Advertisement
Journal of Clinical Oncology  
Search for:
Limit by:
  Browse by Subject or Issue
Home Search or Browse JCO My JCO Subscriptions Customer Service Site Map

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sun, L.
Right arrow Articles by Uckun, F. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sun, L.
Right arrow Articles by Uckun, F. M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
Journal of Clinical Oncology, Vol 17, Issue 12 (December), 1999: 3753-3766
© 1999 American Society for Clinical Oncology

Expression of Aberrantly Spliced Oncogenic Ikaros Isoforms in Childhood Acute Lymphoblastic Leukemia

Lei Sun, Patricia A. Goodman, Carla M. Wood, Mya-Lisa Crotty, Martha Sensel, Harland Sather, Christopher Navara, James Nachman, Peter G. Steinherz, Paul S. Gaynon, Nita Seibel, Alexei Vassilev, Brian D. Juran, Gregory H. Reaman, Fatih M. Uckun

From the Parker Hughes Cancer Center and Children's Cancer Group ALL Biology Reference Laboratory, Hughes Institute, St Paul, MN; Group Operations Center, Children's Cancer Group, Arcadia, and Department of Hematology-Oncology, Children's Hospital Los Angeles, Los Angeles, CA; Department of Pediatrics, University of Chicago, Chicago, IL; Department of Pediatrics, Memorial Sloan-Kettering Cancer Center, New York, NY; and Children's National Medical Center and George Washington University, Washington, DC.

Address reprint requests to F.M. Uckun, MD, Hughes Institute, 2665 Long Lake Rd, Suite 330, St. Paul, MN 55113; email fatih_uckun{at}ih.org


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
PURPOSE: We sought to determine if molecular abnormalities involving the Ikaros gene could contribute to the development of acute lymphoblastic leukemia (ALL) in children.

PATIENTS AND METHODS: We studied Ikaros gene expression in normal human bone marrow, normal thymocytes, normal fetal liver–derived immature lymphocyte precursor cell lines, eight different ALL cell lines, and leukemic cells from 69 children with ALL (T-lineage ALL, n = 18; B-lineage ALL, n = 51). Expression of Ikaros protein and its subcellular localization were examined by immunoblotting and confocal laser-scanning microscopy, respectively. Polymerase chain reaction (PCR) and nucleotide sequencing were used to identify the specific Ikaros isoforms expressed in these cells. Genomic sequencing of splice junction regions of the Ikaros gene was performed in search for mutations.

RESULTS: In each of the ALL cases, we found high-level expression of a non–DNA-binding or aberrant DNA-binding isoform of Ikaros with abnormal subcellular compartmentalization patterns. In contrast, only wild-type Ik-1 and Ik-2 isoforms with normal subcellular localization were found in normal bone marrow cells and thymus-derived or fetal liver–derived normal lymphocyte precursors. In leukemic cells expressing the aberrant Ikaros coding sequences with the 30-base-pair deletion, genomic sequence analysis of the intron-exon junctions between exons 6 and 7 yielded the wild-type sequence. We identified a single nucleotide polymorphism (SNP) affecting the third base of the triplet codon for a proline (CCC or CCA) in the highly conserved bipartite activation region (viz, A or C at position 1002 numbering from the translation start site of Ik-1) within our Ikaros clones. Bi-allelic expression of truncated and/or non–DNA-binding isoforms along with wild-type isoforms was observed in leukemic cells, which implicates trans-acting factor(s) affecting splice site recognition.

CONCLUSION: Our findings link specific molecular defects involving the Ikaros gene to childhood ALL. Posttranscriptional regulation of alternative splicing of Ikaros RNA seems to be defective in leukemic lymphocyte precursors from most children with ALL. Consequently, leukemic cells from ALL patients, in contrast to normal lymphocyte precursors, express high levels of non–DNA-binding Ikaros isoforms that are reminiscent of the non–DNA-binding Ikaros isoforms that lead to lymphoblastic leukemia in mice.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
ACUTE LYMPHOBLASTIC leukemia (ALL) is the most common form of cancer in children.1-4 A better understanding of the biologic basis and predisposing leukemogenic events in this disease may lead to the development of more effective treatment programs as well as novel prevention strategies. The leukemic clones in ALL patients are thought to originate from normal lymphocyte precursors that have been arrested at various stages of T- or B-lymphocyte development2; hence, any critical regulatory network that controls normal lymphocyte development is a potential target for a leukemogenic event. One such regulatory network that is vital for normal lymphopoiesis involves Ikaros, a member of the Kruppel family "zinc finger" DNA-binding proteins. Ikaros acts as an evolutionarily conserved "master switch" of hematopoiesis that dictates the transcriptional regulation of the earliest stages of lymphocyte ontogeny and differentiation.5-16 In mice, absence of the normal Ikaros gene results in an early and complete arrest in the development of all lymphoid lineages during both fetal and adult hematopoiesis.5 Ikaros-deficient mice have a rudimentary thymus, lack peripheral lymph nodes, and are characterized by a complete absence of lymphocyte progenitor cells as well as mature B-lymphocytes, T-lymphocytes, and natural killer cells.5 Ikaros also has an important leukemia suppressor function that depends on its DNA binding ability: mice that are heterozygous for a germline mutation which results in loss of critical DNA-binding zinc fingers of Ikaros develop a very aggressive form of lymphoblastic leukemia with a concomitant loss of heterozygosity that occurs between 3 and 6 months after birth.10 Moreover, Ikaros has been localized to centromeric heterochromatin in immature lymphocyte precursors, and it has been proposed that Ikaros might play an important role in recruitment and centromere-associated silencing of potentially leukemogenic growth-regulatory genes.15,16

The programmed expression and function of the Ikaros gene is tightly controlled by alternative splicing of the Ikaros pre-mRNA, which results in production of eight different Ikaros isoforms.5-16 Therefore, splicing errors could have severe consequences for the lymphocyte compartment of the developing immune system. All eight Ikaros isoforms share a common carboxy(C)-terminal domain that contains a transcription activation motif and two zinc finger motifs that are required for hetero- and homodimerization among the Ikaros isoforms and for interactions with other proteins.7,8,12 Only three of the eight Ikaros isoforms, however, contain the requisite three or more amino (N)-terminal zinc fingers that confer high-affinity binding to an Ikaros-specific core DNA sequence motif in the promoters of target genes.12 The formation of homo- and heterodimers among the DNA-binding isoforms increases their affinity for DNA, whereas heterodimers between the DNA-binding isoforms and non–DNA-binding isoforms are unable to bind DNA. Therefore, Ikaros proteins with fewer than three N-terminal zinc fingers can interfere with the activity of Ikaros isoforms that can bind DNA.11,12 An abundance of the non–DNA-binding Ikaros isoforms that no longer bind DNA could result in significantly impaired expression of regulatory target genes that are essential for the orderly development and maturation of lymphocyte precursors and could interfere with centromeric recruitment and repression of potentially leukemogenic genes (see Discussion).

Based on the critical regulatory function of Ikaros for normal lymphocyte development in mice, as well as the observation of rapid development of lymphoblastic leukemia in mice expressing Ikaros isoforms that lack critical amino-terminal zinc fingers, we hypothesized that normal Ikaros expression and function might be altered in childhood ALL. Our present study, which involved 18 children with T-lineage ALL and 51 children with B-lineage ALL, shows that the posttranscriptional regulation of alternative splicing of Ikaros pre-mRNA is defective in leukemic lymphocyte precursors from most patients. Consequently, leukemic cells from ALL patients, in contrast to normal lymphocyte precursors, express high levels of non–DNA-binding Ikaros isoforms that are reminiscent of the Ikaros isoforms which lead to lymphoblastic leukemia in germline mutant mice. Our findings link for the first time specific molecular defects involving Ikaros to a disease of the human immune system and thereby provide strong support for the long-suspected function of Ikaros as an indispensable regulatory gene. The detection of Ikaros abnormalities as leukemia-specific indicators of disease burden may facilitate the evaluation and monitoring of the quality of remission in children with ALL who are enrolled in contemporary treatment programs.


    PATIENTS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Patients and Cell Lines
The patient population included 64 children (< 21 years of age) with newly diagnosed ALL who were enrolled on Children's Cancer Group (CCG) protocols CCG-1882 and CCG-1961 (for ALL patients 1 to 9 years of age with WBCs >= 50,000/µL or age >= 10 years), CCG-1901 (for ALL patients with lymphomatous features, including T-ALL), or CCG-107, CCG-1883, and CCG-1953 (for infants with ALL). Fifteen patients had T-lineage ALL and 49 patients had B-lineage ALL. Except for eight patients with B-lineage ALL, all other patients (87.5%) had high-risk ALL according to National Cancer Institute (NCI) risk classification.17 Five patients in first bone marrow relapse also were studied. Each protocol was approved by the NCI as well as the institutional review boards of the participating CCG-affiliated institutions. Informed consent was obtained from parents, patients, or both as deemed appropriate for treatment and laboratory studies according to United States Department of Health and Human Services guidelines.

