|
|||||
|
|
||||||
© 1999 American Society for Clinical Oncology Heterozygous Germline ATM Mutations Do Not Contribute to Radiation-Associated Malignancies After Hodgkin's DiseaseFrom the Center for Cancer Risk Analysis, Massachusetts General Hospital Cancer Center and Harvard Medical School, Charlestown, MA; Departments of Pediatric Oncology and Biostatistics, Dana-Farber Cancer Institute, Boston, MA; Joint Center for Radiation Therapy, Boston, MA; and Tohoku University, Sendai, Japan. Address reprint requests to Daniel A. Haber, MD, PhD, Laboratory of Molecular Genetics, Massachusetts General Hospital Cancer Center, Building 149, 13th St, Charlestown, MA 02129; email haber@ helix.mgh.harvard.edu.
PURPOSE: The successful treatment of Hodgkin's disease has been associated with an increased incidence of secondary malignancies. To investigate whether genetic factors contribute to the development of secondary tumors, we collected family cancer histories and performed mutational analysis of the ataxia-telangiectasia (AT) gene, ATM, in a cohort of Hodgkin's disease survivors with secondary malignancies. ATM was chosen for evaluation because of the increased radiosensitivity of cells derived from AT patients and obligate heterozygotes and the epidemiologic observation that AT carriers are at increased risk for radiation-induced breast cancer. PATIENTS AND METHODS: Fifty-two patients who developed one or more neoplasms after treatment for Hodgkin's disease participated in this study. Personal and family histories of cancer were obtained through patient interviews and review of medical records. ATM mutational analysis was performed using a yeast-based protein truncation assay. RESULTS: Seventy-six secondary neoplasms were observed in this cohort of 52 Hodgkin's disease survivors, with 18 patients (35%) developing more than one secondary neoplasm. Positive family histories of cancer were present in 11 (21%) of 52 patients, compared with three (4%) of 68 Hodgkin's disease patients in a comparison cohort who did not develop secondary neoplasms (P = .008; Fisher's exact test). No germline ATM mutations were identified, resulting in an estimated AT carrier frequency in this population of 0% (90% confidence interval, 0% to 4%). CONCLUSION: Analysis of the number of tumors per individual and the family history of cancer in our cohort suggests that genetic factors may contribute to development of secondary neoplasms in a subset of Hodgkin's disease survivors. Mutational analysis, however, does not support a significant role for heterozygous truncating ATM mutations. Future studies evaluating other genes involved in DNA damage response pathways are warranted.
THE MANAGEMENT OF Hodgkin's disease has been a paradigm for the successful treatment of cancer affecting children and young adults. Modern treatment regimens, using chemotherapy and/or radiation therapy, have led to 20-year disease-free survival in approximately 80% of patients presenting at early stages. Unfortunately, survivors of Hodgkin's disease, particularly those who developed the disease as children, are at significant risk for developing secondary malignancies, including acute myeloid leukemia (AML), non-Hodgkin's lymphoma, and a variety of solid tumors.1-11 AML arises in 1% to 5% of patients within 10 years after completion of treatment for Hodgkin's disease (median, 5.5 years) and has been linked to the use of alkylating agents.12,13 Solid tumors, of which breast cancer in females is the most common, continuously increase in incidence over time, occurring in 10% to 15% of patients followed for 15 to 25 years.2,4,6,7,10,11,14 Secondary malignancies contribute significantly to the late mortality observed in Hodgkin's disease survivors,15 and some studies suggest that by 20 years after initial diagnosis and treatment, more patients have died of therapy-related causes than of Hodgkin's disease itself.16,17 Ataxia-telangiectasia (AT) is an autosomal recessive cancer susceptibility syndrome18 due to inactivating mutations in the ATM gene.19 In addition to having cerebellar degeneration and severe deficiency of cellular and humoral immunity, individuals with AT are at risk for developing lymphocytic leukemia, Hodgkin's and non-Hodgkin's lymphoma, and solid tumors, including breast and gastric cancers.20-28 Cultured cells derived from AT patients demonstrate increased sensitivity to ionizing radiation and genomic instability,29-32 consistent with the postulated role of ATM in the p53-dependent DNA damage response pathway.31,33-41 Epidemiologic