Advertisement
Journal of Clinical Oncology  
Search for:
Limit by:
  Browse by Subject or Issue
Home Search or Browse JCO My JCO Subscriptions Customer Service Site Map

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Castells, A.
Right arrow Articles by Farré, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Castells, A.
Right arrow Articles by Farré, A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
Journal of Clinical Oncology, Vol 17, Issue 2 (February), 1999: 578
© 1999 American Society for Clinical Oncology

K-ras Mutations in DNA Extracted From the Plasma of Patients With Pancreatic Carcinoma: Diagnostic Utility and Prognostic Significance

Antoni Castells, Pere Puig, Josefina Móra, Jaume Boadas, Loreto Boix, Eulàlia Urgell, Manel Solé, Gabriel Capellà, Fèlix Lluís, Laureano Fernández-Cruz, Salvador Navarro, Antoni Farré

From the Institut Clínic de Malalties Digestives and Department of Pathology, Institut d'Investigacions Biomèdiques August Pi i Sunyer, Hospital Clínic i Provincial, University of Barcelona; and Departments of Biochemistry, Gastroenterology, and Surgery, and Laboratori d'Investigació Gastrointestinal, Hospital de la Santa Creu i Sant Pau, Barcelona, Catalonia, Spain.

Address reprint requests to Antoni Castells, MD, Molecular Neurogenetics Unit, Massachusetts General Hospital, 149 13th St, 6th Floor, Charlestown, MA 02129; email castells{at}helix.mgh.harvard.edu


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
PURPOSE: Previous studies have demonstrated the presence of K-ras mutations in the plasma of patients with pancreatic carcinoma. However, the diagnostic utility and the prognostic significance of this finding have never been addressed.

PATIENTS AND METHODS: Forty-four consecutive patients with histologically confirmed primary pancreatic ductal adenocarcinoma were included. A control group of 37 patients with chronic pancreatitis, 10 patients with other tumors of the pancreatic area, nine patients with acute pancreatitis, and four healthy volunteers was also included. Plasma DNA was isolated and K-ras codon-12 mutations were analyzed by means of restriction fragment length polymorphism-polymerase chain reaction and single-strand conformation polymorphism techniques. Patients were followed up to establish their clinical outcome.

RESULTS: The mutant-type K-ras gene was found in plasma DNA samples of 12 (27%) of 44 patients with pancreatic ductal adenocarcinoma; this finding was related to the tumor stage (P = .05), mainly in the presence of distant metastases (P = .02). In addition, K-ras mutations were detected in the plasma DNA of two (5%) of 37 patients with chronic pancreatitis. In the subset of patients with pancreatic masses, the sensitivity and specificity of plasma K-ras analysis for pancreatic adenocarcinoma were 27% and 100%, respectively. Finally, pancreatic carcinoma patients with the mutant-type K-ras gene in plasma DNA exhibited a shorter survival time than patients with the wild-type gene (P < .005), and plasma K-ras mutations were identified as the only independent prognostic factor (odds ratio, 1.51; 95% confidence interval, 1.02 to 2.23).

CONCLUSION: Plasma K-ras analysis is a highly specific, low-sensitivity approach that has diagnostic and prognostic clinical implications in patients with pancreatic carcinoma.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
PANCREATIC CARCINOMA represents the fourth leading cause of cancer death in Western countries.1 Patients with this neoplasm have a median survival time of 6 months after their initial diagnosis.2,3 Although there have been advances in imaging techniques, diagnosing the disease remains difficult, and as a result, most patients exhibit disseminated disease.2-4 Additionally, abdominal or endoscopic ultrasound-guided, fine-needle aspiration biopsy specimens often constitute the only sample amenable for cytologic confirmation of the disease.5

ras mutations are found in 80% to 90% of pancreatic carcinoma patients, usually at codon 12 of the K-ras gene.6-9 This high incidence of mutations suggests that the K-ras gene may constitute a useful tumor marker. In fact, in vitro amplification of DNA has been used extensively in pancreatic cancer from fine-needle aspirates,10-12 pancreatic juice,13-15 and feces,16 thus increasing the diagnostic utility of aspiration biopsy or endoscopic retrograde cholangiopancreatography. On the other hand, it is well known that small amounts of free DNA are found in the plasma or serum of neoplastic patients.17,18 With the use of polymerase chain reaction (PCR) techniques, microsatellite alterations have been detected in the plasma DNA of patients with small-cell lung cancer19 and in the serum DNA of patients with head and neck cancer,20 and K-ras mutations have been found in the plasma DNA of patients with colorectal21 and pancreatic neoplasms.13,22,23 Preliminary studies in pancreatic cancer, however, have not assessed the relevance of this finding in clinical practice.

