Advertisement
Journal of Clinical Oncology  
Search for:
Limit by:
  Browse by Subject or Issue
Home Search or Browse JCO My JCO Subscriptions Customer Service Site Map

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Summers, K. E.
Right arrow Articles by Fitzgibbon, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Summers, K. E.
Right arrow Articles by Fitzgibbon, J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
Journal of Clinical Oncology, Vol 19, Issue 2 (January), 2001: 420-424
© 2001 American Society for Clinical Oncology

Frequency of the Bcl-2/IgH Rearrangement in Normal Individuals: Implications for the Monitoring of Disease in Patients With Follicular Lymphoma

By Karin E. Summers, Lindsey K. Goff, A. Gerry Wilson, Rajnish K. Gupta, T. Andrew Lister, Jude Fitzgibbon

From the Imperial Cancer Research Fund Medical Oncology Unit, St Bartholomew’s Hospital Medical College, London; and Division of Molecular and Genetic Medicine, Royal Hallamshire Hospital, Sheffield, United Kingdom.

Address reprint requests to Jude Fitzgibbon, PhD, Imperial Cancer Research Fund Medical Oncology Unit, St Bartholomew’s Hospital Medical College, Charterhouse Square, London EC1M 6BQ, England, United Kingdom; email jfitzgib{at}hgmp.mrc.ac.uk


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
PURPOSE: To determine the incidence and frequency of the Bcl-2/IgH rearrangement in the peripheral blood of normal individuals to define the potential complication this may pose for the molecular monitoring of disease in patients with follicular lymphoma (FL).

MATERIALS AND METHODS: The incidence and frequency of the major breakpoint cluster region rearrangement in DNA extracted from peripheral blood or lymphoblastoid cell lines from 481 normal individuals was determined using a TaqMan real-time polymerase chain reaction assay (PE Applied Biosystems, Foster City, CA).

RESULTS: Twenty three percent of samples were positive for the Bcl-2/IgH rearrangement, with approximately 3% of these at levels of more than 1 in 104 cells.

CONCLUSION: The presence of circulating Bcl-2/IgH+ cells, other than those derived from the malignant clone, could confound the detection and quantitation of minimal residual disease in patients with FL, particularly at low levels of tumor burden.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
FOLLICULAR LYMPHOMA (FL) is characterized by the presence of the t(14;18)(q32;q21) (Bcl-2/IgH) chromosomal translocation that results in the rearrangement and upregulation of the Bcl-2 proto-oncogene. The majority of rearrangements in Bcl-2 occur at two distinct chromosomal regions, the major breakpoint cluster region (MBR) in 70% and the minor cluster region in 10% of patient’s tumors.1-3 These rearrangements are detected in the bone marrow and peripheral blood of patients with FL independent of stage at diagnosis,4,5 and may persist even in patients who have achieved a complete clinical response (CR) after treatment.6

Conventionally, response to therapy for lymphoma has been defined according to clinical and radiologic criteria and morphologic examination of the peripheral blood and bone marrow. Because CR in these terms is frequently followed by recurrence,7 it would be attractive to define the outcome of therapy more precisely according to the amount of molecular rearrangement detectable during remission. However, the occurrence of the Bcl-2/IgH rearrangement in the peripheral blood or tissues from patients with follicular hyperplasia,8,9 persistent polyclonal B cell lymphocytosis,10 and normal individuals11-14 suggests that circulating Bcl-2/IgH+ cells, other than those derived from the malignant clone, may pose a potential complication when monitoring minimal residual disease (MRD) in patients with this disease.

Real-time polymerase chain reaction (PCR) is a rapid technique for quantitation and monitoring of tumor burden.15-18 In this study, the technique has been used to determine the incidence and frequency of PCR-detectable MBR Bcl-2/IgH rearrangement in the peripheral blood from 481 normal individuals. The implications for monitoring MRD are discussed.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
DNA Samples
DNA obtained from the peripheral blood of 481 normal individuals was analyzed in the study. Of these, 397 were obtained from the Blood Transfusion services in London (180 samples) and Sheffield (217 samples). The median age of the blood donors was 42.3 years (range, 21 to 69 years) with 184 males (46%) and 212 females (53%), with one donor unspecified. All blood donors were negative for hepatitis B and C, syphilis and human immunodeficiency virus. A further 84 DNA samples extracted from Epstein Barr virus–transformed lymphoblastoid cell lines derived from the peripheral blood of normal individuals were kindly provided by J. Bodmer, DSc (Imperial Cancer Research Fund Laboratories, Oxford, United Kingdom).