calculations have predicted that AT carriers constitute approximately 1% of the general population, an estimate that we have confirmed by showing that two of 202 healthy blood donors carry a heterozygous truncating mutation in ATM.42 The high prevalence of AT carriers in the general population has been of particular interest, given the hypothesis that loss of one ATM allele may be associated with an impaired response to DNA damage induced by ionizing radiation. Cultured cells from AT heterozygotes display increased sensitivity to ionizing radiation, intermediate between that of AT homozygotes and normal controls.43 Furthermore, epidemiologic studies of AT families have reported a five- to eight-fold increase in breast cancer among female relatives presumed to be carriers,21-27 and a recent analysis has raised the possibility that this increased risk may be correlated with exposure to diagnostic procedures involving ionizing radiation.27,44 To determine whether AT heterozygotes constitute a subset of patients at risk for radiation-associated cancer, we undertook a mutational analysis of ATM in a cohort of patients who developed secondary neoplasms after successful treatment for Hodgkin's disease.
Patients Analysis of medical records at the Harvard Joint Center for Radiation Therapy and the Massachusetts General Hospital, Boston, MA, identified 123 patients diagnosed with Hodgkin's disease between 1969 and 1991 who developed one or more secondary neoplasms between 1975 and 1998. Fifty-two patients agreed to participate in this study after giving consent conforming to institutional guidelines (44 patients had died owing to progression of secondary neoplasms before the study began, 12 chose not to participate, and the remaining 15 could not contacted). Information regarding personal and family history of cancer was obtained by means of a patient interview and a review of medical records. For comparison of risk factors, family history of cancer was ascertained using similar methods from a cohort of 68 Hodgkin's disease patients who had not developed secondary neoplasms. The median follow-up in the comparison cohort was 16 years (range, 9 to 31 years), and the patients were treated with the same treatment protocols. This cohort was assembled for a separate study of breast cancer risk and therefore included only women.
ATM Mutational Analysis A nested PCR was then performed, using primers which included 5' tails of 45 nucleotides complementary to the sequence flanking an engineered BamH1 site within the yeast URA3 gene (Forward tail 5'-TTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTAT- GCAG-3'; Reverse tail 5'-GCAGCAACAGGACTAGGATGAGTAGCAGCACGTTCCTTATATGTG-3'). Ten overlapping ATM fragments (A to J) were generated with primers designed to preserve the open reading frame of both the ATM fragment and URA3, after their insertion by homologous recombination. PCR conditions: 95°C for 5 minutes; (95°C x 15 seconds; 52°C x 30 seconds; 72°C x 2 minutes) for 29 cycles, followed by (95°C x 15 seconds; 65°C x 30 seconds; 72°C x 1 minute) for nine cycles. ATM-specific primers used to amplify fragments A to J were: AF: TACTTAATGATCTGCTTATCTGCTG; AR: TTACGAAATCCTGAAGAATACTTTC; BF: GGACTCAACATAGGCTTAATGAT; BR: AGAATTGGAGGCACTTCTGTG; CF: AATCAATAATGAAATGGCTCTT; CR: TTACAAACATCTTGGTCACGAC; DF: TGTTAATTGATTCTAGCACGC; DR: TGAATCTGATTAGCAATGGAC; EF: TGATTCCACATCTGGTGATTA; ER: CTTCGAAGATCCTTTAGTCCT; FF: TTTATGATGCACTTCCATTGA; FR: AAGTGAGCAGCACAAGACTGA; GF: AATCACAAAG- AACAATGCTTG; GR: TTGAGAATACTCAGGGCAAGA; HF: CTTTCAAGAACACTCAGCTCC; HR: GGGTGATCCATTGAAA- TTCTA; IF: GCCTAGGATTTCATGAAGTCC; IR: CTGAAATCATTTGGCCTGTAT; JF: TGCAACAGGTCTTCCAGATGT; JR: CACACCCAAGCTGGCCATCC. Insertion of the tagged RT-PCR products into the yeast URA3 gene by homologous recombination and gap repair was performed as described previously.46 Two hundred nanograms of unpurified PCR products and 10 ng of linearized vector were cotransformed into competent yeast YPH499 (Stratagene, La Jolla, CA) by the lithium acetate method. Transformants were selected on agar plates lacking leucine, and 30 colonies were replica-plated on plates lacking leucine and uracil. PCR products derived from specimens with wild-type ATM yielded more than 75% Ura+ transformants, whereas controls with known heterozygous mutations yielded 35% to 55% Ura+ colonies, and known AT homozygotes produced less than 5% Ura+ colonies. Intermediate results were repeated twice and subjected to automated nucleotide sequencing (ABI 373; Applied Biosystems, Foster City, CA).