Diagnosis of ALL was made on the basis of morphologic, biochemical, and immunologic features of the leukemic cells, including lymphoblast morphology as determined by Wright-Giemsa staining, positive nuclear staining for terminal deoxynucleotidyl transferase, negative staining for myeloperoxidase, and reactivity with monoclonal antibodies to lymphoid differentiation antigens, as described previously.18-20 All T-lineage ALL patients in the present study were classified as T-lineage ALL because >= 30% of the isolated leukemic cells were positive for the pan–T-cell marker CD7 and less than 30% were positive for the pan–B-cell marker CD19. Similarly, all B-lineage ALL patients were classified as B-lineage ALL because >= 30% of their leukemic cells were positive for CD19 and less than 30% were positive for CD7. Surplus cells from diagnostic bone marrow specimens were used for molecular genetic studies.

The presenting clinical features of the 64 newly diagnosed patients are listed in Table 1. Among the 15 newly diagnosed T-lineage ALL patients, all 15 had high-risk ALL according to NCI risk classification,17 nine (60%) were male, 14 (97%) had high WBC counts, 12 (80%) had hepatosplenomegaly, and 11 (73%) had a mediastinal mass (Table 1). Among the 49 newly diagnosed B-lineage patients, 41 (30 infants and 11 children; 84%) had high-risk ALL, 28 (57%) were male, 27 (55%) had high WBC counts, and 34 (69%) had hepatosplenomegaly. The preponderance of high-risk patients in this study was due to the availability of larger numbers of leukemic blasts from children with high-risk ALL. Normal bone marrow specimens were obtained from two children who were bone marrow donors in the context of sibling bone marrow transplantation. Normal thymuses were obtained from five children undergoing thoracic surgery for a cardiac defect. One fetal thymus was obtained from a prostaglandin-induced human abortus of 21 weeks' gestational age. These tissues were used according to the guidelines of the Hughes Institute Committee on the Use of Human Subjects. In addition, the human T-lineage ALL cell lines MOLT-3 and JK-E6-1 (ATCC TIB-152), as well as the B-lineage ALL cell lines LC1;19 (E2A-PBX1+), KM-3, HPB-NULL, NALM-6, ALL-1 (BCR-ABL+), and RS4;11 (MLL-AF4+), were also included in the analyses. Also included in our study were the fetal liver–derived immature lymphocyte precursor cell lines FL8.2+ (a CD2+CD19+CD10+CD34+ pro-B/T cell line with germline IgH and T-cell receptor (TCR){alpha} genes coexpressing the B-lineage surface antigen CD19 as well as the T-lineage surface antigen CD2) and FL8.2- (a CD2-CD19+CD10+CD34+ -sIg- pro-B cell line with germline IgH genes). The establishment and characterization of these normal lymphocyte precursor cell lines were previously reported in detail.21,22


View this table:
[in this window]
[in a new window]
 
Table 1. Patient Characteristics
 

Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) and Nucleotide Sequencing
All RT-PCR assays for Ikaros mRNA expression were performed centrally in the CCG ALL Biology Reference Laboratory, taking all due precautions to avoid false-positive results, as previously described in detail.23 Briefly, total cellular RNA was extracted from cells using the RNeasy total RNA isolation kit (Qiagen, Santa Clarita, CA), and 20% of the total RNA sample was used for cDNA synthesis with Moloney murine leukemia virus reverse transcriptase (GIBCO-BRL, Gaithersburg, MD) in the presence of dNTPs. Products were amplified with Amplitaq DNA polymerase (Perkin Elmer Cetus Corp, Norwalk, CT) and subjected to 35 cycles in a DNA thermal cycler as described. For enhanced sensitivity, the PCR products were amplified further by nested PCR. Primers for amplification of Ikaros (Ik) cDNAs were F1:5'ATGGATGCTGACGAGGGTCAAGAC3' and R1:5'TTAGCTCATGTGGAAGCGGTGCTC3'. Primers for nested PCR were F2: 5'CTCATCAGGGAAGGAAAGCC3' and R2: 5'GGTGTACATGACGTGATCCAGG3'. The location of the 5' ends of the primers relative to the start site based on Ik-1 cDNA are +1 for F1, +32 for F2, +1570 for R1, and +1444 for R2. The predicted sizes of the PCR products are 1.5 kb for Ik-1, 1.28 kb for Ik-2 and Ik-3, 1.17 kb for Ik-4, 1.1 kb for Ik-5, 0.86 kb for Ik-6, 1.1 kb for Ik-7, and 1.0 kb for Ik-8. RNA integrity was confirmed by PCR amplification of the cABL mRNA, which is expressed ubiquitously in human hematopoietic cells, using the primers 5'-TTCAGCGGCCAGTAGCATCTGACTT-3' and 5'-TGTGATTATAGCCTAAGACCCGGAG-3'. Reactions conducted with RNA isolated from normal fetal thymocytes/infant bone marrow mononuclear cells were used as positive controls for Ikaros transcripts. Negative controls included PCR products from an RNA-free cDNA synthesis and amplification reaction and a DNA polymerase-free reaction.

Purified RT-PCR products (QIAquickTM PCR purification kit, Qiagen) were cloned into the pCR II vector using the TA Cloning kit (Invitrogen, San Diego, CA). The cloned PCR products were purified with a Qiagen plasmid isolation kit and sequenced automatically with the Thermosequenase sequencing kit (Amersham, Arlington Heights, IL) and the ALF Sequencer (Pharmacia, LKB Biotech, Piscataway, NJ).22 Manual sequencing by the dideoxynucleotide chain termination method was performed using the T7 Sequenase Quick-denature Plasmid Sequencing kit (Amersham) according to the manufacturer's instructions. The sequences were compared with the published human Ikaros cDNA sequence obtained through GenBank (accession codes S80876 and U40462).

Genomic Sequence Analysis of the Ikaros Gene at the Two Alternative Splice Donor Sites
Genomic DNA was isolated from both patient cells and cell lines using the Puregene DNA isolation kit (Gentra Systems, Inc, Minneapolis/Plymouth, MN). The genomic sequence surrounding the predominant splice donor and acceptor sites at the exon-intron splice junction of Ikaros exon 6 was characterized through the use of a GenomeWalker Kit (Clontech, Palo Alto, CA). This kit uses high-quality human placenta genomic DNA, which is digested with individual restriction enzymes and then ligated to specifically designed adapters to produce five separate digested DNA "libraries." Amplification of genomic sequence with one unknown end is then possible using one gene-specific primer (GSP1 or P1) and one adapter-specific primer (AP1). Then nested PCR amplification (with GSP2, or P2, and AP2) follows to produce adequate quantities of region-specific product for use in cloning and sequence analysis. For the first round, the gene-specific PCR primer from Ikaros exon 6 was 5'-TAA TCA CAG TGA ATG GCA GAA GAC CTG-3' (P1a, position +732-759), whereas for the second round, the nested primer was 5'-GGC AGA AGA CCT GTG CAA GAT AGG ATC A-3' (P2, position +747-774). The PCR protocol was performed as recommended in the GenomeWalker manual. Briefly, long-range PCR is accomplished with the AdvanTAge genomic PCR polymerase mix (Clontech), which is a formulation containing a primary polymerase, Tth; a secondary, proofreading polymerase with 3' to 5' exonuclease activity; and TthStart antibody (Clontech), which effectively generates a hot-start PCR. For the first round, the two-step cycling parameters were as follows: 94°C for 25 seconds, 72°C for 4 minutes (seven cycles); then 94°C for 25 seconds, 67°C for 4 minutes (32 cycles); followed by a final extension at 67°C for 4 minutes. In the nested reaction, the cycling parameters were as follows: 94°C for 25 seconds, 72°C for 4 minutes (five cycles); 94°C for 25 seconds, 67°C for 4 minutes (20 cycles); followed by a final extension at 67°C for 4 minutes.

In the amplification of the 3' splice site, the AdvanTAge PCR mix was replaced with the Expand Long Template PCR system (Roche Molecular Biochemicals, Indianapolis, IN), which contains a combination of Taq polymerase and Pwo polymerase, as the proofreading enzyme, along with precise reagent buffer formulations. Buffer 3, which is formulated for difficult templates and contains detergents, was used at the recommended dilution. For the first round, the gene-specific PCR primer from Ikaros exon 7 was 5'-AGC GGG CGC AGG GAC TC-3' (P7, position +989-973), whereas for the second round, the nested primer was 5'-GAC TCG GCC CCC AGG TAG TTG-3' (P6, position +977-957). Primers AP1 and AP2 were briefly described above. The PCR protocol was performed essentially as recommended in the GenomeWalker manual and as described above. The human tissue-type plasminogen activator (tPA) PCR primers were the positive control primers, PCP1 and PCP2, provided with the GenomeWalker kit. The tPA control cycling parameters were as described in the manufacturer's protocol using the genomic library digest, PvuII.