Real-Time Quantitative PCR
PCR was performed using the ABI PRISM 7700 Sequence Detection System (PE Applied Biosystems, Foster City, CA). TaqMan Fluorogenic Probes (PE Applied Biosystems), hybridizing between the forward and reverse primers, were labelled at the 3' end with the quencher dye TAMRA (6-carboxy-tetramethylrhodamine) and at the 5' end with the reporter dye FAM (6-carboxy-fluorescein). PCR was carried out for the MBR Bcl-2/IgH rearrangement, together with beta-actin and beta-2 microglobulin genes as endogenous references, to allow quantification of DNA in eachsample. For the Bcl-2/IgH assay, primers for the JH consensus, Bcl-2 MBR region and probe were used as described by Dölken et al.19 Primers for the beta-2 microglobulin assay (forward primer, 5'ggaattgatttgggagagcatc; reverse, 5'caggtcctggctctacaatttactaa; and probe, 5'agtgtgactgggcagatcatccaccttc) were designed using Primer Express software (PE Biosystems). Primer sequences and probes for beta-actin were supplied and used following the manufacturers instructions (PE Applied Biosystems).

A 25-µL reaction mix was used incorporating TaqMan Universal PCR Master Mix (PE Applied Biosystems), 300 nmol/L of primers, a 200 nmol/L probe, and between 0.25 and 0.50 µg of DNA. After a 2-minute incubation at 50°C (to eliminate contamination from previous PCR products via the action of uracil-N-glycosylase) and denaturation for 10 minutes at 95°C, the DNA was subjected to 40 cycles of 15 seconds at 95°C and a 1-minute combined annealing/extension step at 60°C. Standard curves were constructed with the DoHH2 cell line that has a t(8;14;18) rearrangement.20 Tenfold dilutions were made in water to generate standards ranging from 10 to 105 DoHH2 cells. These standards were used to generate standard curves for both the Bcl-2/IgH rearrangement and the endogenous reference genes. Quantitation of the rearrangement, however, was similar whether DoHH2 was diluted into water or genomic DNA. The quantity of target (Bcl-2/IgH, beta-actin, or beta-2 microglobulin) in a test sample was derived from where it lay on the DoHH2 standard curve.

Approximately 1.5 µg of DNA in 3 x 0.5-µg reactions (equivalent to 2.5 x 105 cells; 1 cell = 6 pg) from each of the 84 lymphoblastoid cell lines was screened for the presence of the Bcl-2/IgH rearrangement and beta-actin, with standard curves and six no-template controls for each 96 x 25 µL experiment.

The 397 DNA samples extracted from peripheral blood were first analyzed using a two-step strategy for time and cost considerations. Initially, 1.5 µg of DNA (0.5 µg x three reactions) of each sample was screened to identify samples having the Bcl-2/IgH rearrangement, using real-time PCR, without standard curves. A control beta-2 microglobulin amplification of 0.5 µg of DNA was carried out for each sample and nine no-template controls were included in each 96-well experiment. Samples that were positive were rescreened using a further 2 µg of DNA and full standard curves for quantitation.

