Advertisement
Journal of Clinical Oncology  
Search for:
Limit by:
  Browse by Subject or Issue
Home Search or Browse JCO My JCO Subscriptions Customer Service Site Map

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tortola, S.
Right arrow Articles by Capella, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tortola, S.
Right arrow Articles by Capella, G.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
Journal of Clinical Oncology, Vol 17, Issue 5 (May), 1999: 1375
© 1999 American Society for Clinical Oncology

p53 and K-ras Gene Mutations Correlate With Tumor Aggressiveness But Are Not of Routine Prognostic Value in Colorectal Cancer

Silvia Tortola, Eugenio Marcuello, Isabel González, Germán Reyes, Rosa Arribas, Gemma Aiza, Francesc J. Sancho, Miguel A. Peinado, Gabriel Capella

From the Department of Cancer and Metastasis, Institut de Recerca Oncològica, Hospital Duran i Reynals; Department of Medical Oncology, Laboratori d'Investigació Gastrointestinal, Institut de Recerca; Department of Pathology, Hospital de Sant Pau; and Institut Català d'Oncologia, L'Hospitalet, Barcelona, Spain.

Address reprint requests to Gabriel Capellá, MD, Laboratori de Biologia Molecular, Institut Català d'Oncologia, Av Gran Via s/n, km 2.7, 08907 L'Hospitalet, Barcelona, Spain; email gcapella{at}ico.scs.es


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
PURPOSE: p53 gene and K-ras mutations are among the most common genetic alterations present in colorectal cancer. The prognostic utility of such mutations remains controversial. The purpose of this study was to prospectively evaluate the prognostic significance of p53 and K-ras gene mutations in colorectal cancer.

PATIENTS AND METHODS: One hundred forty patients were analyzed. Tumors belonging to the microsatellite mutator phenotype were excluded (n = 8). Mutations at the K-ras and p53 genes were detected and characterized by restriction fragment length polymorphism, single-strand conformation polymorphism, and sequencing, as appropriate.

RESULTS: p53 mutations were detected in 66 (50%) and K-ras mutations were detected in 54 (41%) of the 132 patients. In 26 cases (20%), ras and p53 mutations coexisted; in 38 cases (29%), neither mutation was found. Multivariate analysis of the whole population analyzed (n = 132) showed that survival was strongly correlated with the presence of p53 mutations alone or in combination with K-ras mutations (P = .002; log-rank test). When only patients undergoing a radical resection were considered (R0; n = 101), p53 mutations were no longer of prognostic significance.

CONCLUSION: p53 mutations alone or in combination with K-ras mutations are correlated with a worse outcome. However, the routine use of these mutations as prognostic markers in the clinical setting is not recommended.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
COLORECTAL CANCER is one of the best studied systems of multistage human carcinogenesis.1 K-ras and p53 gene mutations are among the most common genetic alterations present in colorectal tumors. ras genes codify for membrane-attached, small guanine triphosphate–bound proteins that play a key role in transduction of extracellular mitogenic signals. ras mutations (mainly at codons 12 and 13 of the K-ras gene) that constitutively activate their function are present in a significant proportion of colorectal adenomas and carcinomas.2,3 The p53 gene product, a nuclear phosphoprotein constitutively expressed at low levels in most normal tissues, plays a key role in control of cell cycle progression and apoptosis (see review in Chang et al4). At least 50% of colorectal tumors contain an inactivated p53 protein.5 In contrast with activating ras gene point mutations, which are concentrated in only a few activating positions, mutations that occur in the p53 gene are scattered along a large region of the gene. Most mutations result in the formation of an abnormal protein with novel oncogenic properties and prolonged half-life. The accumulation of such mutated protein can be detected by immunohistochemical staining in a significant proportion of cases.6-10

The relationship between K-ras and/or p53 gene mutations, survival, and putative clinical usefulness in colorectal cancer has been controversial.11 To our knowledge, only one prospective study has assessed the prognostic usefulness of K-ras mutations.12 Although these alterations may12-15 or may not be correlated with increased relapse rate and decreased survival,16-19 identification of ras abnormalities has not been demonstrated to be an independent prognostic factor for overall or disease-free survival in large bowel carcinoma.11 p53 gene point mutations are seemingly correlated with tumor progression.20-24 p53 overexpression has been correlated with worse outcome,25-28 better prognosis,12,18 or no influence on patient survival.29-31 Deletions at 17p, the p53 locus, have been shown to be correlated with patient survival.16,17 Few studies have simultaneously analyzed ras and p53 aberrations and their relationship with patient survival.12-14,18,23 Moreover, to our knowledge, no study has simultaneously analyzed K-ras and p53 gene point mutations and their potential clinical usefulness. Altogether, available data are controversial and insufficient to recommend the use of such mutations as prognostic factors in colorectal cancer; therefore, prospective studies that assess the prognostic utility of these genetic abnormalities are required before their clinical value can be firmly established.11

In the present study, we have prospectively evaluated the prognostic value of K-ras and p53 gene mutation detection in colorectal cancer in a large series of patients with long-term follow-up using multivariate analysis techniques. We show that p53 and the combination of K-ras and p53 gene mutations are correlated with tumor aggressiveness. Nevertheless, this correlation was not significant when only patients undergoing a radical resection (R0) (who were therefore susceptible to the benefit of an additional prognostic parameter) were considered. In consequence, we conclude that the routine use of p53 and K-ras gene mutation detection in the clinical setting should not be recommended.