Statistical Methods
Clinical Characteristics of Patients With Hodgkin's Disease Analysis of medical records at Harvard-affiliated hospitals identified 123 patients who developed secondary neoplasms after treatment for Hodgkin's disease, representing approximately 10% of all patients treated for this disease between 1969 and 1991. Of these, 52 patients were alive and willing to participate in this study. The median age at diagnosis of Hodgkin's disease was 22 years (range, 12 to 72 years), with a median follow-up of 22 years (range, 5 to 34 years). Radiation therapy, chemotherapy, or both were used in all patients. Clinical stage at presentation and treatment regimens are listed in Table 1.
Seventy-six secondary neoplasms were observed in this cohort of 52 Hodgkin's disease survivors, with 18 patients (35%) developing more than one secondary neoplasm. Owing to a high mortality rate, there were no patients in this cohort with secondary leukemia. With the exception of secondary leukemia, the spectrum of neoplasms in this cohort is comparable to that reported in other clinical series2,4,7,10 and included 24 cancers of the breast, eight non-Hodgkin's lymphomas, 14 skin cancers, seven head and neck tumors, five soft tissue sarcomas, five cancers of the female reproductive tract, three melanomas, three gastrointestinal tumors, two lymphangiomas, and single cases of five additional tumors (Table 2). Forty-eight patients (92%) developed at least one tumor within the radiation field. Additional neoplasms distant from the radiated area developed in six patients (12%). Of the 20 women with a secondary breast cancer, four (20%) developed an additional contralateral breast tumor.
The median time to diagnosis of a first secondary neoplasm was 14 years (range 1 to 31) after Hodgkin's disease (Table 3). Thirteen of the 18 patients with multiple secondary neoplasms developed a total of two secondary neoplasms, four patients developed three secondary neoplasms, and one patient developed four secondary neoplasms. The median time to the development of these neoplasms was 21, 27, and 35 years, respectively. Multiple neoplasms most commonly included development of a contralateral breast tumor in patients with a first breast cancer and development of one or more basal cell carcinomas after having a first basal cell carcinoma. All patients who developed bilateral breast tumors had been under age 20 years at the time they were treated for Hodgkin's disease.
The observation that 18 (35%) of the 52 Hodgkin's disease survivors in our cohort developed multiple neoplasms is striking and considerably higher than the previously reported frequency of 5%.10 This presumably reflects the longer follow-up in our study (22 v 12.3 years) and the inclusion of patients with basal cell carcinoma. Excluding patients with basal cell carcinoma, 12 (26%) of 46 patients in our study had multiple secondary neoplasms. This high frequency of multiple cancers was suggestive of genetic predisposition, leading us to examine the family history of cancer in these patients.