Sequence Analysis of Bcl-2/IgH Products
To confirm authenticity, Bcl-2/IgH products from normal individuals were amplified for sequencing using either a standard two-step nested PCR protocol with the primer pairs (outer MBR cagccttgaaacattgatgg and JH consensus acctgaggagacggtgacc, and inner MBR agttgctttacgtggcctgt and inner JH consensus cagggttccttggccccag) or using real-time PCR omitting uracil-N-glycosylase from the reaction. Real-time PCR products required a second round of standard PCR using the inner primer pair to facilitate efficient ligation. PCR products were cloned using the TOPO TA cloning kit (In-Vitrogen, Carlsbad, CA) and sequenced using an ABI 377 sequencer (PE Applied Biosystems).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Validation of the Bcl-2/IgH MBR Real-Time PCR Assay
The t(8;14;18)-bearing FL cell line DoHH2 was used to generate standard curves for real-time PCR with Bcl-2/IgH MBR and two endogenous reference genes, beta-actin and beta-2 microglobulin. Figure 1 shows typical standard curves obtained with beta-2 microglobulin (Figs 1A and 1B) and Bcl-2/IgH (Figs 1C and 1D). The slope value of the standard curve represents the number of cycles corresponding to one log difference in starting copy number. The higher threshold cycle values in the Bcl-2/IgH amplification plot reflect the presence of a single copy of the rearrangement in each DoHH2 cell, compared with two copies of beta-2 microglobulin per cell. The variable slope values are indicative of the difference in efficiencies of the PCR reactions, which may reflect the disparity in amplicon product size (variable Bcl-2/IgH product size v beta-2 microglobulin, 79 base pairs).



View larger version (116K):
[in this window]
[in a new window]
 
Fig 1. (A, C) Amplification plots and (B,D) standard curves for beta-2 microglobulin and Bcl-2/IgH using 5 standards ranging from 10 to 100,000 cells (standards, blue; samples, red). Standard curves for (B) beta-2 microglobulin showing samples of approximately 100,000 cells and (D) Bcl-2/IgH assay, samples between 5 and 40 copies.

 
The Bcl-2/IgH MBR real-time reaction had a sensitivity of one in 105 cells. However, to obtain highly reproducible results, the presence of a minimum of 10 target copies of the rearrangement was necessary. Because the upper limit of DNA used per reaction was approximately 24 ng/µL or approximately 105 cells/25 µL reaction, this is equivalent to the reproducible detection of one copy of the rearrangement in 104 cells (one rearranged allele/cell). In contrast, detection of beta-2 microglobulin required a minimum of five target copies equivalent to a reproducible detection of one in 4 x 104 cells (two normal alleles/cell; representative experiment shown in Fig 1).

Frequency of MBR in Lymphoblastoid Cell Line DNA
DNA from each of 84 lymphoblastoid cell lines was tested for the presence of the Bcl-2/IgH rearrangement. Eleven (13%) had the translocation at frequencies ranging from one in 4 x 103 to 2.5 x 105 cells, two samples having frequencies more than one in 5 x 103 cells. To investigate whether this high frequency of the rearrangement, albeit in a small number of samples, was also present in peripheral blood or whether these results were influenced by the Epstein-Barr virus–transformation, a panel of whole peripheral blood–derived DNA samples was studied.

Frequency of MBR in Peripheral-Blood DNA
Of the 397 peripheral-blood DNA samples analyzed, 101 samples (25%) were found to contain the Bcl-2/IgH MBR rearrangement; of these, 69 (17%) were positive in one reaction, 23 (6%) in two reactions, and nine (2%) were positive in all three (Fig 2A). These results were interpreted as representing samples with increasing frequencies of the Bcl-2/IgH rearrangement.



View larger version (54K):
[in this window]
[in a new window]
 
Fig 2. Real-time analysis of 397 normal samples (triplicates). (A) 101 (25%) were Bcl-2/IgH+ in 1 (17%), 2 (6%), or 3 (2%) reactions. (B) Seventy-four of 101 positive samples were retested with quantitation. Twenty-eight (38%) were positive, with 12 samples positive at frequencies more than 1 in 104 cells.

 
DNA (2 µg) from 74 of these 101 positive samples was reanalyzed using standard curves to quantify the frequency of the Bcl-2/IgH rearrangement (Fig 2B). DNA was not available for analysis for the remaining 27 individuals. Twenty eight samples (28 of 74; 38%) remained positive in this study in the range of one in 2.6 x 103 to 6.6 x 104 cells. Twelve of 28 of these were positive at frequencies of more than one in 104 cells, including six of seven samples that had previously been positive in all three reactions. Of the remaining six samples, five had previously been positive in two of three reactions and one sample had been positive in one of three reactions. Samples previously positive in only a single reaction were less likely to be PCR-positive on retesting, supporting the finding that highly reproducible results are limited to a minimum target copy number of 10.