Nested PCR products were cloned using the TOPO TA Cloning Kit (Invitrogen, Carlsbad, CA). Plasmid minipreps of the cloned DNA were performed using the High Pure Plasmid Isolation Kit (Roche Molecular Biochemicals). Clones containing insert were sequenced using a Thermo Sequenase primer cycle sequencing kit (Amersham Pharmacia Biotech, Piscataway, NJ) and the ALFexpress automated DNA sequencer (Amersham Pharmacia). In some cases (3' splice junction), dimethyl sulfoxide was added to the cycle sequencing reactions at a final concentration of 5% volume-to-volume ratio. Ikaros cDNAs of GenBank accession nos. HSU40462 (human Ikaros mRNA, hIk-1) and S80876 (human Ikaros mRNA, alternatively spliced form, Jurkat) were used in sequence comparisons and mapping. A composite cDNA sequence was generated from these sequences.

Amplification of Genomic DNA and Genomic Sequence Analysis of the Ikaros Gene in ALL Cells
The sequence that was obtained using the GenomeWalker kit (see Genomic Sequence Analysis of the Ikaros Gene at the Two Alternative Splice Donor Sites) was used to design primers to directly amplify the region surrounding the 5' splice junction of Ikaros exons 6 and 7 from the patient and cell line genomic DNA. For the 5' splice site, PCR was performed using two primer sets that differ in the placement of the intronic (antisense) primer to amplify fragments of 342 base pairs (bp) and 211 bp. The sense primers from exon 6 for both products were essentially identical to the gene specific primer (P1a), ie, 5'-TAA TCA CAG TGA ATG GCA GAA GAC CTG-3' (P1a) or 5'-TAA GCA CAG TGA AAT GGC AGA AGA CCT G-3' (P1b) at position +732-759. The sequence of the antisense primers that were used to amplify two fragments of different lengths, 342 and 211 bp, were 5'-ATG CTG CAA AAT CAA ATC TAG GAA AAA C-3' (P4, intronic position +223-196 from the splice donor site) and 5'-TTT CCC TTT CTT CCA CCC TCA ACT CAT-3' (P3, intronic position +92-65), respectively.

PCR was performed using 500 ng of genomic DNA in a 50-µL reaction volume using the Expand Long Template PCR system (Roche Molecular Biochemicals) with buffer and component concentrations as recommended using buffer system 3 for difficult templates. The long-range PCR cycling parameters were as follows: 95°C for 2 minutes (complete denaturation), which is followed by 10 cycles at 94°C for 25 seconds, 65°C for 30 seconds, extension at 68°C for 2 minutes, with an additional 20 cycles of 94°C for 25 seconds, 65°C for 30 seconds, 68°C for 2 minutes (extension), in which 20 seconds is added per cycle to the extension step, and then a final extension at 68°C for 10 minutes. The resulting products were cloned using the TOPO TA Cloning Kit (Invitrogen). Plasmid minipreps of the cloned DNA were performed using the High Pure Plasmid Isolation Kit (Roche Molecular Biochemicals). Clones containing insert were sequenced using the Thermo Sequenase primer cycle sequencing kit (Amersham Pharmacia) and an ALFexpress automated sequencer (Amersham Pharmacia). For the 3' splice site, genomic PCR was performed as above with the Expand Long Template PCR system (Roche Molecular Biochemicals) but using buffer system 1 and 5% dimethyl sulfoxide. The sense primer was 5'-GTA GGT CCT GGC TCG GTG TCC C-3' (P5, intronic position -244 to -223 from the splice acceptor site), and the antisense primer was 5'-GAC TCG GCC CCC AGG TAG TTG-3' (P6, position in cDNA +977-957). In this case, the long-range PCR cycling parameters were 1 x 95°C for 3 minutes; 10 x 95°C for 30 seconds, 66°C for 45 seconds, 68°C for 2 minutes, 68°C for 2 minutes; 20 x 95°C for 30 seconds, 66°C for 45 seconds, 68°C for 2 minutes + 10 sec/cycle; and 1 x 68°C for 5 minutes. For this 3' fragment analysis, dimethyl sulfoxide was added to both the genomic PCR and the cycle sequencing reactions at a final concentration of 5% volume-to-volume ratio.

Western Blot Analysis of Ikaros Protein Expression
Whole cell lysates were prepared using a 1% Nonidet-P40 lysis buffer, as described.24,25 Western blot analysis of whole cell lysates for Ikaros expression was performed using a polyclonal anti-Ikaros antibody12 that is reactive with all eight Ikaros isoforms.24,25 In brief, 30-µg samples of whole cell lysates were loaded on a 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis, and the size-fractionated proteins were transferred onto a PVDF membrane (Millipore Corporation, Bedford, MA). The membrane was blocked in 5% milk for at least 1 hour at room temperature and then incubated with a polyclonal anti-Ikaros antibody (1:1000 dilution)12 in phosphate-buffered saline (PBS) with 5% milk overnight at 4°C. The membrane was washed three times with PBS-Tween (150 mmol/L NaCl, 16 mmol/L Na2HPO4, 4 mmol/L NaH2PO4, 0.1% Tween, pH 7.3) at room temperature and incubated with a peroxidase-conjugated goat antirabbit IgG (1:2000 dilution; Jackson Laboratory, Bar Harbor, ME) for 2 hours at room temperature. Immunoreactive proteins were detected by the enhanced chemiluminescence system (Amersham), as described.24,25

Subcellular Localization Studies Using Confocal Laser Scanning Microscopy
The subcellular localization of Ikaros protein(s) was examined by immunofluorescence and confocal laser scanning microscopy, as described.24,25 Cells (200 x 103) were attached to poly-L-lysine–coated glass coverslips by a 30-minute incubation at room temperature, washed twice with PBS, and fixed in ice-cold (-20°C) methanol for 15 minutes. To permeabilize the cells and block the nonspecific antibody binding sites, cells were treated with 0.1% Triton X-100 and 10% goat serum in PBS for 30 minutes. To detect the Ikaros protein, cells were incubated with an affinity-purified polyclonal rabbit anti-Ikaros antibody12,25 (1:300 dilution) for 1 hour at room temperature. Cells were washed with PBS and incubated with a fluorescein isothiocyanate conjugated goat antirabbit IgG (Amersham) (1:40 final dilution) for 1 hour. Cells were washed with PBS, counterstained with the DNA-specific nuclear dye toto-3 (Molecular Probes Inc, Eugene, OR; 1:1000 dilution) for 10 minutes at room temperature, and washed again with PBS. The coverslips were inverted, mounted onto slides in Vectashield (Vector Labs, Burlinghame, CA) to prevent photobleaching, and sealed with nail varnish.25 Slides were examined using an MRC 1024 Laser Scanning Confocal Microscope (BioRad, Hercules, CA) mounted on an Eclipse E-800 upright microscope (Nikon, Melville, NY) equipped for epifluorescence with high numerical aperture objectives.24,25 Optical sections were obtained and turned into stereomicrographs using Lasersharp software (BioRad). Representative digital images were processed using the Photoshop software (Adobe Systems, Mountain View, CA). Images were printed with a Fuji Pictography thermal transfer printer (Fuji Photo, Elmsford, NY).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Ikaros Protein Expression in Leukemic Cells From Children With ALL
Ikaros expression was studied in eight different ALL cell lines, normal tissues, and primary leukemic cells from 59 children with ALL by Western blot analysis (Fig 1 and Table 2). Normal fetal liver–derived human lymphocyte precursor cell lines FL8.2+ (pro-B/T) and FL8.2- (pro-B) (Fig 1A) as well as normal bone marrow cells and thymocytes (Fig 1B and 1C, and Table 2) expressed a 57-kd immunoreactive protein that corresponded in size to Ik-1 and a 47-kd immunoreactive protein that corresponded to either Ik-2 or Ik-3. In contrast, the T-lineage ALL cell lines MOLT-3 cells and JK-E6-1 (data not shown, see legend of Table 2), B-lineage ALL cell lines LC1;19, KM-3, HPB-NULL, NALM-6, ALL-1, and RS4;11 (Fig 1B, lanes 1 to 6), and primary leukemic cells from 16 of 17 (94%) T-lineage ALL patients (Table 2) and 42 of 42 (100%) B-lineage ALL patients (Table 2 and Fig 1C) primarily expressed a smaller immunoreactive protein band of approximately 37 to 40 kd, which corresponded in size and electrophoretic mobility to one or more of the small non–DNA-binding Ikaros isoforms of Ik-4, Ik-5, Ik-6, Ik-7, and/or Ik-8, all of which lack critical N-terminal zinc fingers that are involved in DNA binding.