The present prospective investigation was aimed at determining the presence of K-ras mutations in the peripheral blood of pancreatic carcinoma patients. The accuracy of this approach was established by comparing a large series of patients in different stages of pancreatic adenocarcinoma with a control group that included not only healthy subjects but also patients with other pancreatic disorders. Inclusion of patients with chronic pancreatitis was important because K-ras mutations have been found in the pancreas24,25 and pancreatic juice from nonneoplastic cases.15,26 The diagnostic utility of this procedure was addressed in the setting of those patients with pancreatic masses, and its prognostic significance was established in a follow-up study by means of a multivariate analysis. Finally, K-ras mutations were looked for both in the plasma and in the buffy coat layer in order to determine whether they corresponded to naked DNA released from the primary tumor or, conversely, whether they derived from whole neoplastic circulating cells.


    PATIENTS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Patients
Between July 1996 and August 1997, 44 consecutive patients with histologically confirmed primary pancreatic ductal adenocarcinoma were included in the study. The mean age was 62 ± 12 years, and there were 25 men and 19 women. Tumors were staged by means of dynamic computed tomography, magnetic resonance imaging, and angiography and/or endoscopic ultrasonography. When patients underwent surgery, definitive tumor stage was established on the basis of operative findings. On the basis of the tumor-node-metastasis (TNM) system,27 four patients were classified in stage I, 11 in stage II, five in stage III, and 23 in stage IV. Tumor stage could not be assessed in the remaining patient because of the lack of accurate information.

Control group subjects were recruited during the same time period and included 37 patients with chronic pancreatitis, 10 patients with other tumors of the pancreatic area (five had cholangiocarcinoma of the distal intrapancreatic common bile duct, two had mucinous adenoma, one had pancreatic metastasis, one had a neuroendocrine tumor, and one had an estromal tumor of the duodenal wall), nine patients with acute pancreatitis, and four healthy volunteers. The diagnosis of chronic pancreatitis was based on radiologic data obtained by means of either endoscopic retrograde cholangiopancreatography or computed tomography.28

Peripheral venous blood samples (20 mL) were obtained by means of a standard venipuncture technique, using heparinized tubes. In patients with pancreatic tumors, the blood sample was collected before any therapeutic procedure. In patients who underwent endoscopic retrograde cholangiopancreatography, the sample was collected before this diagnostic technique was performed.

The study protocol was approved by the ethics of research committees of both institutions (Hospital Clínic i Provincial and Hospital de la Santa Creu i Sant Pau), and informed consent was obtained from each patient. The study was performed in a blind fashion, so that patients' clinical characteristics were unknown by the investigator performing the molecular analysis on the blood samples. In addition, each sample was analyzed twice. All patients were followed up to determine their clinical outcome. Survival analysis was done in December 1997.

DNA Extraction From the Plasma
Plasma DNA was purified on QIAamp spin columns (QIAamp blood kit; Qiagen, Basel, Switzerland). In brief, 1 mL of plasma was pipetted into a microfuge tube. Lysis was ensured by adding and mixing 125 µL of Qiagen protease solution and 1,000 µL of buffer AL (QIAamp blood kit). After a 10-minute incubation at 70°C, 1,100 µL of ethanol was added. To improve the recovery of small amounts of DNA, 20 ng of tRNA from baker's yeast (Boehringer Mannheim, Indianapolis, IN) was added as a carrier before precipitation.29 The mixture was carefully applied to the QIAamp column and centrifuged at 8,000 x g for 1 minute; the filtrate was discarded. Then, 500 µL of buffer AW (QIAamp blood kit) was added and centrifuged twice at 8,000 x g for 1 minute. DNA in the QIAamp column was eluted with 200 µL of buffer AE (QIAamp blood kit), incubated at room temperature for 1 minute, and then centrifuged at 11,000 x g for 3 minutes.

DNA Extraction From the Buffy Coat Layer
Mononuclear cells from peripheral blood samples were isolated using a Ficoll gradient. Samples were first diluted with 30 mL of phosphate-buffered saline, then layered on 15 mL of Ficoll gradient solution, and then centrifuged at 700 x g for 30 minutes. Mononuclear cells, localized in the interphase between plasma and Ficoll, were collected and precipitated by centrifugation at 1,000 x g for 10 minutes. After pellets were washed with phosphate-buffered saline, they were digested with proteinase K followed by saline precipitation.29

DNA Extraction From Cytohistologic Specimens
In 39 patients with pancreatic ductal adenocarcinoma, the presence of K-ras mutations could be determined in cytohistologic specimens obtained either at surgery (n = 7), by fine-needle aspiration biopsy of pancreatic nodules or distant metastases (n = 25), by diagnostic paracentesis (n = 2), or by aspiration of pancreatic juice during endoscopic retrograde cholangiopancreatography (n = 5). In the remaining five pancreatic carcinoma patients, there was not sufficient material with which to carry out the molecular analysis. The presence of K-ras mutations was also analyzed in the cytohistologic specimens of patients with chronic pancreatitis (n = 26) who underwent endoscopic retrograde cholangiopancreatography (n = 25) or surgery (n = 1).