Age and Incidence of Bcl-2/IgH
The mean ages of the 101 individuals who were PCR-positive for the Bcl-2/IgH rearrangement and of the 296 individuals with no traceable Bcl-2/IgH rearrangement were 44.1 and 41.7 years, respectively. In the 12 samples confirmed to have circulating MBR Bcl-2/IgH+ cells at a frequency of more than one in 104 cells, the mean age was 43.8 years.

Confirmation of the Bcl-2/IgH Rearrangements in Normal DNA
Sequence analysis of the Bcl-2/IgH rearrangement, performed on PCR products isolated from seven normal samples having the highest frequency of the rearrangement, confirmed that these products were unique and specific for the Bcl-2/IgH rearrangement (Table 1).


View this table:
[in this window]
[in a new window]
 
Table 1. Sequence Analysis of Bcl-2/IgH Rearrangements From Normal Individuals
 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The Bcl-2/IgH rearrangement can be used as a marker to monitor the course of the disease in patients with FL. However, the finding that the rearrangement is detected in normal individuals poses a potential complication when used to quantitate MRD. In this study, the incidence and frequency of the Bcl-2/IgH rearrangement was determined in 481 DNA samples from normal individuals using real-time PCR.

The rearrangement was detected in 23% (112) of the 481 samples analyzed. In at least 3% of normal samples (two of 84 lymphoblastoid lines, 12 of 397 blood DNA samples), the MBR rearrangement was present at frequencies of more than one in 104 cells, which is higher than that observed in many patients. The lower incidence of the rearrangement compared with that observed in other studies13 probably reflects the smaller amount of DNA analyzed for each normal individual. Furthermore, the real-time PCR assay used in this study requires a minimum of 10 target copies for the reproducible detection of the rearrangement, increasing the likelihood of false-negative results. The occurrence of the Bcl-2/IgH rearrangement in 23% of normal peripheral-blood samples is likely therefore to represent a lower limit for the incidence of the rearrangement in normal individuals.

Previous studies have shown an increasing incidence of the Bcl-2/IgH rearrangement with age that suggested a link between the incidence of FL and the occurrence of the Bcl-2/IgH rearrangement.13 The normal individuals described here exhibit no apparent age-associated increase in the incidence and frequency of circulating Bcl-2/IgH-bearing cells. The high detection rate of the rearrangement in the peripheral blood of normal individuals and the low incidence of FL21 would also seem to rule out the possibility that these cells represent a subclinical form of the disease.12

This high incidence of the Bcl-2/IgH rearrangement in normal individuals will make it difficult to quantify the frequency of the malignant clone in patients with FL who may similarly carry a background of Bcl-2/IgH+ cells unrelated to their disease. The difficulty involved in discriminating between the malignant clone and other Bcl-2/IgH-bearing cells, usually determined by sequence comparison with the known clonal rearrangement, can also be overcome using clone-specific primers designed to breakpoint and junctional region N-nucleotides.22 This may be a necessary approach to confirm the quantitation of the malignant clone in patients, particularly those having low levels of detectable Bcl-2/IgH+ cells. As reproducible detection/quantitation of the rearrangement is only obtained with a minimum initial copy number of five to 10 Bcl-2/IgH+ cells,16,19 the current real-time PCR protocols seem to be inappropriate as the sole technique for monitoring MRD in FL. However, efforts to further optimize the reproducibility of this real-time PCR assay will be worthwhile, as the technique offers a powerful and simple method of quantifying the Bcl-2/IgH rearrangement when compared with conventional semiquantitative nested PCR approaches.

In conclusion, this study quantifies the presence of Bcl-2/IgH MBR rearrangement in a proportion of normal individuals at levels comparable to or greater than that found in patients with FL. It is likely that the presence of a background of Bcl-2/IgH+ cells in patients could confound the detection and quantitation of MRD, particularly at low levels of tumor burden.