Family History of Cancer in Hodgkin's Disease Patients With Radiation-Associated Secondary Neoplasms
The malignancies arising in relatives of Hodgkin's survivors with secondary tumors were variable. They included Hodgkin's and non-Hodgkin's lymphoma in 12 families (23%), consistent with previous reports describing an increased incidence of lymphoma among family members of Hodgkin's disease patients.47-49 Two patients (4%) had a strong family history of breast cancer, and one patient (2%) had a multicancer pedigree suggestive of Li-Fraumeni syndrome. The majority of patients, however, did not fit into previously recognized familial cancer syndromes. Given the high prevalence of AT heterozygotes in the general population and their postulated elevated risk for radiation-induced cancer, we undertook a screen for germline mutations in the ATM gene in this cohort of Hodgkin's disease patients with secondary neoplasms.
Mutational analyses of AT families have demonstrated that 80% to 90% of mutations result in premature chain termination,50-56 leading us to adapt a yeast-based protein truncation assay46 to efficiently screen the entire 10-kb coding sequence for the presence of heterozygous stop codons. Ten overlapping fragments of the ATM coding region were generated by RT-PCR, using primers tagged with tails of 45 nucleotides. These tails allow the use of highly efficient homologous recombination and gap repair in yeast to insert PCR-generated ATM fragments in-frame within the yeast URA3 gene (Fig 1). Homologous recombination within competent yeast achieves separation of PCR products derived from wild-type and mutant alleles, and analysis of transformants for their ability to grow in the absence of uracil identifies the presence or absence of a stop codon within the ATM coding sequence. Chimeric products encoded by wild-type ATM-URA3 transcripts confer the Ura+ phenotype, whereas mutant ATM-URA3 transcripts produce Ura- transformants. This yeast-based protein truncation assay was validated using controls known to have wild-type ATM sequence (producing > 75% Ura+ transformants), known AT carriers (35% to 55% Ura+ transformants), and AT homozygotes (< 5% Ura+ transformants). Nucleotide sequencing of Ura- clones was used to confirm the presence of a truncating mutation.
Epstein-Barr virusimmortalized lymphoblasts were generated from all patients to generate sufficient quantities of high-quality mRNA for RT-PCR. Mutational analysis of the 52 patients in our cohort did not identify any germline heterozygous ATM mutations (90% confidence interval, 0% to 4%). Given this sample size and the observed 1% AT carrier frequency,42 our study had 80% power to detect an increase to 6% and 95% power to detect an increase to 10% in the frequency of ATM mutations in this cohort.
Increasing evidence has accumulated supporting the role of ionizing radiation in the development of secondary neoplasms, including accidental exposure to atomic bomb irradiation,57,58 occupational exposure in radiology technicians,59 and exposure to therapeutic doses of radiation in young cancer patients. Several recent publications have described the development of radiation-associated neoplasms in Hodgkin's disease survivors, with the findings indicating a long latency for the development of secondary solid tumors, and a significantly increased incidence of breast cancer in women receiving mantle radiation before the age of 25 years.1-7,11,17,60,61 In addition to the age of exposure to radiation, genetic factors may contribute to the development of secondary neoplasms.60,62 This is perhaps best demonstrated in children who harbor a heterozygous germline mutation in the retinoblastoma tumor susceptibility gene RB1 and whose eye tumors are treated by radiation therapy to the orbit. The frequent development of osteosarcomas within the radiation field in these children points to the synergistic effect between genetic predisposition and ionizing radiation.63,64 Likewise, individuals with the Li-Fraumeni syndrome who harbor germline mutations in the p53 tumor suppressor gene have an increased risk for secondary cancers, including osteosarcomas arising within the field of irradiation.65-68 Our data are consistent with an important contribution by genetic factors. A positive family history of cancer was present in 21% of Hodgkin's disease patients who developed a first secondary neoplasm, compared with only 4% of patients within a comparison cohort who had Hodgkin's disease without development of