    PATIENTS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Study Design
Between July 1991 and July 1993, a total of 166 patients who were preoperatively diagnosed with colorectal cancer and operated on with curative or palliative intention at the Hospital de Sant Pau were prospectively included in a study specifically designed to evaluate the prognostic value of genetic alterations in colorectal cancer. Inclusion criteria included the following: (1) electively resected primary adenocarcinomas, (2) obtention of fresh, paired, normal mucosa tumor samples within 2 hours after tumor removal, and (3) no postoperative death. Inclusion in the study did not influence the adjuvant treatment given. The study protocol was approved by the ethics committee. No chemotherapy or radiotherapy was given before surgery in these patients. Fifteen (9%) of the 166 patients had to be excluded from prognostic assessment because of inadequate follow-up: 12 were lost to follow-up, and in three cases, clinical information was not recorded adequately. The remaining 151 cases were included for genetic analysis. In 11 cases (7%), genetic analysis of p53 was not possible due to polymerase chain reaction (PCR) failure or inconclusive results (see Results). Of the 140 tumors analyzed, eight harbored microsatellite instability and were considered separately due to their distinct biologic and molecular behavior.32,33

All cases were pathologically staged using Astler-Coller modification of Dukes' cancer staging system. Surgical specimens were collected in the operating room and immediately taken to the Pathology Department in ice. Carcinomas and paired normal samples were snap-frozen within 2 hours after removal and then stored at -80°C. Patients were followed-up at the general surgery or oncology departments and their status was updated every 6 months. The end of the study period was January 1997. Mean follow-up was 52 months (range, 37 to 65 months).

Analysis of Patients
The remaining 132 patients were the subject of the present analysis. Mean age was 67 ± 12 years (range, 33 to 89 years); 72 patients were male and 60 were female. Dukes' stage was as follows: A (one patient), B1 (18 patients), B2 (40 patients), B3 (nine patients), C (38 patients), and D (26 patients). Seventy-seven patients (59%) were N0, 35 were N1, 18 were N2, and two were N3 (tumor-node-metastasis staging system). One hundred one patients had left-sided tumors and 31 patients had right-sided tumors. Thirty-two patients received chemotherapy and/or radiotherapy as an adjuvant treatment. Overall 5-year survival was 62%. Disease persisted after surgery in 27 patients, and removal of the primary and macroscopic hepatic metastases was successfully performed in four Dukes' D patients. Disease recurred in 29 patients (22%) during follow-up. Average time of relapse was 22 months (range, 3 to 51 months), and 22 recurrences (76%) occurred in the first 3 years after surgery. In two cases, a second surgery was performed. Forty-six patients (35%) died of disease, five died of other causes, eight (6%) are alive with disease, and 73 (55%) are alive without disease.

To assess the true prognostic value of mutations in the K-ras and p53 genes, only those patients (n = 101) who underwent a radical resection (defined by the absence of macroscopic or microscopic remnant disease) and who did not have Dukes' stage D disease were considered. Twenty-six of the excluded patients were Dukes' D, and in five cases, remnant disease remained after surgery. In these selected patients, mean follow-up time was also 52 months; the overall survival rate was 77% and the disease-free survival rate was 70%. At the end of the study, 18 patients had died of disease, five patients had died of other causes, six were alive with disease, and 72 were alive without disease.

Microsatellite Instability Analysis
In a first approach, five microsatellite sequences including APD2 (primer sequences: CTCACTGATGATCATATTGAAAT, GTGAAATCCTGTCTCTACTAAAAA, modified from Ionov et al32), D12S95, D21S415, D21S1235, and D4S2948 were amplified and analyzed on sequencing gels. These sequences were used to assess microsatellite instability on the basis of their high sensitivity to detect replication errors after comparison with a series of colorectal cancers previously identified to belong to the microsatellite mutator phenotype.32 Unexpectedly, incidence of cases displaying microsatellite instability was extremely low compared with that of other studies. To confirm these results, nine other microsatellite sequences were studied (D4S2946, D4S1551, D4S3022, D4S418, D4S2912, D4S2397, D4S3001, D4S1587, and D4S405). Cases that displayed mobility shifts in two or more microsatellites were considered positive for genome-wide instability at simple repeated sequences (microsatellite mutator phenotype).