The pancreatic juice collected at endoscopic retrograde cholangiopancreatography was centrifuged at 12,000 rpm for 5 minutes. Aspirates from pancreatic tissue were fixed in 50% ethanol and centrifuged, and a paraffin cell block was made. Several sections of the cell block were examined after staining with hematoxylin and eosin. One hematoxylin-and-eosin–stained, 5- to 10-µm slice was used for microscopic examination, and DNA was extracted from the adjacent slide, after paraffin was removed with 500 µL of xylene. The sample was then washed twice with 100% ethanol and dried. In all samples obtained by fine-needle aspiration biopsy, a minimum of 30% of tumor cells was present. Tissue DNA extraction was performed by using proteinase K treatment followed by phenol-chloroform extraction and isopropanol precipitation.

Detection of K-ras Codon-12 Mutations by Restriction Fragment Length Polymorphism-PCR
Mutations at codon 12 of the K-ras gene were detected by using a primer-mediated restriction fragment length polymorphism method after in vitro amplification with the PCR technique. The BstNI (New England Biolabs Inc, Beverly, MA) restriction enzyme method described by Jiang et al30 was applied with minor modifications. First-round amplification of exon 1 of the K-ras gene was performed using primers K1USO (5' GGTGGAGTATTTGATAGTGTA 3') and K-ras3' (5' TCAAAGAATGGTCCTGGACC 3') for 30 cycles (54°C for 15 seconds, 72°C for 30 seconds, and 92°C for 15 seconds) in a Hibaid Omnigene Thermalcycler (Teddington, United Kingdom). The PCR assay was performed in a volume of 50 µL containing PCR buffer, 1.5 mmol MgCl2, 0.2 µmol deoxynucleotides (Promega Corp., Madison, WI), 1 unit of Taq polymerase (Life Technologies Inc, Gaithersburg, MD), and 150 ng of the PCR primers. As an internal control of the enzymatic digestion, samples were reamplified using the mutant primer K-ras3' mentioned above. To create a restriction site for the enzyme BstNI (CCTGG), which is lost whenever a mutation occurs at codon 12, the mutant primer K-ras5' (5' ACTGAATATAAACTTGTGGTAGTTGGACCT 3') was used for 30 cycles. After enzymatic digestion, samples were electrophoresed in a 6% polyacrylamide gel. The 143-base pair fragment depicts the presence of the mutant allele, and a 114-base pair band depicts the normal allele. The sensitivity of detection was a mutant–normal allele ratio of 10-2. Control samples prepared with different proportions of mutant allele, as well as positive and negative control samples, were included in every experiment.

Characterization of K-ras Mutations by the Single-Strand Conformation Polymorphism Method
K-ras codon 12 mutations were characterized by the single-strand conformation polymorphism method, as previously described.31 In brief, 8 µL of PCR product were diluted in 16 µL of formamide-dye denaturing buffer and incubated for 4 minutes at 95°C. Tubes were cooled on ice for 3 minutes, and 5 µL of the solution was loaded onto 9% polyacrylamide gels. Electrophoresis was carried out at room temperature under 5 W for 16 to 18 hours. Gels were dyed with silver stain and vacuum dried at 85°C.

Statistical Analysis
Continuous variables are expressed as mean ± SD. Length of follow-up is described as median and range. Correlations between qualitative variables were evaluated by means of the {chi}2 test; the Yates correction was applied when necessary. Continuous variables with nonparametric distribution were compared by means of the Mann-Whitney U test.

The prognostic value of K-ras mutations in peripheral blood was assessed with a multivariate approach including other parameters with a predictive influence on survival, such as age, sex, tumor size and location, presence of vascular invasion, tumor stage according to the TNM system,27 and K-ras status in tissue samples. All data were obtained at inclusion. Survival time was considered from the date of diagnosis. Univariate analysis was performed by computing survival curves according to the Kaplan-Meier method32 and comparing them through the Mantel-Cox and Breslow tests. For continuous variables, the cutoff level chosen was their median value. Variables that achieved statistical significance (P < .05) in the univariate analysis were subsequently included in a multivariate analysis using a stepwise forward Cox regression procedure.33 All calculations were performed by using the SPSS statistical software package (SPSS Inc, Chicago, IL).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
K-ras Mutations in Pancreatic Adenocarcinoma Patients
The mutant-type K-ras gene was found in plasma DNA samples of 12 (27%) of 44 patients with pancreatic ductal adenocarcinoma (Table 1 and Fig 1). K-ras alterations included aspartic acid (n = 5), valine (n = 3), alanine (n = 2), and arginine (n = 2) (Table 2). The wild-type K-ras gene was found in all DNA samples extracted from the buffy coat layers of those 44 patients.


View this table:
[in this window]
[in a new window]
 
Table 1. Detection of K-ras Mutations in DNA Extracted From the Plasma
 


View larger version (59K):
[in this window]
[in a new window]
 
Fig 1. Detection of K-ras codon-12 mutations by restriction fragment length polymorphism-PCR. Lanes 1 and 12, molecular weight scale; lane 2, uncut PCR product (157 base pairs, U); lane 3, positive control (143-base pair mutant band, M); lanes 4 through 9, plasma DNA from pancreatic carcinoma patients; lane 10, negative control (114-base pair wild-type band, N); lane 11, control sample without DNA.