    ACKNOWLEDGMENTS
 
We thank John Anson for excellent technical assistance, Bryan Young and Louise Jones for critical reading of the manuscript, and Vivienne Weller for secretarial assistance.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
1. Cleary ML, Sklar J: Nucleotide sequence of a t(14;18) chromosomal breakpoint in follicular lymphoma and demonstration of a breakpoint-cluster region near a transcriptionally active locus on chromosome 18. Proc Natl Acad Sci U–A 82: 7439-7443, 1985[Abstract/Free Full Text]

2. Cleary ML, Smith SD, Sklar J: Cloning and structural analysis of cDNAs for bcl-2 and a hybrid bcl-2/immunoglobulin transcript resulting from the t(14;18) translocation. Cell 47: 19-28, 1986[Medline]

3. Tsujimoto Y, Croce CM: Analysis of the structure, transcripts, and protein products of bcl-2, the gene involved in human follicular lymphoma. Proc Natl Acad Sci U–A 83: 5214-5218, 1986[Abstract/Free Full Text]

4. Lambrechts AC, Hupkes PE, Dorsers LC, et al: Translocation (14;18)-positive cells are present in the circulation of the majority of patients with localized (stage I and II) follicular non-Hodgkin’s lymphoma. Blood 82: 2510-2516, 1993[Abstract/Free Full Text]

5. Berinstein NL, Reis MD, Ngan BY, et al: Detection of occult lymphoma in the peripheral blood and bone marrow of patients with untreated early-stage and advanced-stage follicular lymphoma. J Clin Oncol 11: 1344-1352, 1993[Abstract/Free Full Text]

6. Gribben JG, Freedman A, Woo SD, et al: All advanced stage non-Hodgkin’s lymphomas with a polymerase chain reaction amplifiable breakpoint of bcl-2 have residual cells containing the bcl-2 rearrangement at evaluation and after treatment. Blood 78: 3275-3280, 1991[Abstract/Free Full Text]

7. Gallagher CJ, Gregory WM, Jones AE, et al: Follicular lymphoma: Prognostic factors for response and survival. J Clin Oncol 4: 1470-1480, 1986[Abstract/Free Full Text]

8. Limpens J, de Jong D, van Krieken JH, et al: Bcl-2/JH rearrangements in benign lymphoid tissues with follicular hyperplasia. Oncogene 6: 2271-2276, 1991[Medline]

9. Aster JC, Kobayashi Y, Shiota M, et al: Detection of the t(14;18) at similar frequencies in hyperplastic lymphoid tissues from American and Japanese patients. American J Pathol 141: 291-299, 1992

10. Delage R, Roy J, Jacques L, et al: Multiple bcl-2/Ig gene rearrangements in persistent polyclonal B-cell lymphocytosis. Br J Haematol 97: 589-595, 1997[Medline]

11. Liu Y, Hernandez AM, Shibata D, et al: BCL2 translocation frequency rises with age in humans. Proc Natl Acad Sci U–A 91: 8910-8914, 1994[Abstract/Free Full Text]

12. Limpens J, Stad R, Vos C, et al: Lymphoma-associated translocation t(14;18) in blood B cells of normal individuals. Blood 85: 2528-2536, 1995[Abstract/Free Full Text]

13. Ji W, Qu GZ, Ye P, et al: Frequent detection of bcl-2/JH translocations in human blood and organ samples by a quantitative polymerase chain reaction assay. Cancer Res 55: 2876-2882, 1995[Abstract/Free Full Text]

14. Dölken G, Illerhaus G, Hirt C, et al: BCL-2/JH rearrangements in circulating B cells of healthy blood donors and patients with nonmalignant diseases. J Clin Oncol 14: 1333-1344, 1996[Abstract/Free Full Text]

15. Luthra R, McBride JA, Cabanillas F, et al: Novel 5` exonuclease-based real-time PCR assay for the detection of t(14;18)(q32;q21) in patients with follicular lymphoma. Am J Pathol 153: 63-68, 1998[Abstract/Free Full Text]

16. Olsson K, Gerard CJ, Zehnder J, et al: Real-time t(11;14) and t(14;18) PCR assays provide sensitive and quantitative assessments of minimal residual disease (MRD). Leukemia 13: 1833-1842, 1999[Medline]

17. Pongers-Willemse MJ, Verhagen OJ, Tibbe GJ, et al: Real-time quantitative PCR for the detection of minimal residual disease in acute lymphoblastic leukemia using junctional region specific TaqMan probes. Leukemia 12: 2006-2014, 1998[Medline]

