Advertisement
Journal of Clinical Oncology  
Search for:
Limit by:
  Browse by Subject or Issue
Home Search or Browse JCO My JCO Subscriptions Customer Service Site Map

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Davies, S. M.
Right arrow Articles by Perentesis, J. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Davies, S. M.
Right arrow Articles by Perentesis, J. P.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
Journal of Clinical Oncology, Vol 19, Issue 5 (March), 2001: 1279-1287
© 2001 American Society for Clinical Oncology

Glutathione S-Transferase Polymorphisms and Outcome of Chemotherapy in Childhood Acute Myeloid Leukemia

By Stella M. Davies, Leslie L. Robison, Jonathan D. Buckley, Tom Tjoa, William G. Woods, Gretchen A. Radloff, Julie A. Ross, John P. Perentesis

From the Department of Pediatrics, University of Minnesota, Minneapolis, MN; South Carolina Cancer Center, Columbia, SC; Department of Preventive Medicine, Keck School of Medicine, University of Southern California, Los Angeles; and the Children’s Cancer Group, Arcadia, CA.

Address reprint requests to S.M. Davies, MB, BS, PhD, Children’s Cancer Group, PO Box 60012, Arcadia, CA 91066-6012; email: davie008{at}tc.umn.edu


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
PURPOSE: Glutathione S-transferase theta (GSTT1) and mu (GSTM1) genes are polymorphic, the genes being absent in approximately 15% and 50% of the population, respectively. Because glutathione S-transferases may be involved in the metabolism of chemotherapy drugs, we hypothesized that presence or absence of the genes may influence the outcome of treatment for childhood acute myeloid leukemia (AML).

PATIENTS AND METHODS: We genotyped GSTT1 and GSTM1 in 306 children with AML receiving chemotherapy on Children’s Cancer Group therapeutic studies. Outcomes were compared in those with and without GSTT1 and GSTM1 genes.

RESULTS: Patients with the GSTT1-negative genotype had reduced survival compared with those with at least one GSTT1 allele (GSTT1 positive) (52% v 40% at 5 years; log-rank P = .05). A multivariate model of survival adjusted for age group, sex, WBC count, chloroma, CNS involvement, and French-American-British group confirmed the increased risk of death in the GSTT1-null cases (relative risk,AQ 1.6; P = .02). The frequency of death in remission was increased in GSTT1-negative cases compared with GSTT1-positive cases (24% v 12%, log-rank P = .05). The frequency of relapse from end of induction was similar in GSTT1-negative and GSTT1-positive cases (38% v 35%, log-rank P = .5).

CONCLUSION: Children who lacked GSTT1 had greater toxicity and reduced survival after chemotherapy for AML compared with children with at least one GSTT1 allele. If confirmed in further studies, GSTT1 genotype might be useful in selecting appropriate chemotherapy regimens for children with AML.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The glutathione S-transferases (GSTs) are a group of enzymes that add sulfur molecules (as glutathione) to a wide range of acceptor molecules (reviewed in1). Xenobiotic acceptors include halogenated and nitro compounds, organophosphates (including pesticides), alkylating agents, epoxides, and polycyclic aromatic hydrocarbons.2,3 The reaction is generally a detoxification, and the conjugate is degraded by the enzymes of the gamma-glutamyl cycle. The GST T1 (GSTT1) and the GST M1 (GSTM1) genes are polymorphic in humans, with the phenotypic absence of enzyme activity caused by a homozygous inherited deletion of the gene.4-6 The frequency of the GSTT1-negative genotype is approximately 15%, and the frequency of the GSTM1-null genotype is approximately 50% in United States and European studies (reviewed in7).