 

View this table:
[in this window]
[in a new window]
 
Table 2. Summary of the Mutations at Codon 12 of the K-ras Gene in Patients With Pancreatic Adenocarcinoma or Chronic Pancreatitis
 

The presence of the mutant-type K-ras gene in the plasma DNA of these patients was not related to age, sex, tumor site, tumor size, nor vascular involvement (Table 3). In contrast, K-ras mutations in plasma were correlated with tumor stage (P = .05), mainly in the presence of distant metastases (P = .02) (Table 3).


View this table:
[in this window]
[in a new window]
 
Table 3. Variables Associated With K-ras Gene Mutations in Plasma DNA Obtained From Patients With Pancreatic Adenocarcinoma
 

In the 39 pancreatic carcinoma patients in whom both plasma and tissue samples were available, the correlation of K-ras mutations was analyzed. Twenty-eight patients (72%) exhibited K-ras mutations in their primary tumor, with nine (32%) of them showing an identical alteration in the corresponding plasma DNA sample. Otherwise, mutations were not detected in plasma samples of the remaining 11 patients whose primary tumor was negative for K-ras.

K-ras Mutations in the Control Group
K-ras mutations were detected in the plasma DNA of two (5%) of 37 patients with chronic pancreatitis (aspartic acid type) (Tables 1 and 2). In the remaining 35 patients, the wild-type K-ras gene was observed. On the other hand, no K-ras mutations were found in the buffy coat layer DNA samples of any patient with chronic pancreatitis.

The correlation of K-ras mutations between plasma and pancreatic juice or tissue was analyzed in those 26 chronic pancreatitis patients in whom both samples were available. No plasma K-ras mutations were observed in 21 patients with negative pancreatic juice. Of the two patients with K-ras mutations in their plasma DNA, one patient exhibited the same alteration in the pancreatic tissue specimen obtained when he underwent a partial pancreatectomy as a consequence of untreatable abdominal pain. No mutation was detected in DNA extracted from the pancreatic juice of the second patient with the mutant-type K-ras gene in plasma DNA (Table 2). Finally, three patients showed K-ras mutations in DNA obtained from the pancreatic juice, but no alteration was detected in the corresponding plasma sample.

The above-mentioned five chronic pancreatitis patients with K-ras mutations in DNA extracted from either plasma, pancreatic juice, or pancreatic tissue were studied extensively by means of endoscopic retrograde cholangiopancreatography, abdominal computed tomography, and endoscopic ultrasonography. No evidence of neoplastic disease was found. Pathologic examination of a resected pancreatic specimen from the patient who underwent surgery confirmed the absence of malignant proliferation. In addition, after a median follow-up of 9 months (range, 6 to 17 months), no chronic pancreatitis patient with K-ras mutations had developed a pancreatic carcinoma.

No K-ras mutations were found in the plasma (Table 1) or buffy coat layer DNA samples of any patient with acute pancreatitis or other neoplasms of the pancreatic area, nor in healthy volunteers.

Diagnostic Utility of Plasma K-ras Mutations in Pancreatic Masses
The diagnostic utility of detecting plasma K-ras mutations was assessed in the 56 patients with pancreatic masses (Table 4). The final diagnosis of this subset of patients was pancreatic ductal adenocarcinoma in 44 cases, other tumors of the pancreatic area in 10 cases, and pseudotumoral chronic pancreatitis in two cases. In this setting, plasma K-ras mutations were found in only 12 patients with pancreatic carcinoma, whereas the wild-type K-ras gene was observed in all remaining patients (Table 4). Considering these data, the sensitivity and specificity of plasma K-ras analysis for pancreatic adenocarcinoma were 27% and 100%, respectively, in patients with pancreatic masses.


View this table:
[in this window]
[in a new window]
 
Table 4. Diagnostic Utility of Plasma K-ras Mutation Analysis in the 56 Patients Who Presented With Pancreatic Masses
 

Prognostic Significance of Plasma K-ras Mutations in Pancreatic Carcinoma Patients
After a median follow-up of 7 months (range, 3 to 16 months), 35 (79%) of 44 pancreatic carcinoma patients had died. Patients with plasma K-ras mutations exhibited a shorter probability of survival than those with the wild-type gene (17% v 41% at 6 months, and 0% v 24% at 12 months, respectively; Mantel, P < .005, Breslow, P < .005) (Fig 2). Moreover, the tumor stage was also found to have predictive value with regard to the survival of pancreatic cancer patients (Mantel, P < .01, Breslow, P < .05). On the other hand, when survival analysis was limited to those 28 patients presenting K-ras mutations in their primary tumor, both the presence of plasma K-ras mutations (Mantel, P < .005, Breslow, P < .005) (Fig 2) and TNM tumor stage (Mantel, P < .02, Breslow, P < .05) persisted as prognostic variables.