View larger version (55K):
[in this window]
[in a new window]
 
Fig 1. Western blot analysis of Ikaros protein expression in normal versus leukemic cells. (A.1 and A.2) Anti-Ikaros Western blots of whole cell lysates from Jurkat T-lineage ALL cells and normal fetal liver–derived human lymphocyte precursor cell lines FL8.2+ and FL8.2-. The positions corresponding to the size-based migration patterns of Ik-1 (~57 kd), Ik-2/Ik-3 (~47 kd), and Ik-4 through Ik-8 (~37 to 40 kd) proteins are indicated. (B) Anti-Ikaros Western blots of whole cell lysates from normal thymocytes (NTHY-5) and six different B-lineage ALL cell lines. (C) Anti-Ikaros Western blots of whole cell lysates from normal thymocytes (NTHY-4) and leukemic cells from eight children with noninfant B-lineage ALL.

 

View this table:
[in this window]
[in a new window]
 
Table 2. Ikaros Expression Profile of Leukemic Cells From Children With Acute Lymphoblastic Leukemia
 

Abnormal Subcellular Compartmentalization of Ikaros Proteins and Loss of Ikaros-Specific DNA Binding Activity in Leukemic Cells From Children With ALL
We compared the subcellular compartmentalization of Ikaros proteins in normal and fetal tissues with that of primary leukemic cells from 49 children with ALL (11 T-lineage and 38 B-lineage ALL patients), two ALL cell lines, and two normal fetal liver–derived lymphocyte precursor cell lines (FL8.2+ and FL8.2-) by confocal laser scanning microscopy (Table 2 and Fig 2). The nuclei (but not the cytoplasm) of the FL8.2+ and FL8.2- cell lines (Fig 2D and 2E), fetal thymocytes, normal thymocytes, and normal bone marrow mononuclear cells (Table 2) were stained brightly by the anti-Ikaros antibody with discrete foci of high-level expression, as evidenced by a distinct, punctate, green fluorescent staining pattern in toto-3–labeled blue nuclei. In contrast, Ikaros proteins were expressed predominantly in the cytoplasm of leukemic cells from seven of 11 children (64%) with T-lineage ALL (Table 2) and 20 of 38 children (53%) with B-lineage ALL (Fig 2A through 2C), as well as from the ALL cell lines JK-E6-1 and MOLT-3 (data not shown), as evidenced by a bright green fluorescent rim surrounding the toto-3–labeled blue nuclei. In leukemic cells from four of 11 (36%) T-lineage ALL patients and 18 of 38 (47%) B-lineage ALL patients, we found an abnormal, diffuse, patchy nuclear staining with or without cytoplasmic staining (Table 2).



View larger version (35K):
[in this window]
[in a new window]
 
Fig 2. Subcellular compartmentalization of Ikaros proteins in normal versus leukemic lymphocyte precursors. (A through C) Confocal images of leukemic cells from three B-lineage ALL patients showing cytoplasmic expression of Ikaros (ie, bright green fluorescent rim surrounding the toto-3–labeled blue nuclei). (D and E) Confocal images of normal fetal liver–derived lymphocyte precursor cell lines FL8.2+ (Pro-B/T) and FL8.2- (Pro-B) showing the characteristic multifocal nuclear localization pattern of Ikaros (ie, green fluorescent punctate staining in toto-3–labeled blue nuclei). The depicted images were representative for more than 90% of cells in each case. Table 2 lists detailed information on Ikaros expression profiles in normal and leukemic cells.

 

Molecular Characterization of Ikaros Transcripts in Leukemic Cells From Children With ALL
RT-PCR and nucleotide sequencing were used to examine normal thymocytes, normal bone marrow cells, and leukemic cells from children with ALL for the expression of PCR-amplifiable Ikaros transcripts. A single PCR product of approximately 1.4 Kb was observed in normal fetal thymocytes, and 10 of 10 different PCR clones had the coding sequence of wild-type Ik-1 (Table 2). Similarly, a single PCR product of approximately 1.2 kb was detected in normal bone marrow cells from a healthy child, and three of three different PCR clones had the coding sequence of wild-type Ik-2 (Table 2). By comparison, the predominant PCR products in leukemic cells from 20 of 21 children with ALL were smaller than Ik-2 (Table 2). Sequence analysis was successful in all 21 cases. Leukemic cells from one of the 21 ALL patients (as well as from the MOLT-3 T-lineage ALL cell line) expressed aberrant Ik-2 isoforms [Ink2(ins)] with a 20–amino acid insertion (TYGADDFRDFHAIIPKSFSR) due to a 60-bp insertion immediately upstream of exon 4 at the exon 2/exon 4 junction either alone or together with an in-frame 10–amino acid deletion, {Delta} KSSMPQKFLG, due to a 30-bp deletion at the 3' end of exon 6 (Table 2). Leukemic cells from eight of 10 (80%) T-lineage ALL patients and five of 11 (45%) B-lineage ALL patients that were analyzed expressed the non–DNA-binding Ikaros isoform Ik-4 (Table 2); two T-lineage ALL patients expressed only wild-type Ik-4. Two additional T-lineage ALL patients expressed wild-type Ik-4 along with a wild-type or aberrant (in-frame 10–amino acid deletion, {Delta} KSSMPQKFLG, due to the loss of 30 bp at the 3' end of exon 6) form of Ik-2. One T-lineage ALL patient expressed only the aberrant Ik-4 coding sequence with the 30-bp deletion at the 3' end of exon 6, whereas another T-lineage ALL patient and four B-lineage ALL patients expressed the {Delta} KSSMPQKFLG deletion form of Ik-4 along with wild-type Ik-1 and/or Ik-2. Two T-lineage ALL patients and one B-lineage ALL patients expressed both wild-type and {Delta} KSSMPQKFLG deletion forms of Ik-4 along with wild-type Ik-1 and/or Ik-2. In contrast with Ik-4, other dominant-negative isoforms of Ikaros were not frequently expressed in primary leukemic cells from children with ALL: Ik-6 was found in wild-type form in five of five PCR clones from a single B-lineage ALL patient (Table 2). Ik-7 was found in wild-type form in two of two PCR clones from a single B-lineage ALL patient and in aberrant form with the {Delta} KSSMPQKFLG deletion in at least one half of the PCR clones from one T-lineage ALL patient and one B-lineage ALL patient. Ik-8 was found in PCR clones from three of 11 B-lineage ALL patients but in none of the 10 T-lineage ALL patients (Table 2). Thus RT-PCR and sequencing extended the results obtained with confocal microscopy and Western blot analyses by confirming that primary leukemic cells from each child with ALL express small non–DNA-binding and/or aberrant isoforms of Ikaros. Among 21 cases analyzed, 19 (90.5%) expressed dominant-negative Ikaros isoforms, including Ik-4 (12 of 21 patients), Ik-6 (one of 21 patients), Ik-7 (three of 21 patients), and Ik-8 (three of 21 patients). Furthermore, in 15 of 21 cases (71.4%), the PCR clones with coding sequences of Ik-2, Ik-4, Ik-7, and Ik-8 had an identical 30-bp deletion at the 3' end of exon 6. The observed N-terminal insertions and C-terminal deletions did not cause a frame shift and, therefore, did not change the downstream amino acid sequences.