Detection of K-ras and p53 Mutations
Mutations at codons 12 and 13 of the K-ras gene were detected and characterized by an artificial restriction fragment length polymorphism/PCR approach.2 p53 mutations in exons 4 to 9 were analyzed by single-strand conformation polymorphism analysis. Briefly, a first PCR was performed using primers 12979U 5' GCTGCCGTGTTCCAGTTGCT 3' and 14875D 5' AGGCATCACTGCCCCCTGAT 3'. The resulting 1,897–base pair (bp) fragment was then used as a template to separately amplify a fragment of 410 bp including exons 5 and 6 (primers 13054U 5' TACTCCCCTGCCCTCAACAAG 3' and 13463D 5' CTCCTCCCAGAGACCCCAGT 3') and a fragment of 622 bp including exons 7 and 8 (primers 13966U 5' CTGGCCTCATCTTGGGCCTG 3' and 14587D 5' CTCGCTTAGTGCTCCCTGGG 3'). These two fragments were then digested with restriction enzyme HpaII and the resulting fragments were run on a 6% polyacrylamide gel without glycerol (0.2 hours at 30 W and 5 to 6 hours at 6 W) and with a 10% glycerol (0.2 hours at 30 W and 13 to 14 hours at 6 W) to detect mobility shifts. Mutations were confirmed by direct cycle sequencing of the PCR products using the AmpliCycle Sequencing Kit (Perkin Elmer, Branchburg, NJ). Exons 4 and 9 were only analyzed on samples that were negative for mutations in exons 5 to 8. Exon 4 was amplified directly from DNA using primers 12019U 5' TCCCCCTTGCCGTCCCAAG 3' and 12349D 5' TACGGCCAGGCATTGAAGTC 3'. The resulting 331-bp fragment was run without previous digestion on a 6% polyacrylamide/10% glycerol gel for 0.2 hours at 30 W and 19 hours at 6 W. To analyze exon 9, a fragment of 788 bp including exons 7 to 9 was amplified with primers 13966U 5' CTGGCCTCATCTTGGGCCTG 3' and 14753D 5' CTGAAGGGTGAAATATTCTCC 3' and digested with HhaI to produce two fragments of 548 and 240 bp, the last one containing exon 9.

Although K-ras analysis was feasible in all tumors, p53 mutational analysis was not conclusive in 11 cases. In six cases, PCR amplification of exons 4 to 9 (or any of them) failed. In the other five cases, sequencing did not identify mutations suspected because of abnormal mobility patterns in the SSCP analysis. All of these cases, as previously stated, were excluded from the analysis.

Statistical Analysis
All values are expressed as mean ± SD. Statistical differences between variables were analyzed with unpaired t tests or analysis of variance as appropriate. Contingency tables were analyzed by Fisher's exact or {chi}2 tests as appropriate. Overall survival distributions were calculated by the Kaplan-Meier method and analyzed using the log-rank test. Univariate and multivariate analysis was performed using the Cox proportional hazards model. All statistical analysis was performed with SPSS software (SPSS, Inc, Chicago, IL). All P values are estimated from two-sided statistical tests.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Genetic Analysis
K-ras mutations were detected in 54 of the 132 (41%) tumors analyzed. Mutations were located at codon 12 in 42 cases and at codon 13 in nine cases. In the other three cases, both mutations coexisted. The spectrum of mutations at codon 12 of the K-ras gene was as follows: 22 were aspartic acid (including three double mutations), 16 were nonaspartic, and eight were not characterized. The majority of codon 13 mutations (11 of 12, including the three cases with double mutation) were aspartic acid substitutions; the remaining one was not characterized. p53 mutations were detected in 66 of the 132 (50%) tumors analyzed (46 transitions, 12 transversions, one double mutation consisting of a transition and a transversion, and seven frameshift mutations [six deletions and one insertion]). In five cases, mutations were located at splicing sequences in introns. Hot spots for mutations were codons 175 (n = 12) and 273 (n = 11, including a double mutation). Forty transitions were located at CpG islands. In 26 cases (20%), ras and p53 mutations coexisted, and in 38 cases (29%), neither mutation was found.

Molecular Correlates of Clinicopathologic Variables
Incidence of K-ras mutations did not increase during tumor progression and did not differ according to tumor location (Table Go1). It is of note that the mean age of patients with codon 13 mutations was 59 ± 15 years, whereas codon 12 tumors were diagnosed in older patients (68 ± 9 years; P = .01). Incidence of p53 was moderately higher in more advanced stages of the disease, although differences were not statistically significant. A trend was observed regarding a correlation between a high incidence of p53 mutations and persistent disease after surgical resection. Confirming previous studies, p53 mutations were more frequent in the left colon. Fifty-seven of the 101 left-sided tumors were p53-positive, whereas only nine of 31 right-sided tumors contained p53 mutations (Table 1). The coexistence or absence of mutations in the K-ras and p53 genes seemingly conditioned tumor behavior. Most ras-positive/p53-positive tumors showed lymphatic invasion (24 of 26 tumors) and local invasion (23 of 26 tumors). Accordingly, 95% of tumors (36 of 38) lacking both mutations (n = 38) were not locally invasive (P = .05). Finally, lymphatic invasion was less often evidenced in ras-negative/p53-negative tumors (11 of 38), although differences were not statistically significant.


View this table:
[in this window]
[in a new window]
 
Table 1. Clinicopathologic Correlations of K-ras and p53 Gene Mutations
 

Relationship Between ras and p53Gene Mutations
K-ras and p53 mutations seem to be independent events. However, tumors with mutation at codon 13 of the K-ras gene were more likely to contain mutations in the p53 gene (seven of nine) than tumors with codon 12 mutations (17 of 42; P = .06; Fisher's exact test). Moreover, codon 13 tumors displayed a higher proportion of p53 gene transversions (four of seven) when compared with codon 12 (two of 17) and ras-negative tumors (six of 39; P = .02; Fisher's exact test). In concordance, CpG transitions are the p53 gene alterations most frequently detected in codon 12–positive tumors (14 of 15).

