fig 1. Reaction products were obtained in a thermal cycler (GeneAmp 9600; Perkin Elmer, Norwalk, CT) with an initial denaturation step (94°C for 5 minutes) and a total of 30 cycles of denaturation (94°C for 1 minute), annealing (56°C for 1 minute), and extension (72°C for 1 minute), followed by a final elongation (7 minutes at 72°C).

View larger version (11K): [in this window] [in a new window]   Fig 1. CD44 PCR amplification scheme shows the position of forward (C4F and V6F) and reverse (C16R and V6R) oligonucleotide primers. CD44 invariant region is depicted in black. Galectin-3 amplification scheme shows the position of forward (Gal3F) and reverse (Gal3R) primers. The linear portions of the maps represent intronic sequences.

A negative control without retrotranscription was provided for all of the experiments. PCR products were separated on a 2% agarose (Boehringer Mannheim), and gels were stained with ethidium bromide.

Total RNAs were also obtained from cytologic material by FNAB. Aspirated material was resuspended in 1 mL of Tripure (Boehringer Mannheim) or 1 mL of TRI-reagent (Sigma). Cell lysates were transferred in a 1.5-mL tube, and 0.2 mL of chloroform was added. Samples were then incubated at room temperature for 15 minutes, and after centrifugation at 7,000 rpm, the upper phases were transferred to a new tube, 2 µg of glycogen was added, and RNA was precipitated with one volume of isopropanol at -20°C overnight. RT-PCR was then performed as previously described.

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Expression of Galectin-3 and CD44v6 Molecules in Benign and Malignant Thyroid Tissues
A total of 157 thyroid tissue specimens, derived from patients who had undergone surgical resection of the thyroid gland for either benign or malignant nodules, were immunohistochemically evaluated using mAbs specific for galectin-3 and CD44v6 epitopes. The results of this analysis are summarized in Table 1. Galectin-3 was not detected on 67 tissue specimens comprehensive of normal thyroid, nodular hyperplasia (goiters), and chronic lymphocytic thyroiditis.

Although CD44s receptor was physiologically expressed on normal thyroid epithelium (data not shown), CD44v6 isoforms (originating from the alternative splicing of CD44 variant exons) were detected in 53% of the nodular hyperplasias and in two of 15 chronic lymphocytic thyroiditis tested. In thyroid follicular adenomas, galectin-3 was faintly detected in only one of 37 specimens, whereas CD44v6 was expressed in almost 22%, demonstrating that deregulation of CD44 mRNA splicing can be observed in several disordered growth states of the thyrocytes.

CD44v6 and galectin-3 were not coexpressed in benign lesions of the thyroid gland. Interestingly, when a panel of malignant lesions comprehensive of papillary, follicular, and undifferentiated carcinomas were immunohistochemically evaluated, both galectin-3 and CD44v6 were detected in almost all instances (Table 1). The staining pattern observed with mAb to CD44v6 was primarily confined to the plasma membrane of the cells, whereas a prominent cytoplasmic staining was observed with mAb to galectin-3, which is known to be shed by the neoplastic cells (Fig 2). In some follicular lesions, previously classified by three independent pathologists as follicular neoplasms of undetermined malignant behavior because only a minimal capsular penetration was histologically demonstrated, galectin-3 and CD44v6 were coexpressed at the protein and molecular levels in three of five cases. In consideration of the aforementioned coexpression of galectin-3 and CD44v6 in thyroid malignancies, we are strongly tempted to consider the incipient malignant transformation of such unclassified lesions.

View larger version (126K): [in this window] [in a new window]   Fig 2. Immunohistochemical detection of galectin-3 on thyroid tissues. (A) Follicular adenoma; (B) follicular carcinoma; (C) papillary carcinoma; (D) normal thyroid tissue surrounding papillary carcinoma. Immunoreactivity of mAb to galectin-3 is restricted to follicular and papillary malignancies. (Indirect immunoperoxidase counterstained with Mayer's hematoxylin.)