Expression of aberrant Ikaros isoforms in leukemic cells could result in cis from sequence alterations or from leukemia-associated alterations in trans-acting factors. Whereas cis activation of aberrant expression would cause mono-allelic expression of the aberrant isoforms, trans activation would be more likely to cause bi-allelic expression. We carefully examined the sequence of 128 Ikaros RT-PCR clones from 25 ALL cases for the presence of polymorphic sequence variations to determine whether the aberrant isoforms with the {Delta} KSSMPQKFLG deletion were mono- or bi-allelically expressed. We identified a single nucleotide polymorphism (SNP) within our Ikaros clones at nucleotide position 1002 (numbering from the translational start site of Ik-1; GenBank no. U40462 Human Ikaros/LYF-1 homolog [hIK-1] mRNA) as a silent variation affecting the third base of the triplet codon for a proline (CCC or CCA) within exon 7 in the highly conserved bipartite activation region (Fig 3A). This region is conserved in the various Ikaros splice variants, thereby allowing typing of all Ikaros isoforms. We observed either a C or A at this position, with the C allele being most prevalent (Fig 3B and C). Similar expression levels of the two polymorphic variant forms (C or A) of Ikaros were observed in eight of 25 cases, whereas only a single allelic variant (either C, n = 15; or A, n = 2) was observed in the remaining 17 cases. Overall, the expression frequencies were 77% (99 of 128 clones) for the 1002C allele and 23% (29 of 128 clones) for the 1002A allele. Both allelic variants were observed among wild-type and aberrant {Delta} KSSMPQKFLG DNA-binding isoforms as well as wild-type and aberrant {Delta} KSSMPQKFLG non–DNA-binding isoforms (Fig 3B and 3C). This bi-allelic expression pattern of the various Ikaros isoforms suggests that trans-acting factor(s), possibly affecting splice-site recognition, are involved in the generation of the non–DNA-binding as well as aberrant {Delta} KSSMPQKFLG Ikaros isoforms. Bi-allelic expression was observed during the sequence analysis of aberrant Ikaros {Delta} KSSMPQKFLG RT-PCR clones from individual patients expressing only the aberrant {Delta} KSSMPQKFLG forms of Ikaros or aberrant as well as wild-type forms of Ikaros (Fig 3B). This finding made it very unlikely that the observed deletions could be due to a cis-acting mutation within or surrounding the Ikaros gene. However, we also observed an excess of expression of aberrant non–DNA-binding isoforms ({Delta} KSSMPQKFLG) (91% C; 9% A) on the C allele, as well as an excess of clones expressing the aberrant DNA-binding isoforms ({Delta} KSSMPQKFLG) on the A allele (42% C; 58% A). These results suggest a more subtle cis-acting influence on splice-site recognition.



View larger version (30K):
[in this window]
[in a new window]
 
Fig 3. SNP in Ikaros cDNA demonstrates bi-allelic expression of normal and aberrant Ikaros isoforms. (A.1) A schematic diagram of the Ikaros cDNA. The zinc fingers (F1-F6) and Ikaros exons (E1-E7) are labeled. PCR primers are designated as arrows below the figure, F1 and F2 are forward PCR primers and R1 and R2 are reverse PCR primers. (A.2) Location of the SNP site (C or A at position 1002; numbering starts at translational start site in Ik-1 cDNA) in the bipartite activation domain shared by all Ikaros isoforms. (B) Bi-allelic expression of aberrant {Delta}KSSMPQKFLG DNA-binding and non–DNA-binding Ikaros isoforms in NALM-6 B-lineage ALL cells. Automated sequence traces spanning the SNP site from seven RT-PCR clones are shown. The alternative A or C at position 1002 is underlined. Typing results are shown from two Ik-4 (non–DNA-binding isoforms [WT]) clones, one Ik-4 + deletion (non–DNA-binding isoform [{Delta}KSSMPQKFLG]) clone, two Ik-2 (DNA-binding isoforms [WT]) clones, and two Ik-2 + deletion (DNA-binding isoforms [{Delta}KSSMPQKFLG]) clones. (C) Expression frequency and distribution of Ikaros 1002A and Ikaros 1002C alleles among Ikaros isoforms. This table shows a compilation of typing results of 128 Ikaros cDNA clones from both B- and T-lineage ALL cases.

 

Genomic Sequence Analysis of Splice Donor and Acceptor Site Regions in Leukemic Cells That Overexpress the {Delta} KSSMPQKFLG Alternative Splice Variants of Ikaros
The 10 amino acids involved in the {Delta} KSSMPQKFLG deletion are encoded at the 3' end of exon 6, upstream of the transcription activation domain. Genome walking across the intron-exon junctions between exons 6 and 7 yielded the wild-type sequence. For analysis of the 5' splice site, single bands were successfully obtained as a result of nested PCR from two of five genomic DNA libraries (EcoRV and SspI) provided with the GenomeWalker kit (Fig 4A). Four clones from each of these libraries were chosen for sequence analysis. Results from this initial sequence comparison(Fig 5A) showed a complete match to the 3' end of exon 6 from the Ikaros mRNA (GenBank accession no. U40462; 100% consensus). We characterized 254 bp of novel genomic sequence into the 5' end of the adjacent intron. For the 3' splice site, two of five genomic DNA libraries (DraI and SspI) provided with the GenomeWalker kit successfully produced single bands (503 bp from both libraries) as a result of nested PCR (Fig 4B). An average of four clones from each library were chosen for sequence analysis. Again, a complete match was obtained to the Ikaros mRNA (accession no. U40462) across the exon 7 sequence (Fig 6A). For this region, we characterized 340 bp of novel upstream, intronic sequence. This sequence was then used to develop primers to directly amplify this splice junction and intronic sequence from patient and cell line genomic DNA.



View larger version (64K):
[in this window]
[in a new window]
 
Fig 4. PCR products covering the exon 6/7 splice junction. (A) The nested PCR products generated by amplification of the exon 6 donor site region with the GenomeWalker kit. Distinct PCR products of 394 bp (EcoRV) or 284 bp (SspI) encompassing the exon 6 donor site were obtained. (B) The 503-bp nested PCR product surrounding the exon 7 slice acceptor site is shown, as obtained by amplification of DraI or SspI digested adapter-ligated genomic DNA. Genomic PCR amplification products for the exon 6 donor site (C and D) or the exon 7 acceptor site (E) obtained from control cells (LCL, EBV-transformed B-lymphoblastoid control cell line), leukemic cell lines (Jurkat, Molt-3), and primary leukemic cells from patients (Patient no. 1 and Patient no. 2). (C) The 342-bp PCR product surrounding the exon 6 donor site obtained with PCR primer sets (P1a and P4, or P1b and P4). (D) The 211-bp PCR product obtained by amplification of the region surrounding the exon 6 splice donor site with primer set P1b and P3. (E) The 371-bp product surrounding the exon 7 splice acceptor site obtained by amplification with primer set P5 and P6. Abbreviations: M, molecular weight markers: 1-kb DNA ladder; Neg Con, negative control, duplicate reactions without template (either library digest or genomic DNA sample); Pos Con, positive control, tissue-type plasminogen activator (tPA).

 


View larger version (54K):
[in this window]
[in a new window]
 
Fig 5. Genomic sequence analysis of Ikaros exon 6 splice donor site in leukemic patients expressing the exon 6 deletion. (A) The GenomeWalker kit was used to determine the wild-type sequence surrounding the exon 6 donor site and ending at an EcoRV site. Location of the primers (P1, P2, P3, and P4) that were used to determine this sequence are as indicated. The coding sequence is capitalized and the intronic sequence is depicted in lower case letters. The two alternative splice donor sites (donor site 1 and donor site 2) are shown. Use of the alternative donor site 1 would result in transcripts with the 30-bp deletion seen in leukemic patients. (B) Consensus sequence alignment of Ikaros exon 6 donor site in both controls and leukemic patients expressing the exon 6 deletion. Identical sequences were found in the wild-type sequence (GenomeWalker) and all genomic DNAs examined.

 


View larger version (67K):
[in this window]
[in a new window]
 
Fig 6. Genomic sequence analysis of Ikaros exon 6 splice acceptor site in leukemic cells expressing aberrant Ikaros isoforms with the 30-bp deletion in exon 6. (A) The GenomeWalker kit was used to determine the wild-type sequence surrounding the exon 6 splice acceptor site and ending at overlapping DraI and SspI sites. Primers P5, P6, and P7 were used for sequence determination. The coding sequence is capitalized and the noncoding sequence is depicted in lower case. Also shown are the location of polypyrimidine tract and branch point. (B) Consensus sequence alignment of exon 6 splice acceptor sequence in a control EBV-transformed B-lymphoblastoid cell line (LCL), two T-cell ALL cell lines (JURKAT AND MOLT-3), and leukemic cells from two ALL patients (Patient no. 1 and Patient no. 2). Identical sequences were found in the wild-type sequence (GenomeWalker) and all genomic DNAs examined.

 

Subsequent amplification and genomic sequence analysis of the corresponding exon 6/exon 7 splice junction regions from leukemic patients and cell lines that express the deletion variant demonstrated no mutation in the region spanning the cryptic splice site, as well as at the predominant 5' (donor) or 3' (acceptor) splice sites. Bands of the predicted sizes were obtained in the genomic PCR from the patient and cell line DNAs of those samples expressing the alternative splice variant (Fig 4C and 4D [5' splice site] or 4E [3' splice site]). No size differences were detected in restriction analysis of numerous cloned isolates covering both the 5' and 3' splice sites (data not shown). A minimum of six clones from each sample were sequenced for mutational analysis. Sequencing results confirmed the presence of the region between the alternative splice sites in all genomic DNAs examined. There was no mutation within a 284-bp sequence at the normal splice donor site or the region directly surrounding the deleted sequence (ie, near the cryptic splice donor site) (Fig 5A and 5B). Similarly, no mutations were found within a 328-bp exonic + intronic sequence at the 3' splice acceptor site (Fig 6).