Patient Outcome
In the univariate analysis of the whole population analyzed, survival strongly correlated with Dukes' stage and extramural venous vessel invasion (Table 1). Whereas p53 mutations were associated with poorer prognosis, the presence of K-ras mutations did not predict a worse outcome (Table 2 and Fig 1). Nevertheless, when only tumors that were negative for mutations in the p53 gene were considered (n = 66), K-ras mutations were indicative of a worse outcome (log-rank test, P = .016; Cox regression analysis, relative risk = 3.1, range, 1.8 to 8.2). Patients with tumors lacking both K-ras and p53 mutations had a better survival rate (3-year survival rate, 86%; 5-year survival rate, 4%) when compared with patients with the rest of tumors (3-year survival rate, 61%; 5-year survival rate, 55%) (Table 2 and Fig 1). It should be noted that the survival rate of patients with tumors containing both mutations (56%) did not differ from that of patients with tumors containing mutations in only one of these genes (57% survival rate for K-ras–positive and 54% for p53-positive tumors).


View this table:
[in this window]
[in a new window]
 
Table 2. Overall Survival (n = 132): Univariate Analysis for Clinicopathologic and Genetic Parameters
 


View larger version (19K):
[in this window]
[in a new window]
 
Fig 1. Kaplan-Meier overall survival curves for K-ras and p53 mutations in colorectal carcinomas. "No mutation" depicts K-ras–negative/p53-negative cases. The other three subgroups (K-ras–positive/p53-negative; K-ras–negative/p53-positive; K-ras–negative/p53-negative) showed comparable curves and are displayed together. No differences in survival time subgroups of either mutation were observed.

 

All variables, irrespective of their statistical significance in the univariate analysis, were included in the multivariate analysis. In all regression models, Dukes' stage was chosen as the first step. In addition, all calculations were performed forward and backward, and similar results were obtained. The presence of p53 mutations was of independent prognostic value (Table 3). The combination of p53 and K-ras mutational analysis increased the strength of the hazard ratios without modifying the final statistical significance (Table 3). In contrast, recurrence intervals did not differ according to K-ras or p53 status (p53-negative, 24 ± 15 months v p53-positive, 21 ± 12 months; K-ras–negative, 25 ± 14 months v K-ras–positive, 19 ± 12 months; P = not significant).


View this table:
[in this window]
[in a new window]
 
Table 3. Overall Survival (n = 132): Cox Multivariate Analysis for Clinicopathologic and Genetic Parameters
 

As stated above, the absence of p53 and K-ras mutations was strongly associated with tumors that were not locally invasive. Moreover, patients undergoing a palliative resection showed a moderately higher proportion of p53 mutations. These observations led us to assess the true prognostic value of these genetic alterations by exclusively analyzing patients undergoing a radical resection (R0) (n = 101). In the univariate analysis, survival was strongly correlated with Dukes' stage and vascular invasion (Fig 1 and Table 4). In contrast, the presence of p53 and/or K-ras mutations did not associate with a poorer outcome. In agreement with these observations, disease-free survival analysis offered essentially the same results (Table 4).


View this table:
[in this window]
[in a new window]
 
Table 4. Overall and Disease-Free Survival for Cases Undergoing Radical Surgery (n = 101): Univariate Analysis for Clinicopathologic and Genetic Parameters
 

To gain insight in the differences regarding prognostic information in the whole population and in patients undergoing a radical resection, the impact of both mutations on survival of Dukes' D patients was analyzed. In this subset of patients, the lack of both mutations identified patients who had a better outcome. None of the 21 Dukes' D patients who had K-ras and/or p53 mutations survived, whereas three of five K-ras–negative/p53-negative patients were still alive. Finally, it must be emphasized that all statistical analyses of the whole population and of patients undergoing a radical resection were repeated (including patients with microsatellite mutator phenotype tumors) without modifying any of the reported observations (data not shown).


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Previous studies have provided controversial evidence regarding the prognostic utility of K-ras and p53 aberrations in colorectal cancer (see review in The American Society of Clinical Oncology11). Because the majority of studies have used a retrospective design, it has not been possible to draw final recommendations about the application of such aberrations as prognostic factors. In the present study, we have prospectively evaluated the prognostic value of K-ras and p53 gene mutation detection in a large series of patients with large bowel cancer using long-term follow-up. We have taken special care in using a methodologic approach that is suitable for reproduction in other laboratories, and our analysis of p53 has been more comprehensive than that of most previous studies. In concordance with other studies, mutations in the p53 and K-ras genes seem to be indicators of increased aggressiveness in colorectal cancer. However, they should not be used as routine prognostic factors.

The presence of p53 abnormalities (point mutations, abnormal protein expression, or allelic loss) may be correlated with decreased overall survival and increased relapse rate.16,17,22-28 In this prospective study, we have shown that, in colorectal tumors, the presence of p53 point mutations is clearly associated with a poorer outcome, although it is not correlated with increased relapse rates. In contrast with previous studies, we did not find that p53 mutations vary according to Dukes' stage.21 In our series, the presence of p53 gene mutations was a prognostic factor independent of Dukes' stage as assessed by multivariate analysis when all tumors (Dukes' A to D) were considered, which is in agreement with previous studies.20,22

However, when only patients having a radical resection were analyzed, p53 point mutations were no longer of prognostic utility. The lack of K-ras and p53 mutations is apparently a good prognostic factor in our Dukes' D patients and may account for this discrepancy. Moreover, the higher frequency of p53 mutations in tumors invading peritoneum or neighboring organs, in which a radical resection is less likely, may also be of importance. Our findings strongly suggest that p53 point mutation analysis does not add significant prognostic information to Dukes' staging. Therefore, the detection of p53 and K-ras mutations should not be routinely used in the clinical setting as a prognostic marker that may influence therapeutic decisions.