View larger version (15K):
[in this window]
[in a new window]
 
Fig 2. Probability of survival of pancreatic adenocarcinoma patients with the wild-type (solid line) or the mutant-type (dashed line) K-ras gene in plasma DNA samples, considering both the whole series (top) and only those cases in which the primary tumor exhibited K-ras mutations (bottom).

 

Finally, when both parameters selected in the univariate analysis were included in a stepwise Cox regression model, plasma K-ras mutations were identified as the only independent predictive factor of survival (odds ratio, 1.51; 95% confidence interval, 1.02 to 2.23).


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The results of the present investigation confirm that it is possible to identify K-ras mutations in DNA extracted from the plasma of patients with pancreatic carcinoma. The plasma DNA of these patients, as well as the plasma DNA from patients with small-cell lung cancer, head and neck neoplasms, and colorectal carcinoma,19-23 shared identical molecular characteristics (gene mutations or microsatellite alterations) with patients' primary tumors, thus suggesting its neoplastic origin. In that sense, without considering any clinical usefulness, the analysis of plasma DNA represents a worthwhile, noninvasive way to obtain genetic material suitable for molecular investigations in patients with malignant neoplasms. This approach is especially significant in pancreatic carcinoma patients, because obtaining cytohistologic specimens from these patients is arduous.

Our data show that detection of plasma K-ras mutations is a high-specificity, low-sensitivity method of diagnosing pancreatic carcinoma. Accordingly, it may become a confirmatory tool in those cases in which a more invasive approach is contraindicated. The absence of plasma K-ras mutations in early tumor stages would preclude the possibility of carrying out screening strategies on in-risk populations on the basis of the detection of mutant plasma DNA. Advances in this setting should be focused on improving the sensitivity of the technique and identifying new targets involved in early neoplastic stages. Finally, if one takes into account that plasma K-ras mutations are correlated with the presence of distant metastases, this approach may be especially useful in tumor staging and in monitoring both disease spread and tumor recurrence.

On the other hand, it is important to note that five of 37 patients with chronic pancreatitis and with no evidence of neoplastic degeneration showed K-ras mutations in either their plasma or pancreatic juice. Similarly, recent studies have demonstrated the presence of K-ras mutations in hyperplastic mucous cells of the pancreas with chronic inflammation.16,25 The exact significance of this observation is unclear; some authors suggest that K-ras mutations are an early event in pancreatic carcinogenesis. However, K-ras mutations have also been found in hyperplastic duct cells of the pancreas without pancreatic disease,24 and long-term follow-up of patients with chronic pancreatitis carrying this mutated gene failed to demonstrate any relationship with the development of pancreatic neoplasm.26 To clarify such contradictory data, a prospective study of a large number of patients is mandatory. In this way, the possibility of detecting K-ras mutations in peripheral blood by means of a noninvasive technique may help to clarify the clinical significance of this finding.

The origin of mutated plasma DNA in patients with cancer is uncertain. Because the mutated plasma DNA carries the same molecular alterations as the primary tumor, it is tempting to hypothesize that neoplastic cell lysis leads to the release of naked DNA into the circulation.19-21 Nevertheless, its derivation from whole circulating cancer cells needs to be considered. In fact, several authors, using PCR and targeting tissue-specific gene transcription, have identified circulating cancer cells in patients with different neoplasms,34-36 including pancreatic adenocarcinoma.13,37 The correlation observed between plasma DNA mutations and distant metastases in our study supports this possibility. By contrast, the lack of K-ras mutations in DNA extracted from the buffy coat layer makes the eventual presence of whole cancer cells in peripheral blood very unlikely. Still, it should be kept in mind that neoplastic cells are supposed to be circulating in clusters, and consequently, their recognition could be hampered by a single blood sample extraction. Finally, large amounts of nonmutated DNA coming from leukocytes held in the buffy coat layer might also mask some vestiges of the mutant-type K-ras gene.

The presence of plasma K-ras mutations was identified as an independent prognostic factor in pancreatic adenocarcinoma patients. In fact, subjects with mutated plasma DNA exhibited a shorter survival time than those with the wild-type K-ras gene. However, this result needs to be qualified. First, the plasma K-ras mutation variable was included in the final equation of the Cox analysis with a weak statistical significance. This result suggests a strong collinearity between this parameter and the tumor stage. Second, the present study was composed primarily of patients with very advanced disease. As a result, a bias due to an unbalanced tumor stage could not be ruled out. Finally, the statistical power of the present analysis is undoubtedly hampered by the grim prognosis of the overall series. Accordingly, a definitive conclusion with regard to the prognostic significance of plasma DNA mutations should be postponed until the end of follow-up studies that include a larger number of patients in different tumor stages.

In conclusion, the results of the present study indicate that plasma K-ras analysis is a high-specificity, low-sensitivity approach in pancreatic carcinoma patients and suggest that a plasma-based assay may have a role in the diagnostic and prognostic assessment of these patients. Further investigations are needed to confirm these results, to improve the technique's sensitivity, and to establish its usefulness in the early diagnosis and in-risk group screening of pancreatic cancer.