Evidence indicates that GST expression plays an important role in determining the cytotoxicity of chemotherapeutic drugs, including alkylating agents such as chlorambucil, cyclophosphamide, melphalan, nitrogen mustard, and thiotepa, intercalating agents such as doxorubicin, and mitomycin C and carmustine.8 In studies of laboratory cell lines, increased expression of GST has been shown to be associated with development of resistance to a range of cytotoxic drugs, including alkylating agents,9 anthracyclines,10 and nitrosourea.11 The role of GSTs in metabolism of other chemotherapy drugs, such as VP-16, is currently unclear.

Because alkylating agents and anthracyclines are important drugs in the treatment of acute myeloid leukemia (AML) and are subject to detoxification by GST, it might be expected that GST genotype will be an important predictor of outcome in AML. In this study, we describe the impact of GST genotype on outcome of therapy in more than 300 children with AML. We show that genotype greatly influences outcomes and that the importance of genotype may vary with the intensity and timing of the chemotherapy regimen.


    PATIENTS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Patients
The study population included 306 children with AML or myelodysplasia treated on Children’s Cancer Group therapeutic studies 2861 and 2891 between 1988 and 1994 and who participated in an epidemiologic study of AML, after the parent or guardian signed an institutional review board–approved informed consent document.12,13 Clinical data, including age, sex, WBC count at diagnosis, race, presence of chloroma, presence of CNS disease, and immunophenotype were collected prospectively. For GSTM1, 52 (33%) boys were positive and 105 (67%) null; 63 (43%) girls were positive and 84 (57%) null. For GSTT1, 117 (75%) boys were positive and 40 (25%) null; 122 (83%) girls were positive and 25 (17%) null. Distribution of GST genotypes by race is listed in Table 1; distributions did not differ significantly by race, but it should be noted that numbers are small in all categories other than white. It should also be noted that the frequency of the GSTM1 null genotype for the group as a whole is 63%, increased beyond the expected 50%. We have previously described increased risk of AML in association with the GSTM1 null genotype.14 Cases were classified on the basis of criteria established and revised by the French-American-British (FAB) Cooperative Study group by central pathology review.15 Of the 306 cases, 42 were M0 or M1, 74 were M2, 27 were M3, 64 were M4, 45 were M5, six were M6, 17 were M7, eight had refractory anemia with excess blasts, nine had refractory anemia with excess blasts in transformation, and 14 were not classified. All FAB categories were treated with the same chemotherapy regimens and were eligible for randomization.


View this table:
[in this window]
[in a new window]
 
Table 1. GST Genotype Distribution According to Race ( P = .2)
 
Chemotherapy Treatment Regimen
The chemotherapy treatment strategy has been described previously.16 Briefly, patients with AML were randomized at diagnosis to one of two induction approaches involving a 4-day cycle of five active chemotherapeutic agents (dexamethasone, cytarabine, 6-thioguanine, etoposide, and daunorubicin). The second cycle was administered either 10 days after the first cycle, despite low or dropping blood counts (intensive timing), or 14 days or later from the beginning of the first cycle, dependent on bone marrow recovery and degree of residual leukemia (standard timing). All patients achieving remission received a total of four cycles of induction therapy. They were then allocated to allogeneic bone marrow transplantation if a compatible family donor was present or randomized to aggressive nonmyeloablative chemotherapy (including the drugs listed above and high-dose cytarabine and L-asparaginase) or to myeloablative therapy with purged autologous bone marrow rescue. Allogeneic and autologous bone marrow transplant recipients received identical preparative therapy with the alkylating agents busulfan and cyclophosphamide before infusion of bone marrow stem cells.