Caution should be added regarding interpretation of p53 findings when adjuvant treatment has been given. A recent report has suggested that, in colorectal cancer, p53 status may condition response to adjuvant chemotherapy.12 If this was the case, the negative prognostic information of p53 mutations observed in the whole population could have been overestimated by a presumed poor response in p53-positive tumors. Unfortunately, data obtained in the present study cannot address this issue. In R0 patients, the putative resistance to chemotherapy of p53-positive tumors would not affect our conclusions, because the presence of p53 mutations no longer indicates a subset of patients with a worse outcome.

We have used a more comprehensive approach to analyzing p53 mutations than that of most previous colorectal cancer studies. Using the SSCP/sequencing method for the analysis of exons 4 to 9 of the p53 gene, we have been able to obtain a conclusive report in 93% of the attempted samples. The observed incidence of p53 mutations is similar to that of previous reports.5,20-24 Although cDNA analysis seems to be a more sensitive approach due to the overexpression of the mutant allele5 and the identification of mutations that affect splicing processes, our strategy partially overcomes this limitation because amplification of intronic sequences is included. The use of this technique offers a reproducible and sensitive approach that uses DNA, which is easily obtained from routine samples.

P53 protein accumulation or allelic loss at 17p (the p53 locus) were initially considered good alternatives with which to study p53 gene aberrations. Using immunocytochemistry (ICC), as many as 72% of colorectal tumors show p53 protein overexpression,13,14,18,19,25-31 and loss of heterozygosity is present in as many as 80% of informative cases.16,17 p53 ICC analysis suffers from several drawbacks, mainly the lack of black-and-white results and of concordant results between mutation detection and protein accumulation.6-10 These observations have raised doubts about the use of ICC as an indicator of p53 gene mutation and its meaning in the clinical setting. Allelic loss at 17p is correlated with tumor aggressiveness and could be a good alternative to indirectly studying p53 status.16,17 However, its clinical usefulness has not sufficiently been evaluated.

In other studies, it was suggested that K-ras mutations might accumulate during tumor progression and be associated with poorer survival.12-15 In our series, K-ras mutations alone are not clearly correlated with worse outcome. When combining K-ras and p53 analysis, we have shown that K-ras mutations do have an apparent effect on survival when the mutation in the p53 gene is absent. This observation suggests that a mutation in either gene has a similar impact on tumor aggressiveness, as shown by the fact that ras-negative and p53-negative tumors do have a better prognosis. In contrast, Bell et al13 showed that the coexistence of K-ras mutations and p53 overexpression were associated with decreased survival. The different methodology used may account for this discrepancy.

In our study, we have excluded tumors belonging to the microsatellite mutator phenotype due to their distinct clinical (less aggressive) and molecular (low incidence of p53 and ras gene mutations) characteristics.32,33 The inclusion of these tumors may introduce significant bias in the analysis of molecular correlates in sporadic colorectal cancer and should always be taken into account. Despite analyzing a sufficient number of microsatellite sequences, we have found a relatively low incidence of microsatellite instability, and its inclusion or exclusion does not influence the results reported herein.

In summary, we have provided evidence that, in a prospective design and using the appropriate statistical setting, p53 point mutations alone or in combination with K-ras point mutations are correlated with tumor aggressiveness and a worse outcome. Nevertheless, the analysis of these markers does not improve the prognostic assessment of patients undergoing radical resection. Therefore, neither alteration should be routinely used as a prognostic marker in colorectal cancer.


    ACKNOWLEDGMENTS
 
Supported by grants from Fondo de Investigaciones Sanitarias (94/37), Comisión Interministerial de Cienca y Tecnología (SAF 95/0285, SAF 96/187), Marató de TV3 1994 (to M.A.P. and G.C.), and Fundació Catalana de Gastroenterologia.

We thank Ignasi Gich and Victor Moreno for assistance in the statistical analysis.


    NOTES
 
R.A. and S.T. are fellows of the Spanish Ministry of Education and Science.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
1. Fearon ER, Vogelstein B: A genetic model for colorectal tumorigenesis. Cell 61:759-767, 1990[Medline]

2. Capella G, Cronauer-Mitra S, Peinado MA, et al: Frequency and spectrum of mutations at codons 12 and 13 of the c-k-ras gene in human tumors. Environ Health Perspect 93:125-131, 1991[Medline]

3. Shibata D, Schaeffer J, Li ZH, et al: Genetic heterogeneity of the c-K-ras locus in colorectal adenomas but not in adenocarcinomas. J Natl Cancer Inst 85:1058-1063, 1993[Abstract/Free Full Text]

4. Chang F, Syrjänen S, Syrjänen K: Implications of the p53 tumor-suppressor gene in clinical oncology. J Clin Oncol 13:1009-1022, 1995[Abstract]

5. Peinado MA, Fernandez-Renart M, Capella G, et al: Mutations in the p53 suppressor gene do not correlate with c-K-ras mutations in colorectal cancer. Int J Oncol 2:123-134, 1993

6. Dix B, Robbins P, Carrello S, et al: Comparison of p53 gene mutation and protein overexpression in colorectal carcinomas. Br J Cancer 70:585-590, 1994[Medline]