secondary neoplasms (P = .008). The median follow-up of the comparison cohort is somewhat shorter than that of the current study group (16 v 22 years), and it is possible that fewer family cancers may have been detected owing to the younger age of these kindreds. In addition to demonstrating a statistically significant increase in the incidence of a positive family cancer history in our cohort of Hodgkin's disease patients developing a first secondary neoplasm, we demonstrate an association between positive family history and development of multiple secondary neoplasms. Our observation linking second cancer risk and positive family cancer history is in agreement with the findings of other studies62,65; however, we believe that this is the first report of such a finding within Hodgkin's disease kindreds. In this study, we find that carriers of a germline truncating ATM mutation do not constitute a high proportion of patients with Hodgkin's disease who develop secondary neoplasms after treatment with ionizing radiation. Hence, our data do not support the postulated link between heterozygous ATM mutations and radiation-associated cancer that has been suggested by epidemiologic studies of AT families.27,44 The study of Hodgkin's disease survivors is well suited to test this hypothesis, because radiation therapy to the chest is a key component of successful treatment and the subsequent development of breast cancer is a well-recognized late complication. However, the number of subjects available for analysis in this study was limited owing to the relative rarity of patients developing malignancies after Hodgkin's disease and the morbidity associated with certain secondary neoplasms (particularly AML). Therefore, we cannot exclude the possibility of a small increase in risk for secondary neoplasms among AT carriers that was not detected in this analysis. In addition, by restricting this study to patients surviving both Hodgkin's disease and secondary neoplasms, we limit our ability to determine the prognostic significance of germline ATM mutations. Future prospective studies enrolling a larger number of newly diagnosed patients may clarify whether germline ATM mutations influence the development of secondary neoplasms or long-term survival after diagnosis of a second tumor. In our search to understand the factors that contribute to the development of secondary neoplasms after primary Hodgkin's lymphoma, we find that a subset of these patients belong to kindreds with a high incidence of cancer. In addition, we demonstrate that with extended follow-up, certain Hodgkin's survivors develop multiple secondary neoplasms, supporting the general hypothesis that genetic factors influence susceptibility to the DNA-damaging effects of cancer therapy. Identification of the responsible gene(s) will provide insight into the potential interactions between genetic predisposition and therapy-induced tumorigenesis and will be of clinical benefit in minimizing radiation exposure and intensifying long-term surveillance programs for those at increased risk for secondary tumors.
Supported in part by grants from the Komen, Monell, and Perini Foundations and by National Institutes of Heath grant no. IH K11-AI01331-04 (K.E.N.). We are indebted to the patients who participated in this study and to the staff members of the Jimmy Fund Clinic at Dana-Farber Cancer Institute who assisted in the collection of blood specimens. We also thank Dr. Alan Aisenberg and Dr. Claire Fung of the Department of Radiation Oncology, Massachusetts General Hospital, for providing assistance in identification of Hodgkin's survivors with secondary neoplasms.
1. Aisenberg AC, Finkelstein DM, Doppke KP, et al: High risk of breast carcinoma after irradiation of young women with Hodgkin's disease. Cancer 79:1203-1210, 1997[Medline]
2.
Bhatia S, Robison L, Oberlin O, et al: Breast cancer and other second neoplasms after childhood Hodgkin's disease. N Engl J Med 334:745-751, 1996 3. Carey RW, Lingood RM, Wood W, et al: Breast cancer developing in four women cured of Hodgkin's disease. Cancer 54:2234-2236, 1984[Medline]
4.
Donaldson SS, Hancock SL: Second cancers after Hodgkin's disease in childhood. N Engl J Med 334:792-794, 1996
5.
Doria R, Holford T, Farber LR, et al: Second solid malignancies after combined modality therapy for Hodgkin's disease. J Clin Oncol 13:2016-2022, 1995
6.
Hancock SL, Tucker MA, Hoppe RT: Breast cancer after treatment of Hodgkin's disease. J Natl Cancer Inst 85:25-31, 1993
7.