The sensitivity and specificity of galectin-3 and CD44v6 evaluation (in terms of coexpression) on histologic specimens in benign versus malignant thyroid lesions were 84.6% and 98%, respectively. The sensitivity and specificity of this immunostaining in detecting follicular adenomas versus follicular carcinomas were 86.6% and 94.7%, respectively. Positive and negative predictive values were assessed as 89.8% and 95.3%, respectively, in benign versus malignant lesions, whereas the diagnostic accuracy of galectin-3 and CD44v6 coexpression in identifying benign versus malignant thyroid lesions was 93.6%.

Detection of Galectin-3 and CD44v6 mRNA Transcripts in Benign and Malignant Thyroid Lesions
To demonstrate at the mRNA level the immunohistochemical findings reported here, we used RT-PCR on a retrospective panel of 28 well-classified formalin-fixed and paraffin-embedded thyroid lesions, as well as on a panel of 17 fresh surgically resected tissue specimens for which conventional histologic diagnosis was available. Figure 1 shows the amplification scheme used in this study. In normal thyroid specimens, only mRNA transcripts for CD44 standard receptor (CD44s, 420 base pairs) were detected. Specific transcripts for CD44v6 were observed in one of seven thyroiditis, six of 11 goiters, and eight of 14 follicular adenomas. On the other hand, in a panel of 13 thyroid malignancies comprehensive of follicular, papillary, and undifferentiated carcinomas, specific transcripts for CD44v6 isoforms were invariably detected.

In some instances, two or three CD44v transcripts, representative of the exon product v6, were resolved in RT-PCR in accordance with the possibility that coexpression of different CD44v isoforms may occur during deregulated cell growth (data not shown; Fig 3).

View larger version (80K): [in this window] [in a new window]   Fig 3. Comparative RT-PCR analysis on benign and malignant thyroid lesions. (Top) Two samples of normal thyroid (N.T.), nodular hyperplasia (Go.), and thyroiditis (Thy.). (Bottom) Follicular adenoma (F.A.), follicular carcinoma (F.Ca.), papillary carcinoma (P.Ca.), and undifferentiated carcinoma (U.Ca.) are shown. Galectin-3 transcripts were never detected in normal and benign lesions, whereas in carcinomas, both CD44v6 and galectin-3 transcripts are shown. CD44s, standard CD44 molecule as positive control; molecular weight.

According to the aforementioned immunohistochemical findings, mRNA transcripts for galectin-3 were never detected in normal and benign thyroid lesions, but they were consistently detected in all thyroid malignancies, demonstrating that galectin-3 is a reliable marker of malignant transformation in thyrocytes. A representative selection of these results is shown in Fig 3.

These data suggest that in thyroid malignancies, both CD44 isoforms containing the exon product v6 and galectin-3 are consistently expressed at mRNA and protein levels, and the combined immunodetection of these molecules could be used to identify almost all the cancers, independently of their degree of differentiation.

Immunodetection of Galectin-3 and CD44v6 Could Improve the Diagnostic Accuracy of Conventional Cytology in Preoperative Evaluation of Thyroid Lesions
To verify whether the immunodetection of galectin-3 and CD44v6 could improve the diagnostic accuracy of conventional cytology, we used specific mAbs to galectin-3 and CD44v6 on a panel of cytologic specimens obtained preoperatively by FNAB of palpable thyroid nodules. Results of this analysis are summarized in Table 2, in which cytologic, immunocytologic, and definitive histologic reports are compared for 36 lesions that were surgically resected. Interestingly, coexpression of CD44v6 and galectin-3 was exclusively observed on transformed thyrocytes (cases no. 10, 15, 25, 32, and 35), whereas a restricted expression of CD44v6 isoforms was always related to the presence of hyperplastic nodules or follicular adenomas (Fig 4). These findings were also confirmed in RT-PCR (data not shown). In some colloid goiters, scattered histiocytes were strongly stained with mAb to galectin-3, but normal coexisting thyrocytes were always unreactive. The immunoreactivity of mAb to galectin-3 on normal histiocytes, which is easily discriminated cytomorphologically, may be considered a good internal positive control during immunocytochemical evaluation of preoperative FNAB specimens.