7. Cripps KJ, Purdie CA, Carder PJ, et al: A study of stabilization of p53 protein versus point mutations in colorectal carcinoma. Oncogene 9:2739-2743, 1994[Medline]

8. Bosari S, Viale G, Roncalli M, et al: p53 gene mutations, p53 protein accumulation and compartmentalization in colorectal adenocarcinoma. Am J Pathol 147:790-798, 1995[Abstract]

9. Costa A, Marasca R, Valentinis B, et al: p53 gene point mutations in relation to p53 nuclear protein accumulation in colorectal cancers. J Pathol 176:45-53, 1995[Medline]

10. Smith DR, Ji C-Y, Goh H-S: Prognostic significance of p53 overexpression and mutation in colorectal adenocarcinomas. Br J Cancer 74:216-224, 1996[Medline]

11. The American Society of Clinical Oncology: Clinical practice guidelines for the use of tumor markers in breast and colorectal cancer. J Clin Oncol 14:2843-2877, 1996[Abstract/Free Full Text]

12. Ahnen DJ, Feigl P, Quan G, et al: Ki-ras mutation and p53 overexpression predict the clinical behavior of colorectal cancer: A Southwest Oncology group study. Cancer Res 58:1149-1158, 1998[Abstract/Free Full Text]

13. Bell SM, Scott N, Cross D, et al: Prognostic value of p53 overexpression and c-Ki-ras gene mutations in colorectal cancer. Gastroenterology 104:57-64, 1993[Medline]

14. Tanaka M, Omura K, Watanabe Y, et al: Prognostic factors of colorectal cancer: K-ras mutation, overexpression of p53 protein and cell proliferative activity. J Surg Oncol 57:57-64, 1994[Medline]

15. Span M, Moerkerk P, De Goeij AF, et al: A detailed analysis of K-ras point mutations in relation to tumor progression and survival in colorectal cancer patients. Int J Cancer 69:241-245, 1996[Medline]

16. Kern SE, Fearon ER, Tersmette KWF, et al: Clinical and pathological associates of allelic loss in colorectal carcinoma. JAMA 261:3099-3103, 1989[Abstract/Free Full Text]

17. Laurent-Puig P, Olschwang S, Delattre O, et al: Survival and acquired genetic alterations in colorectal cancer. Gastroenterology 102:1136-1141, 1992[Medline]

18. Dix BR, Robbins P, Soong R, et al: The common molecular genetic alterations in Dukes' B and C colorectal carcinomas are not short-term prognostic indicators of survival. Int J Cancer 59:747-751, 1994[Medline]

19. Morrin M, Kelly M, Barrett N, et al: Mutations of Ki-ras and p53 genes in colorectal cancer and their prognostic significance. Gut 35:1627-1631, 1994[Abstract/Free Full Text]

20. Hamelin R, Laurent-Puig P, Olschwang S, et al: Association of p53 mutations with short survival in colorectal cancer. Gastroenterology 106:42-48, 1994[Medline]

21. Goh HS, Chan CS, Khine K, et al: p53 and behaviour of colorectal cancer. Lancet 344:233-234, 1994[Medline]

22. Goh HS, Yao J, Smith DR: p53 point mutation and survival in colorectal cancer patients. Cancer Res 55:5217-5221, 1995[Abstract/Free Full Text]

23. Pricolo VE, Finkelstein SD, Wu T-T, et al: Prognostic value of TP53 and K-ras-2 mutational analysis in stage III carcinoma of the colon. Am J Surg 171:41-46, 1995

24. Slebos RJ, Baas IO, Clement M, et al: Clinical and pathological associations with p53 tumour-suppressor gene mutations and expression of p21WAP/Cip1 in colorectal carcinoma. Br J Cancer 74:165-171, 1996[Medline]

25. Bosari S, Viale G, Bossi P, et al: Cytoplasmic accumulation of p53 protein: An independent prognostic indicator in colorectal adenocarcinomas. J Natl Cancer Inst 86:681-687, 1994[Abstract/Free Full Text]

26. Nathanson SD, Linden MD, Tender P, et al: Relationship among p53, stage and prognosis of large bowel cancer. Dis Colon Rectum 37:527-534, 1994[Medline]

27. Zeng ZS, Sarkis AS, Zhang ZF, et al: p53 nuclear overexpression: An independent predictor of survival in lymph node-positive colorectal cancer patients. J Clin Oncol 12:2043-2050, 1994.[Abstract/Free Full Text]

28. Auvinen A, Isola J, Visakorpi T, et al: Overexpression of p53 and long-term survival in colon carcinoma. Br J Cancer 70:293-296, 1994[Medline]

29. Poller DN, Baxter KJ, Shepherd NA: p53 and Rb1 protein expression: Are they prognostically useful in colorectal cancer? Br J Cancer 75:87-93, 1997[Medline]

30. Bhatavdekar JM, Patel DD, Ghosh N, et al: Coexpression of Bcl-2, c-Myc, and p53 oncoproteins as prognostic discriminants in patients with colorectal carcinoma. Dis Colon Rectum 40:785-790, 1997[Medline]

31. Mulder JW, Baas IO, Polak M, et al: Evaluation of p53 protein expression as a marker for long-term prognosis in colorectal carcinoma. Br J Cancer 71:1257-1262, 1995[Medline]

32. Ionov Y, Peinado MA, Malkhosyan S, et al: Ubiquitous somatic mutations in simple repeated sequences reveal a new mechanism for colonic carcinogenesis. Nature 363:558-561, 1993[Medline]

33. Kim H, Jen J, Vogelstein B, et al: Clinical and pathological characteristics of sporadic colorectal carcinomas with DNA replication errors in microsatellite sequences. Am J Pathol 145:148-156, 1994[Abstract]

Submitted May 1, 1998; accepted January 6, 1999.