Mauch PM, Kalish LA, Marcus KC, et al: Second malignancies after treatment for laparotomy staged IA-IIIB Hodgkin's disease: Long-term analysis of risk factors and outcome. Blood 87:3625-3632, 1996 8. Tarbell NJ, Gelber RD, Weinstein HJ, et al: Sex differences in risk of second malignant tumors after Hodgkin's disease in childhood. Lancet 341:1428-1432, 1993[Medline] 9. Vlachaki MT, Ha CS, Hagemeister FB, et al: Long-term outcome of treatment for Ann Arbor stage 1 Hodgkin's disease: Patterns of failure, late toxicity and second malignancies. Int J Radiat Oncol Biol Physiol 39:609-616, 1997[Medline] 10. Wolden SL, Lamborn KR, Cleary SF, et al: Second cancers following pediatric Hodgkin's disease. J Clin Oncol 16:536-544, 1998[Abstract]
11.
Yahalom J, Petrek JA, Biddinger PW, et al: Breast cancer in patients irradiated for Hodgkin's disease: A clinical and pathologic analysis of 45 events in 37 patients. J Clin Oncol 10:1674-1681, 1992 12. Coleman C, Williams C, Flint A, et al: Hematologic neoplasia in patients treated for Hodgkin's disease. N Engl J Med 297:1249-1252, 1977[Abstract]
13.
Valagussa P, Santoro A, Fossati-Bellani F, et al: Second acute leukemia and other malignancies following treatment for Hodgkin's disease. J Clin Oncol 4:830-837, 1986
14.
Travis LB, Curtis RE, Glimelius B, et al: Second cancers among long-term survivors of non-Hodgkin's lymphoma. J Natl Cancer Inst 85:1932-1937, 1993
15.
Hudson MM, Jones D, Boyette J, et al: Late mortality of long-term survivors of childhood cancer. J Clin Oncol 15:2205-2213, 1997 16. Mauch P, Kalish L, Marcus K, et al: Long-term survival in Hodgkin's disease. Cancer J Sci Am 1:33-42, 1995[Medline] 17. Hoppe R: Hodgkin's disease: Complications of therapy and excess mortality. Ann Oncol 8:115-118, 1997 18. Swift M, Morrell D, Cromartie E, et al: The incidence and gene frequency of ataxia-telangiectasia in the U.S. Am J Hum Genet 39:573-583, 1986[Medline]
19.
Savitsky K, Bar-Shira A, Gilad S, et al: A single ataxia telangiectasia gene with a product similar to PI-3 kinase. Science 268:1749-1753, 1995 20. Borresen A-L, Andersen TI, Tretli S, et al: Breast cancer and other cancers in Norwegian families with ataxia-telangiectasia. Genes Chromosomes Cancer 2:339-340, 1990[Medline] 21. Easton DF: Cancer risk in A-T heterozygotes. Int J Radiat Biol 66:S177-S182, 1994 (suppl) 22. Morrell D, Cromartie E, Swift M: Mortality and cancer incidence in 263 patients with ataxia-telangiectasia. J Natl Cancer Inst 77:89-92, 1986 23. Morrell D, Chase CL, Swift M: Cancers in 44 families with ataxia-telangiectasia. N Engl J Med 325:1831-1836, 1990[Abstract]
24.
Pippard EC, Hall AJ, Barker DJ, et al: Cancer in homozygotes and heterozygotes of ataxia-telangiectasia and xeroderma pigmentosum in Britain. Cancer Res 48:2929-2932, 1988 25. Swift M, Sholman L, Perry M, et al: Malignant neoplasms in the families of patients with ataxia-telangiectasia. Cancer Res 35:209-215, 1976 26. Swift M, Reitnauer PJ, Morrell D, et al: Breast and other cancers in families with ataxia-telangiectasia. N Engl J Med 316:1289-1294, 1987[Abstract] 27. Swift M, Morrell D, Massey RB, et al: Incidence of cancer in 161 families affected by ataxia-telangiectasia. N Engl J Med 325:1381-1386, 1991
28.