    ACKNOWLEDGMENTS
 
Supported in part by a grant from the Plan Nacional de Investigación Científica y Desarrollo Tecnológico (SAF97-0107). P.P. and L.B. received research grants (95/26 and 95/3008) from the Marató TV3-Càncer.

We thank Dr Anil K. Rustgi for his critical review of the manuscript, Laura Gargallo for her efficient nursing support, and Paula Simpson-O'Brien for editorial assistance.


    NOTES
 
The first two authors contributed equally to this study.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
1. Boring C, Squires TS, Taong T: Cancer statistics, 1993. CA Cancer J Clin 43:7-26, 1993[Medline]

2. Warshaw AL, Fernández-del-Castillo C: Pancreatic carcinoma. N Engl J Med 326:455-465, 1992[Medline]

3. Rosewicz S, Wiedenmann B: Pancreatic carcinoma. Lancet 349:485-489, 1997[Medline]

4. Rösch T Braig C, Gain T, et al: Staging of pancreatic and ampullary carcinoma by endoscopic ultrasonography. Gastroenterology 102:188-199, 1992[Medline]

5. Brandt KR, Vcharboneau JW, Stephens DH, et al: CT- and US-guided biopsy of the pancreas. Radiology 187:99-104, 1993[Abstract/Free Full Text]

6. Almoguera C, Shibata D, Forrester K, et al: Most human carcinomas of the exocrine pancreas contain mutant K-ras genes. Cell 53:549-553, 1988[Medline]

7. Smit V, Boot A, Smits A, et al: K-ras codon 12 mutations occur very frequently in pancreatic adenocarcinomas. Nucleic Acids Res 16:7773-7782, 1988[Abstract/Free Full Text]

8. Grünewald K, Lyons J, Fröhlich A, et al: High frequency of Ki-ras codon 12 mutations in pancreatic adenocarcinomas. Int J Cancer 43:1037-1041, 1989[Medline]

9. Shibata D, Capellà G, Perucho M: Mutational activation of the K-ras gene in human pancreatic carcinoma. Baillieres Clin Gastroenterol 4:151-169, 1991

10. Shibata D, Almoguera C, Forrester K, et al: Detection of K-ras mutations in fine needle aspirates from human pancreatic cancer. Cancer Res 50:1279-1283, 1990[Abstract/Free Full Text]

11. Tada M, Omata M, Ohto M: Clinical application of ras gene mutation for diagnosis of pancreatic adenocarcinoma. Gastroenterology 100:233-238, 1991[Medline]

12. Villanueva A, Reyes G, Cuatrecasas M, et al: Diagnostic utility of K-ras mutations in fine-needle aspirates of pancreatic masses. Gastroenterology 110:1587-1594, 1996[Medline]

13. Tada M, Omata M, Kawai S, et al: Detection of ras gene mutations in pancreatic juice and peripheral blood of patients with pancreatic adenocarcinoma. Cancer Res 53:2472-2474, 1993[Abstract/Free Full Text]

14. Berthélemy P, Bouisson M, Escourrou J, et al: Identification of K-ras mutations in pancreatic juice in the early diagnosis of pancreatic cancer. Ann Intern Med 123:188-191, 1995[Abstract/Free Full Text]

15. Boadas J, Mora J, Roca M, et al: Analysis of the utility of K-ras mutations in pancreatic juice in the diagnosis of pancreatic cancer. Pancreas 15:464, 1997

16. Caldas C, Hahn SA, Hruban RH, et al: Detection of K-ras mutations in the stool of patients with pancreatic adenocarcinoma and pancreatic ductal hyperplasia. Cancer Res 54:3568-3573, 1994[Abstract/Free Full Text]

17. Leon SA, Shapiro B, Sklaroff DM, et al: Free DNA in the serum of cancer patients and the effect of therapy. Cancer Res 37:646-650, 1977[Abstract/Free Full Text]

18. Shapiro B, Chakrabarty M, Cohn EM, et al: Determination of circulating DNA levels in patients with benign or malignant gastrointestinal disease. Cancer 51:2116-2120, 1983[Medline]

19. Chen XQ, Stroun M, Magnenat JL, et al: Microsatellite alterations in plasma DNA of small cell lung cancer patients. Nat Med 2:1033-1035, 1996[Medline]

20. Nawroz H, Koch W, Anker P, et al: Microsatellite alterations in serum DNA of head and neck cancer patients. Nat Med 2:1035-1037, 1996[Medline]

21. Anker P, Lefort F, Vasioukhin V, et al: K-ras mutations are found in DNA extracted from the plasma of patients with colorectal cancer. Gastroenterology 112:1114-1120, 1997[Medline]

22. Sorenson GD, Pribish DM, Valone FH, et al: Soluble normal and mutated DNA sequences from single-copy genes in human blood. Cancer Epidemiol Biomarkers Prev 3:67-71, 1994[Abstract]

23. Mulcahy HE, Lyautey J, Lederrey C, et al: A prospective study of K-ras mutations in the plasma of pancreatic cancer patients. Clin Cancer Res 4:271-275, 1998[Abstract/Free Full Text]