View larger version (132K): [in this window] [in a new window]   Fig 4. Immunocytochemical detection of CD44v6 and galectin-3 on cytologic smears by preoperative FNAB of a cytologically defined follicular nodule. (A) CD44v6 and (B) galectin-3 expression on follicular carcinoma of the thyroid gland, which was cytologically referred to as follicular nodule with atypism (original magnification x 40).

In this preliminary screening, sensitivity, specificity, and positive and negative predictive values of galectin-3 and CD44v6 immunodetection of benign versus malignant thyroid lesions seem to be proximal to 100%. The diagnostic accuracy of preoperative immunocytochemical evaluation of galectin-3 and CD44v6 coexpression in benign versus malignant thyroid lesions was also 100%.

Unfortunately, at this time, the immunodetection of CD44v6 alone, using a mAb to v6 exon–specific peptide, does not improve the diagnostic accuracy of conventional cytology in distinguishing between single hyperplastic nodules, nodular goiters, and follicular adenomas; however, it is interesting to note that in 14 of 36 specimens in which cytologic reports fall within the diagnosis of "follicular nodule not otherwise specified," immunodetection of both galectin-3 and CD44v6 was able to reveal preoperatively five thyroid cancers and nine cases of benign follicular proliferation, all of which were histologically confirmed (Table 2).

The possibility that different CD44v isoforms (in terms of variant exon assortment) could be expressed in large ipofunctional colloid goiters with respect to hyperplastic nodules and adenomas is under investigation in a larger number of cases.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Studies on markers of malignancy in thyroid neoplasms have focused mainly on oncogene alterations,^20,21 but little is known about other molecules, such as cell surface molecules that interact with the extracellular matrix and may be related to malignant transformation and tumor progression. In this study, we demonstrated that CD44v6 and galectin-3 represent potential markers of altered cell proliferation and neoplastic transformation, respectively. The restricted expression of galectin-3 in thyroid cancers in vivo, which we demonstrated immunochemically as well as in RT-PCR, is supported by previous in vitro findings⁷ and is in agreement with other reports in the recent literature.^12-14 In particular, Orlandi et al¹⁴ demonstrated the possible use of galectin-3 in preoperative evaluation of thyroid cancers using formalin-fixed and paraffin-embedded cytologic cell blocks.

Although the expression of CD44v6 in thyroid nodules is not sufficient to distinguish between benign and malignant proliferative lesions,^8,22-24 we demonstrated that this marker of deregulated cell growth is consistently expressed in thyroid malignancies independently by the tumor type. In agreement with our findings, an aberrant pattern of alternative CD44 mRNA splicing involving the exon product v6 was previously reported by Ermak et al^22,23 in papillary carcinomas and by Gu et al²⁴ in all thyroid malignancies derived from follicular cells.

In the present study using immunohistochemistry, immunocytochemistry, and RT-PCR, we demonstrated that galectin-3 and some CD44 isoforms containing the exon product v6 are consistently coexpressed at protein and mRNA levels in thyroid malignancies when compared with their benign counterparts.

Our findings clearly show that coexpression of these molecules can help to distinguish between benign and malignant thyroid lesions, but most of all, between well-differentiated follicular carcinomas versus benign follicular proliferation of the thyroid gland. We therefore support the combined use of mAbs to galectin-3 and CD44v6 in the preoperative evaluation of thyroid nodules with the aim to improve the diagnostic accuracy of conventional cytology.

Although the sensitivity and specificity of CD44v6 and galectin-3 evaluation in thyroid nodules are apparently similar to those concerning the conventional cytologic method,²⁵ it is important to stress that in a consistent number of follicular lesions, cytology fails to make a preoperative distinction.^2,3

The proposed immunocytodiagnosis, also supported by the recent literature,¹⁴ may have a significant clinical impact because no other methods for discriminating between benign and malignant follicular lesions currently exists, other than thyroidectomy followed by histologic evaluation of the tissue.^2-4 Moreover, several thyroid lesions that are presently not categorized at the histologic level also, as well as follicular lesions with undefined malignant potential and the reported epithelial inclusions of well-differentiated thyroid follicles in cervical lymph node, could be correctly characterized both phenotypically and at the mRNA level using specific probes to galectin-3 and CD44v6. A scheme of preoperative screening and clinical management of thyroid lesions that foresees the integration of conventional cytology with immunocytochemical procedures is shown in Fig 5.