Taylor AMR, Metcalfe JA, Thick J, et al: Leukemia and lymphoma in ataxia telangiectasia. Blood 87:423-438, 1996 29. Metcalfe JA, Parkhill J, Campbell L, et al: Accelerated telomere shortening in ataxia telangiectasia. Nat Genet 13:350-353, 1996[Medline] 30. Thacker J: Cellular radiosensitivity in ataxia-telangiectasia. Int J Radiat Biol 66:S87-S96, 1994 (suppl) 31. Scott D, Spreadborough AR, Roberts SA: Radiation-induced G2 delay and spontaneous chromosome aberrations in ataxia-telangiectasia homozygotes and heterozygotes. Int J Radiat Biol 66:S157-S163, 1994 (suppl) 32. Smilenov LB, Morgan SE, Mellado W, et al: Influence of ATM function on telomere metabolism. Oncogene 15:2659-2665, 1997[Medline] 33. Artuso M, Esteve A, Bresil H, et al: The role of the ataxia telangiectasia gene in the p53, WAF1/CIP(p21) and GADD45-mediated response to DNA damage produced by ionising radiation. Oncogene 11:1427-1435, 1995[Medline] 34. Baskaran R, Wood LD, Whitaker LL, et al: Ataxia telangiectasia mutant protein activates c-Abl tyrosine kinase in response to ionizing radiation. Nature 387:516-519, 1997[Medline] 35. Jung M, Lee SA, Zhang Y, et al: Regulation of p53 in response to ionizing radiation in ataxia telangiectasia fibroblasts. Int J Radiat Oncol Biol Physiol 37:417-422, 1997[Medline] 36. Khanna KK, Beamish H, Yan J, et al: Nature of G1/S cell cycle checkpoint defect in ataxia-telangiectasia. Oncogene 11:609-618, 1995[Medline] 37. Lavin MF, Khanna KK, Beamish H, et al: Defect in radiation signal transduction in ataxia-telangiectasia. Int J Radiat Biol 66:S151-S156, 1994 (suppl) 38. Meyn MS, Strasfeld L, Allen C: Testing the role of p53 in the expression of genetic instability and apoptosis in ataxia telangiectasia. Int J Radiat Biol 66:S141-S149, 1994 39. Westphal CH, Rowan S, Schmaltz C, et al: atm and p53 cooperate in apoptosis and suppression of tumorigenesis, but not in resistance to radiation toxicity. Nat Genet 16:397-401, 1997[Medline] 40. Xie G, Habbersett RC, Jia Y, et al: Requirements for p53 and the ATM gene product in the regulation of G1/S and S phase checkpoints. Oncogene 16:721-736, 1998[Medline]
41.
Xu Y, Baltimore D: Dual roles of ATM in the cellular response to radiation and in cell growth control. Genes Dev 10:2401-2410, 1996 42. FitzGerald MG, Bean JM, Hegde SR, et al: Heterozygous ATM mutations do not contribute to early onset of breast cancer. Nat Genet 15:307-310, 1997[Medline] 43. West CM, Elyan SA, Berry P, et al: A comparison of the radiosensitivity of lymphocytes from normal donors, cancer patients, individuals with ataxia telangiectasia (A-T) and A-T heterozygotes. Int J Radiat Biol 68:197-203, 1995[Medline] 44. Athma P, Rappaport R, Swift M: Molecular genotyping shows that ataxia-telangiectasia heterozygotes are predisposed to breast cancer. Cancer Genet Cytogenet 92:130-134, 1996[Medline] 45. Anderson MA, Gusella JF: Use of cyclosporin A in establishing Epstein-Barr virus-transformed human lymphoblastoid cell lines. In Vitro 20:856-858, 1984[Medline]
46.
Ishioka C, Suzuki T, FitzGerald M, et al: Detection of truncating mutations in the BRCA1 and APC genes using a rapid screening assay in yeast. Proc Natl Acad Sci USA 94:2449-2453, 1997
47.
Diehl V, Tesch H: Hodgkin's disease: Environmental or genetic? N Engl J Med 332:461-462, 1995 48. Ferraris AM, Racchi O, Rapezzi D, et al: Familial Hodgkin's disease: A disease of young adulthood? Ann Hematol 74:131-134, 1997[Medline]
49.