GST Genotyping
DNA was extracted from archival bone marrow slides or from cryopreserved marrow samples as previously described.17 Briefly, DNA cells were scraped from the slide with a scalpel by using sterile technique to prevent DNA contamination. Cells were suspended in polymerase chain reaction (PCR) buffer (50 mmol/L KCl,10 mmol/L tris-HCl [pH 9.0], and 1% Triton X-100), boiled for 10 minutes, extracted twice with phenol, and precipitated with ethanol. DNA was washed once with 70% ethanol, resuspended in tris-EDTA buffer, and amplified by PCR. Triplex PCR was performed by using primers for GSTM1 (GAGATGAAGTCCTTCAGA and GCTTCACGTGTTATGGAGGTT; band size 151 base pairs) and GSTT1 (ATGTGACCCTGCAGTTGC and GAGATGTGAGCACCAGTAAGGAA; band size 70 base pairs), and, as an internal control for DNA degradation, primers that amplify K-RAS (GTACTGGTGGAGTATTTGATAGTG and TAGCTGTATCGTCAAGGCAC; band size 164 base pairs). Each 50-µL PCR reaction contained 10 mmol/L tris-HCl pH 8.3, 50 mmol/L KCl, I.5 mmol/L MgCl2, and 100 µmol/L deoxynucleotides; 40 cycles of amplification were performed at an annealing temperature of 58°C, and products were visualized by agarose gel electrophoresis. All reactions were performed in duplicate. A negative control containing no DNA template was included in each experiment and showed no amplified products.

Statistical Analysis
Differences in induction outcome, dichotomized into complete remission or no remission, were assessed with Pearson’s {chi}2 statistic or Fisher’s exact test. Survival estimates were based on the method of Kaplan and Meier.18 Differences in overall survival, disease-free survival, and relapse-free survival were evaluated with the log-rank statistic.19 Disease-free survival and relapse-free survival were defined for those patients with a complete remission. Disease-free survival was defined as the time from the end of induction to relapse or death. Relapse-free survival was defined as the time from the end of induction to marrow relapse or death from progressive disease, censoring on deaths from other causes. Cox regression was used for multivariate models that looked at differences between groups, adjusting for patient characteristics that have prognostic significance.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Results of the randomized comparison of intensive versus standard timing of induction chemotherapy have been reported previously.16 Induction success and time to completion of induction chemotherapy were similar in the intensive and standard timing arms. However, a marked improvement in outcome was demonstrated in patients randomized to the intensive timing arm, irrespective of the postremission therapy to which they were allocated. As noted, the subset of patients enrolled onto this treatment study for whom GST genotyping is available were also enrolled onto an epidemiologic study of AML. Comparison of survival between those enrolled onto the therapeutic study for whom GST genotype was and was not available showed no difference in survival, indicating that this subgroup is probably representative of the study population as a whole. Analysis of the potential association of GSTT1 and GSTM1 genotypes with additional factors that might influence outcome of therapy for AML, such as WBC count at diagnosis (the most powerful predictor of prognosis in this therapeutic study16), age, and presence or absence of chloromas, showed no difference in distribution of genotypes within any of these categories that might confound the analysis. GSTT1 and GSTM1 genotypes were similarly distributed in each of the three postinduction arms (data not shown).

GSTT1 Genotype and Outcome
Patients with the GSTT1-negative genotype had reduced survival compared with those possessing at least one GSTT1 allele (52% v 40% at 5 years; log-rank P = .05) ( Fig 1). A multivariate model of survival adjusted for age group, sex, WBC count, chloroma, CNS involvement, and FAB group confirmed the increased risk of death in the GSTT1-null cases (relative risk [RR], 1.6; P = .02). Further analysis showed reduced survival in GSTT1-negative cases receiving intensively timed therapy (43% v 59% at 5 years; P = .07) ( Fig 2a). Survival was not significantly different in those receiving standard timed therapy (36% v 42% at 5 years; P = .3) (Fig 2b).



View larger version (13K):
[in this window]
[in a new window]
 
Fig 1. Survival in GSTT1-positive (+; n = 240) and -null (-; n = 65) children with AML (52% v 40%; P = .05).

 


View larger version (11K):
[in this window]
[in a new window]
 
Fig 2. (a) Survival in GSTT1-positive (+; n = 137) and -null (-; n = 37) children with AML receiving intensively timed therapy (59% v 43%; P = .07). (b) Survival in GSTT1-positive (+; n = 102) and -null (-; n = 28) children with AML receiving standard timed therapy (42% v 36%; P = .3).