24. Tada M, Ohashi M, Shiratori Y, et al: Analysis of K-ras gene mutation in hyperplastic duct cells of the pancreas without pancreatic disease. Gastroenterology 110:227-231, 1996[Medline]

25. Yanagisawa A, Ohtake K, Ohnishi K, et al: Frequent c-Ki-ras oncogene activation in mucous cell hyperplasia of pancreas suffering from chronic inflammation. Cancer Res 53:953-956, 1993[Abstract/Free Full Text]

26. Furuka N, Kawa S, Akamatsu T, et al: Long-term follow-up of patients with chronic pancreatitis and K-ras mutation detected in pancreatic juice. Gastroenterology 113:593-598, 1997[Medline]

27. Beahrs OH, Henson DE, Hutter RVP, et al: Manual for Staging of Cancer (ed 4). Philadelphia, PA, Lippincott, 1993

28. Sarner M, Cotton PB: Definitions of acute and chronic pancreatitis. Clin Gastroenterol 13:865-870, 1984[Medline]

29. Sambrook J, Frisch FF, Maniatis T: Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY, Cold Spring Harbor Laboratory, 1989

30. Jiang W, Kahn SM, Guillem JG, et al: Rapid detection of ras oncogenes in human tumors: Applications to colon, esophageal, and gastric cancer. Oncogene 4:923-928, 1989[Medline]

31. Matias-Guiu X, Villanueva A, Cuatrecasas M, et al: p53 in a tyroid follicular carcinoma with foci of poorly differentiated and anaplastic carcinoma. Pathol Res Pract 192:1-11, 1996[Medline]

32. Kaplan GL, Meier P: Nonparametric estimation from incomplete observations. J Am Stat Assoc 53:457-481, 1958

33. Cox DR: Regression models and life tables. J R Stat Soc (B) 34:187-220, 1972

34. Smith B, Selby P, Southgate J, et al: Detection of melanoma cells in peripheral blood by means of reverse transcriptase and polymerase chain reaction. Lancet 338:1227-1229, 1991[Medline]

35. Burchill SA, Bradbury MF, Pittman K, et al: Detection of epithelial cancer cells in peripheral blood by reverse transcriptase-polymerase chain reaction. Br J Cancer 71:278-281, 1995[Medline]

36. Castells A, Boix L, Bessa X, et al: Detection of colonic cells in peripheral blood of colorectal cancer patients by means of reverse transcriptase and polymerase chain reaction. Br J Cancer 78:1368-1372, 1998[Medline]

37. Mohiuddin M, Ahmed MM, Venkatasubbarao K: c-Ki-ras mutations in peripheral blood of pancreatic cancer patients: A marker for early tumor metastasis. Int J Radiat Oncol Biol Phys 34:161-166, 1996[Medline]

Submitted June 25, 1998; accepted October 8, 1998.