Mack TM, Cozen W, Shibata DK, et al: Concordance for Hodgkin's disease in identical twins suggesting genetic susceptibility to the young-adult form of the disease. N Engl J Med 332:413-418, 1995
50.
Byrd PJ, McConville CM, Cooper P, et al: Mutations revealed by sequencing the 5' half of the gene for ataxia telangiectasia. Hum Mol Genet 5:145-149, 1996
51.
Gilad S, Khosravi R, Shkedy D, et al: Predominance of null mutations in ataxia telangiectasia. Hum Mol Genet 5:433-439, 1996 52. Gilad S, Khosravi R, Harnik R, et al: Identification of ATM mutations using extended RT-PCR and restriction endonuclease fingerprinting, and elucidation of the repertoire of A-T mutations in Israel. Hum Mutat 11:69-75, 1998[Medline] 53. Stankovic T, Kidd AMJ, Sutcliffe A, et al: ATM mutations and phenotypes in ataxia-telangiectasia families in the British Isles: Expression of mutant ATM and the risk of leukemia, lymphoma and breast cancer. Am J Hum Genet 62:334-345, 1998[Medline] 54. Telatar M, Wang Z, Udar N, et al: Ataxia-telangiectasia: Mutations in ATM cDNA detected by protein-truncation screening. Am J Hum Genet 59:40-44, 1996[Medline]
55.
Vorechovsky I, Luo L, Lindblom A, et al: ATM mutations in cancer families. Cancer Res 56:4130-4133, 1996 56. Wright J, Teraoka S, Onengut S, et al: A high frequency of distinct ATM gene mutations in ataxia-telangiectasia. Am J Hum Genet 59:839-846, 1996[Medline] 57. Land CE, Tokunaga M, Tokuoka S, et al: Early-onset breast cancer in A-bomb survivors. Lancet 342:237, 1993[Medline] 58. Tokunaga M, Land CE, Tokuota S, et al: Incidence of female breast cancer among atomic bomb survivors, 1950-1985. Radiat Res 138:209-223, 1994[Medline]
59.
Boice J, Mandel J, Doody M: Breast cancer among radiologic technologists. JAMA 274:394-401, 1995
60.
Gross PE, Sierra S: Current perspectives on radiation-induced breast cancer. J Clin Oncol 16:338-347, 1998
61.
Shapiro CL, Mauch PM: Radiation-associated breast cancer after Hodgkin's disease: Risks and screening in perspective. J Clin Oncol 10:1662-1665, 1992 62. Kony SJ, de Vathaire F, Chompret A, et al: Radiation and genetic factors in the risk of second malignant neoplasms after a first cancer in childhood. Lancet 350:91-95, 1997[Medline] 63. Draper GJ, Sanders BM, Kingston JE: Second primary neoplasms in patients with retinoblastoma. Br J Cancer 53:661-671, 1986[Medline]
64.
Eng C, Li FP, Abramson DH, et al: Mortality from second tumors among long-term survivors of retinoblastoma. J Natl Cancer Inst 85:1121-1128, 1993
65.
Hisada M, Garber JE, Fung CY, et al: Multiple primary cancers in families with Li-Fraumeni syndrome. J Natl Cancer Inst 90:606-611, 1998 66. Malkin D, Jolly KW, Barbier N, et al: Germline mutations of the p53 tumor-suppressor gene in children and young adults with second malignant neoplasms. N Engl J Med 326:1309-1315, 1992[Abstract]
67.
Strong LC, Williams WR, Tainsky MA: The Li-Fraumeni syndrome: From clinical epidemiology to molecular genetics. Am J Epidemiol 135:190-199, 1992 68. Strong LC, Stine M, Norsted TL: Cancer in survivors of childhood soft tissue sarcoma and their relatives. J Natl Cancer Inst 79:1213-1220, 1987 Submitted September 11, 1998; accepted December 7, 1998.
This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|||||||||||
|
Copyright © 1999 by the American Society of Clinical Oncology, Online ISSN: 1527-7755. Print ISSN: 0732-183X
|