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Facebook Facebook   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
Ann OncolHome page
A. Zaanan, P. Cuilliere-Dartigues, A. Guilloux, Y. Parc, C. Louvet, A. de Gramont, E. Tiret, S. Dumont, B. Gayet, P. Validire, et al.
Impact of p53 expression and microsatellite instability on stage III colon cancer disease-free survival in patients treated by 5-fluorouracil and leucovorin with or without oxaliplatin
Ann. Onc., October 15, 2009; (2009) mdp383v1.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
D. G. Mollevi, T. Serrano, M. M. Ginesta, J. Valls, J. Torras, M. Navarro, E. Ramos, J. R. Germa, E. Jaurrieta, V. Moreno, et al.
Mutations in TP53 are a prognostic factor in colorectal hepatic metastases undergoing surgical resection
Carcinogenesis, June 1, 2007; 28(6): 1241 - 1246.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. Coll-Mulet, D. Iglesias-Serret, A. F. Santidrian, A. M. Cosialls, M. de Frias, E. Castano, C. Campas, M. Barragan, A. F. de Sevilla, A. Domingo, et al.
MDM2 antagonists activate p53 and synergize with genotoxic drugs in B-cell chronic lymphocytic leukemia cells
Blood, May 15, 2006; 107(10): 4109 - 4114.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
D. Chen, Z. Yu, Z. Zhu, and C. D. Lopez
The p53 Pathway Promotes Efficient Mitochondrial DNA Base Excision Repair in Colorectal Cancer Cells.
Cancer Res., April 1, 2006; 66(7): 3485 - 3494.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
P Alhopuro, S K Ylisaukko-oja, W J Koskinen, P Bono, J Arola, H J Jarvinen, J-P Mecklin, T Atula, R Kontio, A A Makitie, et al.
The MDM2 promoter polymorphism SNP309T->G and the risk of uterine leiomyosarcoma, colorectal cancer, and squamous cell carcinoma of the head and neck
J. Med. Genet., September 1, 2005; 42(9): 694 - 698.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
J. L. Westra, M. Schaapveld, H. Hollema, J. P. de Boer, M. M.J. Kraak, D. de Jong, A. ter Elst, N. H. Mulder, C. H.C.M. Buys, R. M.W. Hofstra, et al.
Determination of TP53 Mutation Is More Relevant Than Microsatellite Instability Status for the Prediction of Disease-Free Survival in Adjuvant-Treated Stage III Colon Cancer Patients
J. Clin. Oncol., August 20, 2005; 23(24): 5635 - 5643.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
W. L. Ince, A. M. Jubb, S. N. Holden, E. B. Holmgren, P. Tobin, M. Sridhar, H. I. Hurwitz, F. Kabbinavar, W. F. Novotny, K. J. Hillan, et al.
Association of k-ras, b-raf, and p53 Status With the Treatment Effect of Bevacizumab
J Natl Cancer Inst, July 6, 2005; 97(13): 981 - 989.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
J. Frigola, X. Sole, M. F. Paz, V. Moreno, M. Esteller, G. Capella, and M. A. Peinado
Differential DNA hypermethylation and hypomethylation signatures in colorectal cancer
Hum. Mol. Genet., January 15, 2005; 14(2): 319 - 326.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S. Yamamoto, Y. Tomita, Y. Hoshida, M. Sakon, M. Kameyama, S. Imaoka, M. Sekimoto, S. Nakamori, M. Monden, and K. Aozasa
Expression of Valosin-Containing Protein in Colorectal Carcinomas as a Predictor for Disease Recurrence and Prognosis
Clin. Cancer Res., January 15, 2004; 10(2): 651 - 657.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
R.-A. Risques, V. Moreno, M. Ribas, E. Marcuello, G. Capella, and M. A. Peinado
Genetic Pathways and Genome-Wide Determinants of Clinical Outcome in Colorectal Cancer
Cancer Res., November 1, 2003; 63(21): 7206 - 7214.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
I. S. Long, K. Han, M. Li, S. Shirasawa, T. Sasazuki, M. Johnston, and M.-S. Tsao
Met Receptor Overexpression and Oncogenic Ki-ras Mutation Cooperate to Enhance Tumorigenicity of Colon Cancer Cells in Vivo
Mol. Cancer Res., March 1, 2003; 1(5): 393 - 401.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
A. Russo, M. Migliavacca, I. Zanna, M. R. Valerio, M. A. Latteri, N. Grassi, G. Pantuso, S. Salerno, G. Dardanoni, I. Albanese, et al.
p53 Mutations in L3-Loop Zinc-binding Domain, DNA-Ploidy, and S Phase Fraction Are Independent Prognostic Indicators in Colorectal Cancer: A Prospective Study with a Five-Year Follow-Up
Cancer Epidemiol. Biomarkers Prev., November 1, 2002; 11(11): 1322 - 1331.
[Abstract] [Full Text] [PDF]