View larger version (25K): [in this window] [in a new window]   Fig 5. Proposed protocol for the clinical management of thyroid lesions. Integration of conventional cytology and immunocytochemistry for the evaluation of CD44v6 and galectin-3 expression on preoperative FNAB.

The results of this study demonstrate that CD44v6-negative/galectin-3–negative and CD44v6-positive/galectin-3–negative nodular lesions of the thyroid gland are likely benign and could be monitored in follow-up evaluations. On the other hand, in cytologically demonstrated thyrocytes, the expression of galectin-3 (which is almost invariably associated with CD44v6) strongly suggests the presence of a malignant proliferating lesion. In conclusion, the most important aspect of this study is the real possibility of selecting, on a molecular basis and during preoperative cytologic screening, thyroid lesions that require urgent and imperative surgical treatment. It should be mentioned that even when the thyroid nodule is solitary, solid, and cold on scintiscan, it will prove malignant in no more than 10% to 20% of cases, and that as many as one third of such lesions disappears spontaneously if left untreated.^1,2,4

We are currently evaluating the clinical impact of this reliable, easy, and inexpensive diagnostic approach in a wide prospective multicenter study. In addition, a detailed molecular analysis of CD44v repertoire expressed on a large number of benign thyroid lesions will be performed to investigate the possibility of distinguishing proliferative from "sleeping" nodules. Such information could potentially change the clinical approach to different benign thyroid lesions.

	ACKNOWLEDGMENTS

 
Supported by the Associazione Italiana per la Ricerca sul Cancro. M.P.M. is supported by a fellowship from Federazione Italiana per la Ricerca sul Cancro, Milan, Italy.

We thank Paola Canalini, Antonella Mangoni, and Alessia Brenna for expert technical assistance, Dr Maria Luisa Appetecchia for critical discussion, and Paula Franke for revision of the manuscript.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
1. Rosai J, Carcangiu ML, De Lellis RA: Atlas of Tumor Pathology: Tumors of the Thyroid Gland. Third series, fascicle 5. Washington, DC, Armed Force Institute of Pathology, 1992

2. Nunez C, Mendelsohn G: Fine-needle aspiration and needle biopsy of the thyroid gland. Pathol Annu24:161-198, 1989

3. Gharib H: Fine-needle aspiration biopsy of thyroid nodules: Advantages, limitations and effect. Mayo Clin Proc69:44-49, 1994[Medline]

4. Hedinger CE: Problems in the classification of thyroid tumors: Their significance for prognosis and therapy. Schweiz Med Wochenschr123:1673-1681, 1993[Medline]

5. Barondes SH, Cooper DNV, Gitt MA, et al: Galectins: Structure and functions of a large family of animal lectins. J Biol Chem269:20807-20810, 1994[Free Full Text]

6. Raz A, Zhu D, Hogan V, et al: Evidence for the role of a 34 kDa galactoside-binding lectin in transformation and metastasis. Int J Cancer46:871-877, 1990[Medline]

7. Chiarotti L, Berlingieri MT, De Rosa P, et al: Increased expression of the negative growth factor, galactoside-binding protein gene, in transformed thyroid cells and in human thyroid carcinomas. Oncogene71:2507-2511, 1992

8. Naor D, Vogt Sionov R, Ish-Shalom D: CD44: Structure, function, and association with the malignant process. Adv Cancer Res71:241-319, 1997[Medline]

9. Aruffo A, Stamenkovic I, Melnick M, et al: CD44 is the principal cell surface receptor for hyaluronate. Cell61:1303-1313, 1990[Medline]

10. Matsumoto R, Matsumoto H, Seki M, et al: Human ecalectin, a variant of human galectin-9, is a novel eosinophil chemoattractant produced by T lymphocytes. J Biol Chem273:16976-16984, 1988[Abstract/Free Full Text]