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Ikaros is a master regulator of the earliest stages of lymphocyte ontogeny and differentiation.5-16 In the present study of 69 pediatric patients with ALL, we sought to determine if molecular abnormalities involving the Ikaros gene could contribute to the development of childhood ALL. Our findings provide unprecedented evidence that, in contrast with normal human thymocytes, bone marrow cells, and lymphocyte precursor cell lines, which express the DNA-binding Ikaros isoforms Ik-1 and Ik-2, leukemic cells from children with ALL preferentially express the alternatively spliced Ikaros mRNA species, which lack two or more of the exons 3, 4, and 5 that encode crucial DNA-binding zinc finger domains. Consequently, these leukemic cells primarily express non–DNA-binding isoforms of Ikaros (Ik-4, Ik-6, Ik-7, and Ik-8), which display abnormal subcellular compartmentalization patterns. These results indicate that the posttranscriptional regulation of alternative splicing of Ikaros pre-mRNA is defective in leukemic cells from children with ALL. The presented data are consistent with the evidence from previous studies in mice, which demonstrated that germline mutant mice that express dominant-negative isoforms of Ikaros develop lymphoblastic leukemia,10 as well as with that of our recent study in infants with ALL,25 and implicate the Ikaros gene in the leukemogenesis of childhood ALL. It is also noteworthy that other investigators have recently presented preliminary evidence that implicates the expression of the dominant-negative Ikaros isoforms in the development of lymphoid blast crisis in adult patients with chronic myelogenous leukemia.26

Our current model for the leukemia suppressor function of Ikaros and a role for non–DNA-binding Ikaros isoforms in the development of childhood ALL is illustrated in Fig 7: the DNA-binding isoforms of Ikaros form homo- and heterodimers with distinct DNA binding capabilities and specificities.12 Furthermore, other DNA binding proteins such as Aiolos27 and Helios,28,29 which can dimerize with all Ikaros isoforms via their shared C-terminal zinc finger domains to form stable multimeric complexes, act in concert with Ikaros and may partially complement its function. These different multimeric complexes are thought to control the transcription of developmentally important genes (Fig 7D) during lymphocyte ontogeny and thereby play pivotal roles for the orderly maturation of lymphocyte precursors.14 Non–DNA-binding Ikaros proteins with fewer than three N-terminal zinc fingers can act as dominant-negative regulators by interfering with the ability of DNA-binding Ikaros isoforms to form homo- and heterodimers or complexes with Aiolos and Helios.12 It is therefore conceivable that inappropriate expression of non–DNA-binding Ikaros isoforms during early lymphopoiesis may dysregulate normal lymphocyte development by impairing the expression of regulatory target genes that are essential for the orderly development and maturation of lymphocyte precursors. Such a developmental error could lead to a maturational arrest at discrete stages of lymphocyte ontogeny and predispose lymphocyte precursors to second hits and leukemic transformation. Recent studies have also indicated that Ikaros might play an important role in recruitment and centromere-associated silencing of growth regulatory genes in immature lymphocyte precursors.15,16 An abundance of non–DNA-binding or aberrant Ikaros isoforms could, therefore, interfere with centromeric recruitment and repression of potentially leukemogenic genes (Fig 7) during lymphocyte development.



View larger version (22K):
[in this window]
[in a new window]
 
Fig 7. A model for the role of dominant-negative Ikaros isoforms in leukemogenesis of childhood ALL. DNA-binding Ikaros isoforms form homo- and heterodimers, which are essential for expression of genes that are required for the orderly development and differentiation of normal lymphocyte precursors (D) as well as repression of potentially leukemogenic genes (L) by centromeric silencing. Abundant expression of non–DNA-binding isoforms may interfere with both functions of Ikaros and promote the leukemic transformation of lymphocyte precursors.

 

A recurring 30-bp in-frame deletion at the 3' end of exon 6 was detected in PCR clones of leukemic cells from 15 of 21 cases sequenced and involved the Ik-2, Ik-4, Ik-7, and Ik-8 coding sequences. The deleted peptide in these aberrant Ikaros isoforms is located in close proximity to the conserved bipartite transcription activation domain12 within the first 81 amino acids of exon 7 adjacent to the C-terminal zinc finger dimerization motifs. The structural changes caused by deletion of this peptide could affect the accessibility of the Ikaros activation domain for the aberrant Ik-2 for interactions with members of the basal transcription machinery and stability of such interactions. These aberrant Ik-2 isoforms could also be impaired in their ability to form dimers or other higher-order complexes with other Ikaros isoforms or other proteins. Such impairments could lead to altered DNA-binding or altered subcellular localization of Ikaros, as we observed in the experiments described above. These possibilities will be examined further in future experiments.

We hypothesize that a 30-bp deletion in exon 6 might have resulted from the selection of an alternative 5' splice site, because it starts with a GU sequence (ie, GT in cDNA) at the 5' junction, which could very well serve as a donor site recognition sequence. This hypothesis is strongly supported by our preliminary PCR analyses of the Ikaros genomic locus, which did not yield any evidence for a deletion mutation in leukemic cells with the aberrant mRNA species. Specifically, no mutations were found at the predominant 5' normal splice donor site or the region directly surrounding the deleted sequence near the cryptic splice donor site. Similarly, at the region of the 3' splice acceptor site, no mutation was found in either the exonic or intronic sequence. This region includes the 3' branch point30,31 and the polypyrimidine tract at the acceptor site,32 as well as the upstream, intronic sequence. Therefore, activation of the upstream cryptic splice donor site, which results in an in-frame deletion, is not due to mutation in this region, and this suggests that another unknown alternative splicing mechanism is used.33,34 We identified an SNP that affects the third base of the triplet codon for a proline (CCC or CCA) in the highly conserved bipartite activation region within our Ikaros clones. Bi-allelic expression of truncated and/or non–DNA-binding isoforms along with wild-type isoforms was observed in leukemic cells, implicating trans-acting factor(s) that affect splice site recognition in the generation of this aberrant Ikaros expression profile. It is possible that another region or protein is mutated, which results in cryptic splice site activation, such as a cis-acting regulatory element (ie, alternative splice enhancer35-37) or a trans-acting factor (ie, RNA-binding protein38). Separate detailed studies are required to determine the exact influence of both cis- and trans-acting elements on aberrant Ikaros expression in childhood leukemia.

Our results suggest a new mechanism of activation of an oncogene in ALL. Specifically, our findings reveal a new mechanism that involves the aberrant regulation of splicing, which results in overexpression of oncogenic forms of the Ikaros protein that lack the DNA binding domain and may function as dominant interfering proteins in pathways that are normally regulated by the full-length Ikaros protein. Although most of the reported molecular abnormalities in leukemia involve chromosomal translocations, which sometimes result in the generation of chimeric fusion proteins and/or point mutations, there are a few examples of aberrant splicing. In two patients with adult T-cell leukemia, both intact and truncated (without exon 4) Fas gene transcripts were detected.39 This aberrantly spliced message was not found in normal tissues. The loss of exon 4 in the Fas gene resulted in premature termination and loss of Fas antigen expression. Aberrant IRF-1 transcripts lacking exon 2 and 3 and little or no intact IRF-1 mRNA were reported in bone marrow and peripheral-blood mononuclear cells from patients with myelodysplastic syndrome.40 The aberrant IRF-1 transcript generated an abnormal protein without a transcriptional activation domain. No mutations were found within exons or splice junctions. Although the exact mechanism that causes this aberrant splicing remains to be identified, it was proposed to be a mechanism to inactivate tumor-suppressor genes.40

Taken together, our findings provide direct evidence that leukemic cells from children with ALL express high levels of non–DNA-binding isoforms or aberrant DNA-binding isoforms of Ikaros. This study establishes a previously unknown link between specific molecular defects that involve the Ikaros gene and the most common form of childhood cancer. Because the vast majority of the patients in the present study had high-risk ALL, future studies of much larger patient populations are required to determine the true incidence of Ikaros abnormalities in standard-risk ALL as well as to elucidate the potential prognostic significance of Ikaros abnormalities. Finally, our results motivate a comprehensive analysis of other hematopoietic as well as nonhematopoietic malignancies for similar changes in Ikaros expression.


    ACKNOWLEDGMENTS
 
Supported in part by Children's Cancer Group Chairman's Grant no. CA-13539 from the National Cancer Institute, National Institutes of Health (F.M.U.).


    NOTES
 
F.M.U. is a Stohlman Scholar of the Leukemia Society of America, New York, NY.

Presented in part during the Plenary Session at the Fortieth Annual Meeting of the American Society of Hematology, Miami Beach, FL, December 4-8, 1998.