 
The frequency of death in remission was increased in GSTT1-negative cases (24% v 12%; log-rank P = .05) ( Fig 3). Further analysis showed that the frequency of death in remission was increased in GSTT1-null cases receiving intensively timed therapy (26% v 9% at 5 years; log-rank P = .05) but was similar in GSTT1-null and -positive cases receiving standard timed therapy (22% v 16%; log-rank P = .4). A multivariate model of death in remission adjusted for age, sex, WBC count, chloroma, and CNS involvement also showed an increased risk of death in the GSTT1-null cases (RR, 2.1; P = .08).



View larger version (11K):
[in this window]
[in a new window]
 
Fig 3. Death in remission in GSTT1-positive (+; n = 172) and -null (-; n = 47) children with AML (24% v 12%; log-rank P = .05).

 
The frequency of relapse from end of induction at 5 years was similar in GSTT1-negative and GSTT1-positive cases (38% v 35%, log-rank P = .5 for the whole group). Relapse was nonsignificantly increased in GST-null cases receiving intensive timing (41% v 30%; log-rank P = .2) and was nonsignificantly decreased in GSTT1-null cases receiving standard timing (32% v 45%; log-rank P = .7) ( Fig 4). Multivariate analysis confirmed that there was no impact of GSTT1 genotype on relapse (RR, 1.3; P = .4).



View larger version (11K):
[in this window]
[in a new window]
 
Fig 4. (a) Relapse in GSTT1-positive (+; n = 106) and -null (-; n = 30) children with AML receiving intensively timed therapy (41% v 30%; P = .2). (b) Relapse in GSTT1-positive (+; n = 65) and -null (-; n = 17) children with AML receiving standard timed therapy (32% v 45%; P = .7).

 
Analysis of early events indicates similar frequencies of remission induction in GSTT1-positive and -negative cases (82% v 80%; P = .8). The frequency of death on induction was 4% in GSTT1-positive cases and 10% in GSTT1-negative cases (P = .11). Outcomes according to assigned therapy and GSTT1 genotype are listed in Table 2. Addition of race to all multivariate models showed that black race was associated with inferior outcome but that this was independent of GSTT1 or GSTM1 genotype.


View this table:
[in this window]
[in a new window]
 
Table 2. Outcomes of Treatment According to Assigned Therapy and GSTTI Genotype
 
GSTM1 Genotype and Outcome
Patients with the GSTM1-negative genotype had similar survival compared with those possessing at least one GSTM1 allele (50% v 47% at 5 years; log-rank P = .9) ( Fig 5). Separate analyses of those who received intensively timed therapy and those who received standard therapy also showed no impact of GSTM1 genotype on overall survival. Similarly, frequency of death in remission was not different in GSTM1-positive and -negative cases. In contrast, disease-free survival from end of induction was reduced in GSTM1-positive compared with GSTM1-negative cases receiving standard timing therapy (33% v 59%; log-rank P = .05) but was not different in those receiving intensively timed therapy (62% v 59%; log-rank P = .7). A multivariate model adjusted for age, sex, WBC count, chloroma, and CNS involvement confirmed the improved disease-free survival in the GSTM1-negative cases (RR, 0.5; P = .05).



View larger version (12K):
[in this window]
[in a new window]
 
Fig 5. Survival in GSTM1-positive (+; n = 116) and -null (-; n = 189) children with AML (50% v 47%; log-rank P = .9).

 
Analysis of early events indicates similar frequencies of remission induction (81% v 81.5%; P = not significant) and death on induction (5% v 6%; P = not significant) in GSTM1-positive and -negative cases. Outcomes according to assigned therapy and GSTM1 genotype are listed in Table 3.