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Facebook Facebook   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
K. Brune, S.-M. Hong, A. Li, S. Yachida, T. Abe, M. Griffith, D. Yang, N. Omura, J. Eshleman, M. Canto, et al.
Genetic and Epigenetic Alterations of Familial Pancreatic Cancers
Cancer Epidemiol. Biomarkers Prev., December 1, 2008; 17(12): 3536 - 3542.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
D. G. Mollevi, T. Serrano, M. M. Ginesta, J. Valls, J. Torras, M. Navarro, E. Ramos, J. R. Germa, E. Jaurrieta, V. Moreno, et al.
Mutations in TP53 are a prognostic factor in colorectal hepatic metastases undergoing surgical resection
Carcinogenesis, June 1, 2007; 28(6): 1241 - 1246.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
J. Mora, E. Urgell, A. Farre, L. Comas, E. Montserrat, and F. Gonzalez-Sastre
Agreement between K-ras Sequence Variations Detected in Plasma and Tissue DNA in Pancreatic and Colorectal Cancer.
Clin. Chem., July 1, 2006; 52(7): 1448 - 1449.
[Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
H. Asano, S. Toyooka, M. Tokumo, K. Ichimura, K. Aoe, S. Ito, K. Tsukuda, M. Ouchida, M. Aoe, H. Katayama, et al.
Detection of EGFR Gene Mutation in Lung Cancer by Mutant-Enriched Polymerase Chain Reaction Assay
Clin. Cancer Res., January 1, 2006; 12(1): 43 - 48.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. Pellise, A. Castells, A. Gines, R. Agrelo, M. Sole, S. Castellvi-Bel, G. Fernandez-Esparrach, J. Llach, M. Esteller, J. M. Bordas, et al.
Detection of Lymph Node Micrometastases by Gene Promoter Hypermethylation in Samples Obtained by Endosonography- Guided Fine-Needle Aspiration Biopsy
Clin. Cancer Res., July 1, 2004; 10(13): 4444 - 4449.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
M. Wang, T. M. Block, L. Steel, D. E. Brenner, and Y.-H. Su
Preferential Isolation of Fragmented DNA Enhances the Detection of Circulating Mutated k-ras DNA
Clin. Chem., January 1, 2004; 50(1): 211 - 213.
[Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
J. M. Silva, J. Silva, A. Sanchez, J. M. Garcia, G. Dominguez, M. Provencio, L. Sanfrutos, E. Jareno, A. Colas, P. Espana, et al.
Tumor DNA in Plasma at Diagnosis of Breast Cancer Patients Is a Valuable Predictor of Disease-free Survival
Clin. Cancer Res., December 1, 2002; 8(12): 3761 - 3766.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
B. Nakata, Y. Qing Wang, M. Yashiro, N. Nishioka, H. Tanaka, M. Ohira, T. Ishikawa, H. Nishino, and K. Hirakawa
Prognostic Value of Microsatellite Instability in Resectable Pancreatic Cancer
Clin. Cancer Res., August 1, 2002; 8(8): 2536 - 2540.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
J M Silva, R Rodriguez, J M Garcia, C Munoz, J Silva, G Dominguez, M Provencio, P Espana, and F Bonilla
Detection of epithelial tumour RNA in the plasma of colon cancer patients is associated with advanced stages and circulating tumour cells
Gut, April 1, 2002; 50(4): 530 - 534.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
G. Dominguez, J. Carballido, J. Silva, J. M. Silva, J. M. Garcia, J. Menendez, M. Provencio, P. Espana, and F. Bonilla
p14ARF Promoter Hypermethylation in Plasma DNA as an Indicator of Disease Recurrence in Bladder Cancer Patients
Clin. Cancer Res., April 1, 2002; 8(4): 980 - 985.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
S. M. Dong, S. I. Pai, S.-H. Rha, A. Hildesheim, R. J. Kurman, P. E. Schwartz, R. Mortel, L. McGowan, M. D. Greenberg, W. A. Barnes, et al.
Detection and Quantitation of Human Papillomavirus DNA in the Plasma of Patients with Cervical Carcinoma
Cancer Epidemiol. Biomarkers Prev., January 1, 2002; 11(1): 3 - 6.
[Abstract] [Full Text]


Home page
Clin. Cancer Res.Home page
J. M. Silva, G. Dominguez, J. Silva, J. M. Garcia, A. Sanchez, O. Rodriguez, M. Provencio, P. Espana, and F. Bonilla
Detection of Epithelial Messenger RNA in the Plasma of Breast Cancer Patients Is Associated with Poor Prognosis Tumor Characteristics
Clin. Cancer Res., September 1, 2001; 7(9): 2821 - 2825.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
Z.-M. Shao, J. Wu, Z.-Z. Shen, and M. Nguyen
p53 Mutation in Plasma DNA and Its Prognostic Value in Breast Cancer Patients
Clin. Cancer Res., August 1, 2001; 7(8): 2222 - 2227.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
S Kubicka, F Kuhnel, P Flemming, B Hain, N Kezmic, K L Rudolph, M Manns, and P N Meier
K-ras mutations in the bile of patients with primary sclerosing cholangitis
Gut, March 1, 2001; 48(3): 403 - 408.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
G. D. Sorenson
Detection of Mutated KRAS2 Sequences as Tumor Markers in Plasma/Serum of Patients with Gastrointestinal Cancer
Clin. Cancer Res., June 1, 2000; 6(6): 2129 - 2137.
[Abstract] [Full Text]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
M. Dong, Y. Nio, K. Tamura, M.-M. Song, K.-J. Guo, R.-X. Guo, and Y.-T. Dong
Ki-ras Point Mutation and p53 Expression in Human Pancreatic Cancer: A Comparative Study among Chinese, Japanese, and Western Patients
Cancer Epidemiol. Biomarkers Prev., March 1, 2000; 9(3): 279 - 284.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
M. Sanchez-Cespedes, M. Esteller, L. Wu, H. Nawroz-Danish, G. H. Yoo, W. M. Koch, J. Jen, J. G. Herman, and D. Sidransky
Gene Promoter Hypermethylation in Tumors and Serum of Head and Neck Cancer Patients
Cancer Res., February 1, 2000; 60(4): 892 - 895.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
J. M. Silva, G. Dominguez, J. M. Garcia, R. Gonzalez, M. J. Villanueva, F. Navarro, M. Provencio, S. San Martin, P. Espana, and F. Bonilla
Presence of Tumor DNA in Plasma of Breast Cancer Patients: Clinicopathological Correlations
Cancer Res., July 1, 1999; 59(13): 3251 - 3256.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Castells, A.
Right arrow Articles by Farré, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Castells, A.
Right arrow Articles by Farré, A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

About
JCO
 Editorial
Roster
 Advertising
Information
 Librarians &
Institutions
 Rights &
Permissions
 PDA Services

Copyright © 1999 by the American Society of Clinical Oncology, Online ISSN: 1527-7755. Print ISSN: 0732-183X
Terms and Conditions of Use
  HighWire Press HighWire Press™ assists in the publication of JCO Online