18. Pallisgaard N, Clausen N, Schroder H, et al: Rapid and sensitive minimal residual disease detection in acute leukaemia by quantitative real-time RT-PCR exemplified by t(12;21) TEL-AML1 fusion transcript. Genes Chromosomes Cancer 24: 355-365, 1999

19. Dölken L, Schuler F, Dölken G: Quantitative detection of t(14;18)-positive cells by real-time quantitative PCR using fluorogenic probes. Biotechniques 25: 1058-1064, 1998[Medline]

20. Kluin-Nelemans HC, Limpens J, Meerabux J, et al: A new non-Hodgkin’s B-cell line (DoHH2) with a chromosomal translocation t(14;18)(q32;q21). Leukemia 5: 221-224, 1991[Medline]

21. Devesa SS, Fears T: Non-Hodgkin’s lymphoma time trends: United States and international data. Cancer Res 52: 5432s-5440s, 1992[Abstract/Free Full Text]

22. Kneba M, Eick S, Herbst H, et al: Frequency and structure of t(14;18) major breakpoint regions in non-Hodgkin’s lymphomas typed according to the Kiel classification: Analysis by direct DNA sequencing. Cancer Res 51: 3243-3250, 1991[Abstract/Free Full Text]

Submitted April 6, 2000; accepted September 7, 2000.


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Facebook Facebook   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
Am J Clin PatholHome page
M. T. Howard, S. Dufresne, S. H. Swerdlow, and J. R. Cook
Follicular Lymphoma of the Spleen: Multiparameter Analysis of 16 Cases
Am J Clin Pathol, May 1, 2009; 131(5): 656 - 662.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Pathol.Home page
R B Ilgenfritz, K Kayasut, A Le Tourneau, O A Calendini, L Ouafi, C Marzac, J Diebold, F Devez, V Ducruit, P E Bouchet, et al.
Correlation between molecular and histopathological diagnoses of B cell lymphomas in bone marrow biopsy and aspirates
J. Clin. Pathol., April 1, 2009; 62(4): 357 - 360.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
F. Caligaris-Cappio and P. Ghia
Novel Insights in Chronic Lymphocytic Leukemia: Are We Getting Closer to Understanding the Pathogenesis of the Disease?
J. Clin. Oncol., September 20, 2008; 26(27): 4497 - 4503.
[Abstract] [Full Text] [PDF]


Home page
J Natl Cancer Inst MonogrHome page
G. Dolken, L. Dolken, C. Hirt, C. Fusch, C. S. Rabkin, and F. Schuler
Age-Dependent Prevalence and Frequency of Circulating t(14;18)-Positive Cells in the Peripheral Blood of Healthy Individuals
J Natl Cancer Inst Monographs, July 1, 2008; 2008(39): 44 - 47.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
G. L. Kelly, A. E. Milner, G. S. Baldwin, A. I. Bell, and A. B. Rickinson
Three restricted forms of Epstein-Barr virus latency counteracting apoptosis in c-myc-expressing Burkitt lymphoma cells
PNAS, October 3, 2006; 103(40): 14935 - 14940.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
A. Baccarelli, C. Hirt, A. C. Pesatori, D. Consonni, D. G. Patterson Jr, P. A. Bertazzi, G. Dolken, and M. T. Landi
t(14;18) translocations in lymphocytes of healthy dioxin-exposed individuals from Seveso, Italy
Carcinogenesis, October 1, 2006; 27(10): 2001 - 2007.
[Abstract] [Full Text] [PDF]