View this table:
[in this window]
[in a new window]
 
Table 3. Outcomes of Treatment According to Assigned Therapy and GSTM1 Genotype
 
GSTTI and GSTM1 Genotypes Combined and Outcome
GSTT1 and GSTM1 combined genotypes (ie, GSTT1 negative/GSTM1 negative; GSTT1 negative/GSTM1 positive; GSTT1 positive/GSTM1 positive; GSTT1 positive/GSTM1 negative) were analyzed to determine whether the combined genotype affected outcomes. No significant effects on outcome were seen, although it should be recognized that numbers in each category might have been too small to detect a modest effect.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
This is the first report of GST genotype and outcome of therapy for AML, in which we describe inferior outcome for GSTT1 null individuals, caused largely by an increase in deaths in remission. Treatment of AML requires intensive myelosuppressive induction chemotherapy to achieve remission and continuing postremission treatment to maintain a durable long-term remission. More intensive induction and postremission chemotherapy improves overall survival but is associated with significant morbidity and mortality.20-25 The occurrence of a substantial number of deaths in remission caused by toxicity of therapy is an important limitation on success of treatment for AML.26

In this study, we have shown that absence of the GSTT1 gene is associated with increased toxicity of therapy for AML, particularly in those receiving the most intensive chemotherapy regimen. Absence of GSTT1 may reduce or delay metabolism of the chemotherapy drugs used for AML and might be expected to lead to a reduced relapse rate in addition to increased toxicity. However, the data in this study do not indicate any reduced frequency of relapse to counterbalance the increase in death in remission. It is possible that GSTT1 genotype influences production or excretion of drug metabolites that contribute to toxicity to a greater degree than it influences metabolites that have an antileukemic effect.

The substrate specificity of GSTT1 remains unclear, making it difficult to determine which drug’s metabolism might be influenced by GSTT1 genotype. Interaction between GSTT1 genotype and sensitivity to the environmental carcinogen benzene has been reported.27 Similarly, a number of reports have described increased sensitivity to the genotoxic effects of the agent diepoxybutane in GSTT1-null individuals.28-32 Further studies of GSTT1 genotype and metabolism of chemotherapy drugs may clarify the relationship.

Mu class GSTs are produced by a family of five genes (GSTM1-5), including the GSTM1 gene, which is the only member of the family to demonstrate a null allele.4,5 We found no effect of GSTM1 genotype on overall survival but do demonstrate an increased frequency of relapse (reduced disease-free survival) in GSTM1-positive children receiving standard timing therapy. Although this result needs to be confirmed in future studies, children receiving a less intense regimen who are able to metabolize drugs efficiently may receive an inadequate dose of cytotoxic therapy, leading to a higher relapse rate.

A number of prior studies have examined GST protein levels and prognosis by using a variety of techniques, including immunochemistry, Western blotting, and high-performance liquid chromatography, with variable results. An immunohistochemical study of expression of GST mu in the blasts of children presenting with acute lymphoblastic leukemia (ALL) suggested a role for the mu class GSTs in outcome of treatment of this disease.33 Koberda and Hellmann34 conducted a study of GST activity in AML blasts from 30 adults by using 1-chloro-2,4-dinitrobenzene as a substrate and suggest that outcomes were poorer in those with increased activity. Wrigley et al35 have used immunochemistry and Western blotting to measure levels of GST pi, alpha, and mu in ovarian cancer, but they found no association between protein level and clinical outcomes, whereas other studies36,37 have reported both positive and negative correlations with levels of acidic GST levels in patients with ovarian cancer. Because protein expression studies measure pooled levels of a number of isoenzymes with different and overlapping substrate specificities, it is perhaps not surprising that these studies have not yielded clear-cut results.