11. Barondes SH, Castronovo V, Cooper DNV, et al: Galectins: A family of animal beta-galactoside-binding lectins. Cell76:597-598, 1994[Medline]

12. Xu XC, El Naggar AK, Lotan R: Differential expression of galectin-1 and galectin-3 in thyroid tumors: Potential diagnostic implications. Am J Pathol147:815-821, 1995[Abstract]

13. Fernandez PL, Merino MJ, Gomez M, et al: Galectin-3 and laminin expression in neoplastic and non-neoplastic thyroid tissue. J Pathol181:80-86, 1997[Medline]

14. Orlandi F, Saggiorato E, Pivano G, et al: Galectin-3 is a presurgical marker of human thyroid carcinomas. Cancer Res58:3015-3020, 1998[Abstract/Free Full Text]

15. Screaton GR, Bell MV, Jackson DJ, et al: Genomic structure of DNA encoding the lymphocyte homing receptor CD44 reveals at least 12 alternatively spliced exons. Proc Natl Acad Sci U S A89:12160-12164, 1992[Abstract/Free Full Text]

16. Gunthert U, Hofmann M, Rudy W, et al: A new variant of glycoprotein CD44 confer metastatic potential to rat carcinoma cells. Cell65:13-24, 1991[Medline]

17. Natali PG, Nicotra MR, Bartolazzi A, et al: Integrin expression in cutaneous malignant melanoma: Association of the alpha3beta1 heterodimer with tumor progression. Int J Cancer54:68-72, 1993[Medline]

18. de Andres B, del Pozo V, Gallardo S, et al: Improved method for mRNA extraction from paraffin-embedded tissues. Biotechniques18:42-43, 1995[Medline]

19. Martegani MP, Del Prete F, Gasbarri A, et al: Structural variability of CD44v molecules and reliability of immunodetection of CD44 isoforms using mAbs specific for CD44 variant exon products. Am J Pathol154:291-300, 1999[Abstract/Free Full Text]

20. Johnson TI, Lloyd RV, Thor A: Expression of ras oncogene p21 in normal and proliferative thyroid tissue. Am J Pathol127:60-65, 1987[Abstract]

21. Fagin JA: Molecular pathogenesis of human thyroid neoplasms. Thyroid Today17:1-7, 1994

22. Ermac G, Gerasimov G, Troshina K, et al: Deregulated alternative splicing of CD44 messenger RNA transcripts in neoplastic and non neoplastic lesions of the human thyroid. Cancer Res55:4594-4598, 1995[Abstract/Free Full Text]

23. Ermac G, Jennings T, Robinson L, et al: Restricted patterns of CD44 variant exon expression in human papillary thyroid carcinoma. Cancer Res56:1037-1042, 1996[Abstract/Free Full Text]

24. Gu J, Kashima K, Yokoyama S, et al: Expression of splice variants of CD44 in thyroid neoplasms derived from follicular cells. Pathol Int48:184-190, 1998[Medline]

25. Agrawal S: Diagnostic accuracy and role of fine needle aspiration cytology in management of thyroid nodules. J Surg Oncol58:168-172, 1995[Medline]

Submitted February 1, 1999; accepted July 12, 1999.

CiteULike    Complore    Connotea    Del.icio.us    Digg    Facebook    Reddit    Technorati    Twitter    What's this?

This article has been cited by other articles:

				Y. Y Liu, H. Morreau, J. Kievit, J. A Romijn, N. Carrasco, and J. W Smit Combined immunostaining with galectin-3, fibronectin-1, CITED-1, Hector Battifora mesothelial-1, cytokeratin-19, peroxisome proliferator-activated receptor-{gamma}, and sodium/iodide symporter antibodies for the differential diagnosis of non-medullary thyroid carcinoma Eur. J. Endocrinol., March 1, 2008; 158(3): 375 - 384. [Abstract] [Full Text] [PDF]

				M Niedziela Pathogenesis, diagnosis and management of thyroid nodules in children. Endocr. Relat. Cancer, June 1, 2006; 13(2): 427 - 453. [Abstract] [Full Text] [PDF]