The first three authors have contributed equally to this work.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
1. Poplack D: Acute lymphoblastic leukemia, in Pizzo P, Poplack D (eds): Principles and Practice of Pediatric Oncology (ed 2). Philadelphia, PA, J.B. Lippincott, 1993, pp 431-482

2. Greaves MF: Differentiation-linked leukemogenesis in lymphocytes. Science234:697-704, 1986[Abstract/Free Full Text]

3. Uckun FM, Sensel MG, Waddick KG, et al: Biology and treatment of childhood T-lineage acute lymphoblastic leukemia. Blood91:735-746, 1998[Free Full Text]

4. Crist WM, Shuster JJ, Falleta J, et al: Clinical features and outcome in childhood T-cell leukemia-lymphoma according to stage of thymocyte differentiation: A Pediatric Oncology Group Study. Blood72:1891-1897, 1988[Abstract/Free Full Text]

5. Georgopoulos K, Bigby M, Wang JH, et al: The Ikaros gene is required for the development of all lymphopid lineages. Cell79:143-156, 1994[Medline]

6. Georgopoulos K, Moore DD, Derfler B: Ikaros, an early lymphoid-specific transcription factor and a putative mediator for T cell commitment. Science258:808-812, 1992[Abstract/Free Full Text]

7. Hahm K, Ernst P, Lo K et al: The lymphoid transcription factor LyF-1 is encoded by specific, alternatively spliced mRNA derived from the Ikaros gene. Mol Cell Biol14:7111-7123, 1994[Abstract/Free Full Text]

8. Molnar A, Georgopoulos K: The Ikaros gene encodes a family of functionally diverse zinc finger DNA-binding proteins. Mol Cell Biol14:8292-8303, 1994[Abstract/Free Full Text]

9. Wang JH, Nichogiannopoulos A, Wu L et al: Selective defects in the development of the fetal and adult lymphoid system in mice with an Ikaros null mutation. Immunity5:537-549, 1996[Medline]

10. Winandy S, Wu P Georgopoulos K: A dominant mutation in the Ikaros gene leads to rapid development of leukemia and lymphoma. Cell83:289-299, 1995[Medline]

11. Molnar A, Wu P Largespada DA, et al: The Ikaros gene encodes a family of lymphocyte restricted zinc finger DNA binding proteins, highly conserved in human and mouse. J Immunol156:585-592, 1996[Abstract]

12. Sun L, Liu A, Georgopoulos K: Zinc finger-mediated protein interactions modulate Ikaros activity, a molecular control of lymphocyte development. EMBO J15:5358-5369, 1996[Medline]

13. Hansen JD, Strassburger P, Du Pasquier L: Conservation of a master hematopoietic switch gene during vertebrate evolution: Isolation and characterization of Ikaros from teleost and amphibian species. Eur J Immunol27:3049-3058, 1997[Medline]

14. Georgopoulos K, Winandy S, Avitahl N: The role of the Ikaros gene in lymphocyte development and homeostasis. Ann Rev Immunol15:155-176, 1997[Medline]

15. Brown KE, Guest SS, Smale ST, et al: Association of transcriptionally silent genes with Ikaros complexes at centromeric heterochromatin. Cell91:845-854, 1997[Medline]

16. Klug CA, Morrison SJ, Masek M, et al: Hematopoietic stem cells and lymphoid progenitors express different Ikaros isoforms, and Ikaros is localized to heterochromatin in immature lymphocytes. Proc Natl Acad Sci U S A95:657-662, 1998[Abstract/Free Full Text]

17. Smith M, Arthur D, Camitta B, et al: Uniform approach to risk classification and treatment assignment for children with acute lymphoblastic leukemia [see comments]. J Clin Oncol14:18-24, 1996[Abstract]

18. Uckun F, Reaman G, Steinherz P, et al: Improved outcome for children with T-lineage acute lymphoblastic leukemia after contemporary chemotherapy: A Children's Cancer Group Study. Leuk Lymphoma24:57-70, 1996[Medline]

19. Uckun FM, Sather HN, Gaynon P, et al: Clinical features and treatment outcome of children with myeloid antigen positive acute lymphoblastic leukemia: A report from the Children's Cancer Group. Blood90:28-35, 1997[Abstract/Free Full Text]

20. Uckun FM, Gaynon P, Sensel M, et al: Clinical features and treatment outcome of childhood T-lineage acute lymphoblastic leukemia according to the apparent maturational stage of T-lineage leukemic blasts: A Children's Cancer Group Study. J Clin Oncol15:2214-2221, 1997[Abstract/Free Full Text]

21. Uckun FM, Gajl-Peczalska KJ, Ledbetter JA, et al: Biphenotypic leukemic lymphocyte precursors in CD2+ CD19+ acute lymphoblastic leukemia and their putative normal counterparts in human fetal hematopoietic tissues. Blood73:1000-1015, 1989[Abstract/Free Full Text]

22. Uckun FM, Dibirdik I, Smith R, et al: Interleukin 7 receptor ligation stimulates tyrosine phosphorylation, inositol phospholipid turnover, and clonal proliferation of human B-cell precursors. Proc Natl Acad Sci U S A88:3589-3593, 1991[Abstract/Free Full Text]

23. Uckun FM, Herman-Hatten K, Crotty ML, et al: Clinical significance of MLL-AF4 fusion transcript expression in the absence of a cytogenetically detectable t(4;11)(q21;q23) chromosomal translocation. Blood92:810-821, 1998[Abstract/Free Full Text]

24. Uckun FM, Waddick KG, Mahajan S, et al: BTK as a mediator of radiation-induced apoptosis in DT-40 lymphoma B cells. Science273:1096-1100, 1996[Abstract]

25. Sun L, Heerema N, Crotty L, et al: Expression of dominant-negative and mutant isoforms of the anti-leukemic transcription factor Ikaros in infant acute lymphoblastic leukemia. Proc Natl Acad Sci U S A96:680-685, 1999[Abstract/Free Full Text]

26. Nakayama H, Ishimaru F, Sezaki N, et al: Ikaros gene inactivation in patients with lymphoid crisis of chronic myelogenous leukemia. Blood 92:222a, 1998 (abstr 909) (suppl 1)

27. Morgan B, Sun L, Avitahl N, et al: Aiolos, a lymphoid restricted transcription factor that interacts with Ikaros to regulate lymphocyte differentiation. EMBO J16:2004-2013, 1997[Medline]

28. Kelley CM, Ikeda T, Koipally J, et al: Helios, a novel dimerization partner of Ikaros expressed in the earliest hematopoietic progenitors. Curr Biol8:508-515, 1998[Medline]

29. Hahm K, Cobb BS, McCarty AS, et al: Helios, a T cell-restricted Ikaros family member that quantitatively associates with Ikaros at centromeric heterochromatin. Genes Dev12:782-796, 1998[Abstract/Free Full Text]

30. Cote J, Chabot B: Natural base-pairing interactions between 5' splice site and branch site sequences affect mammalian 5' splice site selection. RNA3:1248-1261, 1997[Abstract]

31. Smith CW, Nadal-Ginard B: Mutually exclusive splicing of alpha-tropomyosin exons enforced by an unusual lariat branch point location: Implications for constitutive splicing. Cell56:749-758, 1989[Medline]

32. Coolidge CJ, Seely RJ, Patton JG: Functional analysis of the polypyrimidine tract in pre-mRNA splicing. Nucleic Acids Res25:888-896, 1997[Abstract/Free Full Text]

33. Lopez AJ: Alternative splicing of pre-mRNA: Developmental consequences and mechanisms of regulation. Annu Rev Genet32:279-305, 1998[Medline]

34. Luo ZD, Camp S, Mutero A, et al: Splicing of 5' introns dictates alternative splice selection of acetylcholinesterase pre-mRNA and specific expression during myogenesis. J Biol Chem273:28486-28495, 1998[Abstract/Free Full Text]

35. Schaal TD, Maniatis T: Selection and characterization of pre-mRNA splicing enhancers: Identification of novel SR protein-specific enhancer sequences. Mol Cell Biol19:1705-1719, 1999[Abstract/Free Full Text]

36. Schaal TD, Maniatis T: Multiple distinct splicing enhancers in the protein-coding sequences of a constitutively spliced pre-mRNA. Mol Cell Biol19:261-273, 1999[Abstract/Free Full Text]

37. McCarthy EM, Phillips JA III: Characterization of an intron splice enhancer that regulates alternative splicing of human GH pre-mRNA. Hum Mol Genet7:1491-1496, 1998[Abstract/Free Full Text]

38. Burnette JM, Hatton AR, Lopez AJ: Trans-acting factors required for inclusion of regulated exons in the Ultrabithorax mRNAs of Drosophila melanogaster. Genetics151:1517-1529, 1999[Abstract/Free Full Text]

39. Tamiya S, Etoh K-I, Suzushima H, et al: Mutation of CD95(Fas/Apo-1) gene in adult T-cell leukemia cells. Blood91:3935-3942, 1998[Abstract/Free Full Text]

40. Harada H, Kondo T, Ogawa S, et al: Accelerated exon skipping of IRF-1 mRNA in human myleodysplasia/leukemia: A possible mechanism of tumor suppressor inactivation. Oncogene9:3313-3320, 1994[Medline]

Submitted February 18, 1999; accepted July 22, 1999.