There have been few studies of GST genotype and outcome of therapy. A large study from St Jude Children’s Research Hospital showed no impact of GSTM1 genotype on incidence of childhood ALL.38 Although there was no impact of GSTM genotype on frequency of marrow relapse, there was a trend toward a higher incidence of CNS relapse in those with GSTM1-positive genotypes, in agreement with the higher frequency of relapse seen in GSTM1-positive individuals in this study. Because therapy for ALL depends largely on antimetabolite drugs such as methotrexate and vincristine, which are likely not metabolized by GSTs, this result is perhaps not unexpected. However, Howells et al39 have examined the impact of genotype on outcome of alkylating agent–based therapy for epithelial ovarian cancer. In this study of 148 women, there was no association between individual genotype and outcome, but women with both GSTM1-negative and GSTT1-negative genotypes demonstrated poorer survival and a shortened progression-free interval. Interestingly, the GSTM1/GSTT1 negative genotype was associated with chemotherapy unresponsiveness, in contrast to this study. The authors do not report frequencies of deaths from toxicity, perhaps because frequencies would be expected to be low in such a study, in contrast to the significant treatment-related mortality associated with therapy of AML.

Although this study has focused on the impact GSTM1 and GSTT1 might have on treatment for AML, there are a number of other polymorphic genes involved in drug metabolism that have the potential to influence outcome of chemotherapy, eg, p450 enzymes, myeloperoxidase, and NQ01 (reviewed in40). In addition, variations in individual DNA repair capacity may also influence chemotherapy response and associated toxicity. Adding an extra level of complexity, changes within the leukemia cells themselves, such as overexpression of the multidrug resistance gene, can also importantly influence outcome of therapy.41-45 It is clear that identifying factors that predict outcome in AML can potentially involve a large number of factors, and studies are under way to analyze additional potentially important constitutional genes.

In this study, we show that GSTT1-negative patients with AML treated with intensively timed chemotherapy have significantly increased treatment-related mortality, compared with patients with at least one GSTT1 allele. This was associated with inferior overall survival. The broader applicability of this finding to other chemotherapy regimens needs to be determined in future studies. If confirmed, the data have the potential to allow for modification of therapy in particular patient groups. This study shows that pharmacogenetic factors can influence the outcome of therapy, and particularly dose-intensive therapy. This is a variable that might need to be considered in the design of large-scale clinical trials, particularly those addressing dose intensification.

APPENDIX
Participating Principal Investigators: Children’s Cancer GroupGo


View this table:
[in this window]
[in a new window]
 
Table 4.
 
APPENDIX (Cont’d)
Go


View this table:
[in this window]
[in a new window]
 
Table 5.
 

    ACKNOWLEDGMENTS
 
Supported by grant no. 5U10-CA13539 to S.M. Davies and by grant support from the Division of Cancer Treatment, National Cancer Institute, National Institutes of Health, Department of Health and Human Services. Contributing Children’s Cancer Group investigators, institutions, and grant numbers are provided in the appendix.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
1. Salinas AE, Wong MG: Glutathione S-transferases: A review. Curr Med Chem 6: 279-309, 1999[Medline]

2. Dirven HAAM, van Ommen B, van Bladeren PJ: Involvement of human glutathione S-transferase isoenzymes in the conjugation of cyclophosphamide metabolites with glutathione. Cancer Res 54: 6215-6220, 1994[Abstract/Free Full Text]

3. Dirven HAAM, Dictus ELJT, Broeders NLHL, et al: The role of human glutathione S-transferase isoenzymes in the formation of glutathione conjugates of the alkylating cytostatic drug thiotepa. Cancer Res 55: 1701-1706, 1995[Abstract/Free Full Text]

4. Board PG: Biochemical genetics of glutathione-S-transferase in man. Am J Hum Genet 33: 36-43, 1981[Medline]

5. Seidegård J, Vorachek WR, Pero RW, et al: Hereditary differences in the expression of the human glutathione transferase active on trans-stilbene oxide are due to a gene deletion. Proc Natl Acad Sci U S A 85: 7293-7297, 1988[Abstract/Free Full Text]

6. Pemble S, Schroeder KR, Spencer SR, et al: Human glutathione S-transferase theta (GSTT1): cDNA cloning and the characterization of a genetic polymorphism. Biochem J 300: 271-276, 1994