Home page
ANN INTERN MEDHome page
P. M. Calvert and H. Frucht
The Genetics of Colorectal Cancer
Ann Intern Med, October 1, 2002; 137(7): 603 - 612.
[Abstract] [Full Text] [PDF]


Home page
Ann OncolHome page
V. Bazan, M. Migliavacca, I. Zanna, C. Tubiolo, N. Grassi, M. A. Latteri, M. La Farina, I. Albanese, G. Dardanoni, S. Salerno, et al.
Specific codon 13 K-ras mutations are predictive of clinical outcome in colorectal cancer patients, whereas codon 12 K-ras mutations are associated with mucinous histotype
Ann. Onc., September 1, 2002; 13(9): 1438 - 1446.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
B. W. Kirk, M. Feinsod, R. Favis, R. M. Kliman, and F. Barany
Single nucleotide polymorphism seeking long term association with complex disease
Nucleic Acids Res., August 1, 2002; 30(15): 3295 - 3311.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pathol.Home page
I M Frayling
Methods of molecular analysis: mutation detection in solid tumours
Mol. Pathol., April 1, 2002; 55(2): 73 - 79.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
S. Tortola, R. Steinert, M. Hantschick, M. A. Peinado, I. Gastinger, P. Stosiek, H. Lippert, W. Schlegel, and M. A. Reymond
Discordance Between K-ras Mutations in Bone Marrow Micrometastases and the Primary Tumor in Colorectal Cancer
J. Clin. Oncol., June 1, 2001; 19(11): 2837 - 2843.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
H. Elsaleh, B. Powell, K. McCaul, F. Grieu, R. Grant, D. Joseph, and B. Iacopetta
P53 Alteration and Microsatellite Instability Have Predictive Value for Survival Benefit from Chemotherapy in Stage III Colorectal Carcinoma
Clin. Cancer Res., May 1, 2001; 7(5): 1343 - 1349.
[Abstract] [Full Text]


Home page
JCOHome page
M. Esteller, S. Gonzalez, R. A. Risques, E. Marcuello, R. Mangues, J. R. Germa, J. G. Herman, G. Capella, and M. A. Peinado
K-ras and p16 Aberrations Confer Poor Prognosis in Human Colorectal Cancer
J. Clin. Oncol., January 15, 2001; 19(2): 299 - 304.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
J. H. Schiller, S. Adak, R. H. Feins, S. M. Keller, W. A. Fry, R. B. Livingston, M. E. M. Hammond, B. Wolf, L. Sabatini, J. Jett, et al.
Lack of Prognostic Significance of p53 and K-ras Mutations in Primary Resected Non-Small-Cell Lung Cancer on E4592: A Laboratory Ancillary Study on an Eastern Cooperative Oncology Group Prospective Randomized Trial of Postoperative Adjuvant Therapy
J. Clin. Oncol., January 15, 2001; 19(2): 448 - 457.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. L. Slattery, K. Curtin, K. Anderson, K.-N. Ma, S. Edwards, M. Leppert, J. Potter, D. Schaffer, and W. S. Samowitz
Associations between Dietary Intake and Ki-ras Mutations in Colon Tumors: A Population-based Study
Cancer Res., December 1, 2000; 60(24): 6935 - 6941.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
M. Esteller, M. Toyota, M. Sanchez-Cespedes, G. Capella, M. A. Peinado, D. N. Watkins, J.-P. J. Issa, D. Sidransky, S. B. Baylin, and J. G. Herman
Inactivation of the DNA Repair Gene O6-Methylguanine-DNA Methyltransferase by Promoter Hypermethylation Is Associated with G to A Mutations in K-ras in Colorectal Tumorigenesis
Cancer Res., May 1, 2000; 60(9): 2368 - 2371.
[Abstract] [Full Text]


Home page
JNCI J Natl Cancer InstHome page
I. Gonzalez-Garcia, V. Moreno, M. Navarro, J. Marti-Rague, E. Marcuello, C. Benasco, O. Campos, G. Capella, and M. A. Peinado
Standardized Approach for Microsatellite Instability Detection in Colorectal Carcinomas
J Natl Cancer Inst, April 5, 2000; 92(7): 544 - 549.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
J. A. Roth
p53 Prognostication: Paradigm or Paradox?
Clin. Cancer Res., November 1, 1999; 5(11): 3345 - 3345.
[Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
R. Arribas, M. Ribas, R.-A. Risques, L. Masramon, S. Tortola, E. Marcuello, G. Aiza, R. Miro, G. Capella, and M. A. Peinado
Prospective Assessment of Allelic Losses at 4p14-16 in Colorectal Cancer: Two Mutational Patterns and a Locus Associated with Poorer Survival
Clin. Cancer Res., November 1, 1999; 5(11): 3454 - 3459.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tortola, S.
Right arrow Articles by Capella, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tortola, S.
Right arrow Articles by Capella, G.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

About
JCO
 Editorial
Roster
 Advertising
Information
 Librarians &
Institutions
 Rights &
Permissions
 PDA Services

Copyright © 1999 by the American Society of Clinical Oncology, Online ISSN: 1527-7755. Print ISSN: 0732-183X
Terms and Conditions of Use
  HighWire Press HighWire Press™ assists in the publication of JCO Online