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Facebook Facebook   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
BloodHome page
I. Iacobucci, C. T. Storlazzi, D. Cilloni, A. Lonetti, E. Ottaviani, S. Soverini, A. Astolfi, S. Chiaretti, A. Vitale, F. Messa, et al.
Identification and molecular characterization of recurrent genomic deletions on 7p12 in the IKZF1 gene in a large cohort of BCR-ABL1-positive acute lymphoblastic leukemia patients: on behalf of Gruppo Italiano Malattie Ematologiche dell'Adulto Acute Leukemia Working Party (GIMEMA AL WP)
Blood, September 3, 2009; 114(10): 2159 - 2167.
[Abstract] [Full Text] [PDF]


Home page
haematolHome page
I. Iacobucci, A. Lonetti, D. Cilloni, F. Messa, A. Ferrari, R. Zuntini, S. Ferrari, E. Ottaviani, F. Arruga, S. Paolini, et al.
Identification of different Ikaros cDNA transcripts in Philadelphia-positive adult acute lymphoblastic leukemia by a high-throughput capillary electrophoresis sizing method
Haematologica, December 1, 2008; 93(12): 1814 - 1821.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
I. Iacobucci, A. Lonetti, F. Messa, D. Cilloni, F. Arruga, E. Ottaviani, S. Paolini, C. Papayannidis, P. P. Piccaluga, P. Giannoulia, et al.
Expression of spliced oncogenic Ikaros isoforms in Philadelphia-positive acute lymphoblastic leukemia patients treated with tyrosine kinase inhibitors: implications for a new mechanism of resistance
Blood, November 1, 2008; 112(9): 3847 - 3855.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. L. Kathrein, S. Chari, and S. Winandy
Ikaros Directly Represses the Notch Target Gene Hes1 in a Leukemia T Cell Line: IMPLICATIONS FOR CD4 REGULATION
J. Biol. Chem., April 18, 2008; 283(16): 10476 - 10484.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
R. Caballero, F. Setien, L. Lopez-Serra, M. Boix-Chornet, M. F. Fraga, S. Ropero, D. Megias, M. Alaminos, E. M. Sanchez-Tapia, M. C. Montoya, et al.
Combinatorial effects of splice variants modulate function of Aiolos
J. Cell Sci., August 1, 2007; 120(15): 2619 - 2630.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Z. Zhang, C. S. Swindle, J. T. Bates, R. Ko, C. V. Cotta, and C. A. Klug
Expression of a non-DNA-binding isoform of Helios induces T-cell lymphoma in mice
Blood, March 1, 2007; 109(5): 2190 - 2197.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Ronni, K. J. Payne, S. Ho, M. N. Bradley, G. Dorsam, and S. Dovat
Human Ikaros Function in Activated T Cells Is Regulated by Coordinated Expression of Its Largest Isoforms
J. Biol. Chem., January 26, 2007; 282(4): 2538 - 2547.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. Liu, Y. Ge, S. G. Payton, A. Aboukameel, S. Buck, R. M. Flatley, C. Haska, R. Mohammad, J. W. Taub, and L. H. Matherly
Transcriptional Regulation of the Human Reduced Folate Carrier in Childhood Acute Lymphoblastic Leukemia Cells
Clin. Cancer Res., January 15, 2006; 12(2): 608 - 616.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. Dumortier, R. Jeannet, P. Kirstetter, E. Kleinmann, M. Sellars, N. R. dos Santos, C. Thibault, J. Barths, J. Ghysdael, J. A. Punt, et al.
Notch Activation Is an Early and Critical Event during T-Cell Leukemogenesis in Ikaros-Deficient Mice
Mol. Cell. Biol., January 1, 2006; 26(1): 209 - 220.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
K. L. Kathrein, R. Lorenz, A. M. Innes, E. Griffiths, and S. Winandy
Ikaros Induces Quiescence and T-Cell Differentiation in a Leukemia Cell Line
Mol. Cell. Biol., March 1, 2005; 25(5): 1645 - 1654.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. J. Payne, G. Huang, E. Sahakian, J. Y. Zhu, N. S. Barteneva, L. W. Barsky, M. A. Payne, and G. M. Crooks
Ikaros Isoform X Is Selectively Expressed in Myeloid Differentiation
J. Immunol., March 15, 2003; 170(6): 3091 - 3098.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. Nishii, N. Katayama, and H. Shiku
Adult acute myeloid leukemia cells do not express nonfunctional Ikaros isoforms
Blood, October 16, 2002; 100(9): 3436 - 3436.
[Full Text] [PDF]


Home page
BloodHome page
F. Ishimaru, T. Yagi, S. Hibi, M. Takanashi, G. Kano, Y. Tabata, T. Imamura, T. Inaba, A. Morimoto, S. Todo, et al.
Expression of Ikaros isoforms in patients with acute myeloid leukemia
Blood, July 30, 2002; 100(4): 1511 - 1513.
[Full Text] [PDF]


Home page
BloodHome page
T. Yagi, S. Hibi, M. Takanashi, G. Kano, Y. Tabata, T. Imamura, T. Inaba, A. Morimoto, S. Todo, and S. Imashuku
High frequency of Ikaros isoform 6 expression in acute myelomonocytic and monocytic leukemias: implications for up-regulation of the antiapoptotic protein Bcl-XL in leukemogenesis
Blood, February 15, 2002; 99(4): 1350 - 1355.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. J. Payne, J.-H. Nicolas, J. Y. Zhu, L. W. Barsky, and G. M. Crooks
Cutting Edge: Predominant Expression of a Novel Ikaros Isoform in Normal Human Hemopoiesis
J. Immunol., August 15, 2001; 167(4): 1867 - 1870.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. L. Guzman, D. Upchurch, B. Grimes, D. S. Howard, D. A. Rizzieri, S. M. Luger, G. L. Phillips, and C. T. Jordan
Expression of tumor-suppressor genes interferon regulatory factor 1 and death-associated protein kinase in primitive acute myelogenous leukemia cells
Blood, April 1, 2001; 97(7): 2177 - 2179.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
C. Tunyaplin, M. A. Shapiro, and K. L. Calame
Characterization of the B lymphocyte-induced maturation protein-1 (Blimp-1) gene, mRNA isoforms and basal promoter
Nucleic Acids Res., December 15, 2000; 28(24): 4846 - 4855.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. Nakase, F. Ishimaru, N. Avitahl, H. Dansako, K. Matsuo, K. Fujii, N. Sezaki, H. Nakayama, T. Yano, S. Fukuda, et al.
Dominant Negative Isoform of the Ikaros Gene in Patients with Adult B-Cell Acute Lymphoblastic Leukemia
Cancer Res., August 1, 2000; 60(15): 4062 - 4065.
[Abstract] [Full Text]


Home page
JCOHome page
F. Ishimaru and F. M. Uckun
Expression of Ikaros Isoforms in Acute Lymphoblastic Leukemia Cell Lines
J. Clin. Oncol., March 13, 2000; 18(6): 1395 - 1397.
[Full Text] [PDF]


Home page
RadiologyHome page
M. J. Cooney, W. G. Bradley, S. C. Symko, S. T. Patel, and P. K. Groncy
Hypertensive Encephalopathy: Complication in Children Treated for Myeloproliferative Disorders-Report of Three Cases
Radiology, March 1, 2000; 214(3): 711 - 716.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
J. Perdomo, M. Holmes, B. Chong, and M. Crossley
Eos and Pegasus, Two Members of the Ikaros Family of Proteins with Distinct DNA Binding Activities
J. Biol. Chem., December 1, 2000; 275(49): 38347 - 38354.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sun, L.
Right arrow Articles by Uckun, F. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sun, L.
Right arrow Articles by Uckun, F. M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

About
JCO
 Editorial
Roster
 Advertising
Information
 Librarians &
Institutions
 Rights &
Permissions
 PDA Services

Copyright © 1999 by the American Society of Clinical Oncology, Online ISSN: 1527-7755. Print ISSN: 0732-183X
Terms and Conditions of Use
  HighWire Press HighWire Press™ assists in the publication of JCO Online