Home page
J. Mol. Diagn.Home page
A. Bowman, D. Jones, L. J. Medeiros, and R. Luthra
Quantitative PCR Detection of t(14;18) bcl-2/JH Fusion Sequences in Follicular Lymphoma Patients: Comparison of Peripheral Blood and Bone Marrow Aspirate Samples
J. Mol. Diagn., November 1, 2004; 6(4): 396 - 400.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. H. Sasso, M. Martinez, S. L. Yarfitz, P. Ghillani, L. Musset, J.-C. Piette, and P. Cacoub
Frequent Joining of Bcl-2 to a JH6 Gene in Hepatitis C Virus-Associated t(14;18)
J. Immunol., September 1, 2004; 173(5): 3549 - 3556.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Ghielmini, S.-F. H. Schmitz, S. B. Cogliatti, G. Pichert, J. Hummerjohann, U. Waltzer, M. F. Fey, D. C. Betticher, G. Martinelli, F. Peccatori, et al.
Prolonged treatment with rituximab in patients with follicular lymphoma significantly increases event-free survival and response duration compared with the standard weekly x 4 schedule
Blood, June 15, 2004; 103(12): 4416 - 4423.
[Abstract] [Full Text] [PDF]


Home page
Sci Aging Knowl EnvironHome page
N. E. Sharpless
The Persistence of Senescence
Sci. Aging Knowl. Environ., August 20, 2003; 2003(33): pe24 - pe24.
[Abstract] [Full Text]


Home page
BloodHome page
F. Giannelli, S. Moscarella, C. Giannini, P. Caini, M. Monti, L. Gragnani, R. G. Romanelli, V. Solazzo, G. Laffi, G. La Villa, et al.
Effect of antiviral treatment in patients with chronic HCV infection and t(14;18) translocation
Blood, August 15, 2003; 102(4): 1196 - 1201.
[Abstract] [Full Text] [PDF]


Home page
J. Mol. Diagn.Home page
S. L. Barrans, P. A.S. Evans, S. J.M. O'Connor, R. G. Owen, G. J. Morgan, and A. S. Jack
The Detection of t(14;18) in Archival Lymph Nodes: Development of a Fluorescence in Situ Hybridization (FISH)-Based Method and Evaluation by Comparison with Polymerase Chain Reaction
J. Mol. Diagn., August 1, 2003; 5(3): 168 - 175.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
P. G. Murray, D. Lissauer, J. Junying, G. Davies, S. Moore, A. Bell, J. Timms, D. Rowlands, C. McConkey, G. M. Reynolds, et al.
Reactivity with A Monoclonal Antibody to Epstein-Barr Virus (EBV) Nuclear Antigen 1 Defines a Subset of Aggressive Breast Cancers in the Absence of the EBV Genome
Cancer Res., May 1, 2003; 63(9): 2338 - 2343.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
M. Ladetto, D. Drandi, M. Compagno, M. Astolfi, F. Volpato, C. Voena, A. Novarino, B. Pollio, A. Addeo, I. Ricca, et al.
PCR-Detectable Nonneoplastic Bcl-2/IgH Rearrangements Are Common in Normal Subjects and Cancer Patients at Diagnosis but Rare in Subjects Treated With Chemotherapy
J. Clin. Oncol., April 1, 2003; 21(7): 1398 - 1403.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. Mori, S. M. Colman, Z. Xiao, A. M. Ford, L. E. Healy, C. Donaldson, J. M. Hows, C. Navarrete, and M. Greaves
Chromosome translocations and covert leukemic clones are generated during normal fetal development
PNAS, June 11, 2002; 99(12): 8242 - 8247.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. J. Biagi and J. F. Seymour
Insights into the molecular pathogenesis of follicular lymphoma arising from analysis of geographic variation
Blood, May 29, 2002; 99(12): 4265 - 4275.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. M. P. W. Mandigers, J. P. P. Meijerink, E. J. B. M. Mensink, E. L. R. T. M. Tonnissen, K. M. Hebeda, M. J. J. T. Bogman, and J. M. M. Raemaekers
Lack of correlation between numbers of circulating t(14;18)-positive cells and response to first-line treatment in follicular lymphoma
Blood, August 15, 2001; 98(4): 940 - 944.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Summers, K. E.
Right arrow Articles by Fitzgibbon, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Summers, K. E.
Right arrow Articles by Fitzgibbon, J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

About
JCO
 Editorial
Roster
 Advertising
Information
 Librarians &
Institutions
 Rights &
Permissions
 PDA Services

Copyright © 2001 by the American Society of Clinical Oncology, Online ISSN: 1527-7755. Print ISSN: 0732-183X
Terms and Conditions of Use
  HighWire Press HighWire Press™ assists in the publication of JCO Online