				M. R. Castro and H. Gharib Continuing Controversies in the Management of Thyroid Nodules Ann Intern Med, June 7, 2005; 142(11): 926 - 931. [Abstract] [Full Text] [PDF]

				E Saggiorato, R De Pompa, M Volante, S Cappia, F Arecco, A P Dei Tos, F Orlandi, and M Papotti Characterization of thyroid 'follicular neoplasms' in fine-needle aspiration cytological specimens using a panel of immunohistochemical markers: a proposal for clinical application Endocr. Relat. Cancer, June 1, 2005; 12(2): 305 - 317. [Abstract] [Full Text] [PDF]

				C. Greco, R. Vona, M. Cosimelli, P. Matarrese, E. Straface, P. Scordati, D. Giannarelli, V. Casale, D. Assisi, M. Mottolese, et al. Cell surface overexpression of galectin-3 and the presence of its ligand 90k in the blood plasma as determinants in colon neoplastic lesions Glycobiology, September 1, 2004; 14(9): 783 - 792. [Abstract] [Full Text] [PDF]

				C. Torres-Cabala, A. Panizo-Santos, H. C. Krutzsch, H. Barazi, M. Namba, M. Sakaguchi, D. D. Roberts, and M. J. Merino Differential Expression of S100C in Thyroid Lesions International Journal of Surgical Pathology, April 1, 2004; 12(2): 107 - 115. [Abstract] [PDF]

				M. N. Nikiforova, R. A. Lynch, P. W. Biddinger, E. K. Alexander, G. W. Dorn II, G. Tallini, T. G. Kroll, and Y. E. Nikiforov RAS Point Mutations and PAX8-PPAR{gamma} Rearrangement in Thyroid Tumors: Evidence for Distinct Molecular Pathways in Thyroid Follicular Carcinoma J. Clin. Endocrinol. Metab., May 1, 2003; 88(5): 2318 - 2326. [Abstract] [Full Text] [PDF]

				L. Hegedus, S. J. Bonnema, and F. N. Bennedbaek Management of Simple Nodular Goiter: Current Status and Future Perspectives Endocr. Rev., February 1, 2003; 24(1): 102 - 132. [Abstract] [Full Text] [PDF]

				M. Niedziela, E. Korman, and J. Maceluch Authors' Response: Methodological Considerations Regarding the Use of Galectin-3 Expression Analysis in Preoperative Evaluation of Thyroid Nodules J. Clin. Endocrinol. Metab., February 1, 2003; 88(2): 950 - 951. [Full Text]

				L. Cheung, M. Messina, A. Gill, A. Clarkson, D. Learoyd, L. Delbridge, J. Wentworth, J. Philips, R. Clifton-Bligh, and B. G. Robinson Detection of the PAX8-PPAR{gamma} Fusion Oncogene in Both Follicular Thyroid Carcinomas and Adenomas J. Clin. Endocrinol. Metab., January 1, 2003; 88(1): 354 - 357. [Abstract] [Full Text] [PDF]

				L. Martins, S. E. Matsuo, K. N. Ebina, M. A. V. Kulcsar, C. U. M. Friguglietti, and E. T. Kimura Galectin-3 Messenger Ribonucleic Acid and Protein Are Expressed in Benign Thyroid Tumors J. Clin. Endocrinol. Metab., October 1, 2002; 87(10): 4806 - 4810. [Abstract] [Full Text] [PDF]

				E. Saggiorato, S. Cappia, P. De Giuli, A. Mussa, G. Pancani, P. Caraci, A. Angeli, and F. Orlandi Galectin-3 as a Presurgical Immunocytodiagnostic Marker of Minimally Invasive Follicular Thyroid Carcinoma J. Clin. Endocrinol. Metab., November 1, 2001; 86(11): 5152 - 5158. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Purchase Article View Shopping Cart Alert me when this article is cited Alert me if a correction is posted Services Email this article to a colleague Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Save to my personal folders Download to citation manager Rights & Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Gasbarri, A. Articles by Bartolazzi, A. Search for Related Content PubMed PubMed Citation Articles by Gasbarri, A. Articles by Bartolazzi, A. Social Bookmarking                            What's this?