7. Rebbeck TR: Molecular epidemiology of the human glutathione S-transferase genotypes GSTM1 and GSTT1 in cancer susceptibility. Cancer Epidemiol Biomarkers Prev 6: 733-743, 1997[Abstract/Free Full Text]

8. Tsuchida S, Sato K: Glutathione transferases and cancer. Crit Rev Biochem Mol Biol 27: 337-384, 1992[Medline]

9. Hoban PR, Robson CN, Davies SM, et al: Reduced topoisomerase II and elevated alpha class glutathione S-transferase expression in a multidrug resistant CHO cell line highly cross-resistant to mitomycin C. Biochem Pharmacol 43: 685-693, 1992[Medline]

10. Chao CC, Huang YT, Ma CM, et al: Overexpression of glutathione S-transferase and elevation of thiol pools in a multi-drug resistant human colon cancer cell line. Mol Pharmacol 41: 69-75, 1992[Abstract]

11. Smith MT, Evans CG, Doane-Setzer P, et al: Denitrosation of 1,3-Bis(2-chloroethyl)-1-nitrosourea by class Mu glutathione transferases and its role in cellular resistance in rat brain tumor cells. Cancer Res 49: 2621-2625, 1989[Abstract/Free Full Text]

12. Steinbuch M, Weinberg CR, Buckley JD, et al: Indoor residential radon exposure and risk of childhood acute myeloid leukemia. Br J Cancer 81: 900-906, 1999[Medline]

13. Shu XO, Linet MS, Steinbuch M, et al: Breast-feeding and risk of childhood acute leukemia. J Natl Cancer Inst 91: 1765-1772, 1999[Abstract/Free Full Text]

14. Davies SM, Robison LL, Buckley JD, et al: GST polymorphisms in children with myeloid leukemia: A Children’s Cancer Group (CCG) study. Cancer Epidemiol Biomarkers Prev 9: 563-566, 2000[Abstract/Free Full Text]

15. Cheson BD, Cassileth PA, Head DR, et al: Report of the National Cancer Institute-sponsored workshop on definitions of diagnosis and response in acute myeloid leukemia. J Clin Oncol 8: 813-819, 1990[Abstract]

16. Woods WG, Kobrinsky N, Buckley JD, et al: Timed-sequential induction therapy improves postremission outcome in acute myeloid leukemia: A report from the Children’s Cancer Group. Blood 87: 4979-4989, 1996[Abstract/Free Full Text]

17. Boyle EB, Steinbuch M, Tekautz T, et al: Accuracy of DNA amplification from archival hematological slides for use in genetic biomarker studies. Cancer Epidemiol Biomarkers Prev 7: 1127-1131, 1998[Abstract/Free Full Text]

18. Kaplan EL, Meier P: Nonparametric estimation from incomplete observations. J Am Stat Assoc 53: 457-481, 1958

19. Peto R, Peto J: Asymptotically efficient rank in variant text procedures. J R Stat Soc (A) 135: 185, 1972

20. Wells RJ, Woods WG, Buckley JD, et al: Treatment of newly diagnosed children and adolescents with acute myeloid leukemia: A Children’s Cancer Group study. J Clin Oncol 12: 2367-2377, 1994[Abstract/Free Full Text]

21. Yates J, Glidewell O, Wiernik P, et al: Cytosine arabinoside with daunorubicin or Adriamycin for therapy of acute myelocytic leukemia: A CALGB study. Blood 60: 454-462, 1982[Abstract/Free Full Text]

22. Wolff SN, Herzig RH, Fay JW, et al: High- dose cytarabine and daunorubicin as consolidation therapy for acute myeloid leukemia in first remission: Long-term follow-up and results. J Clin Oncol 7: 1260-1267, 1989[Abstract]

23. Cassileth PA, Lynch E, Hines JD, et al: Varying intensity of postremission therapy in acute myeloid leukemia. Blood 79: 1924-1930, 1992[Abstract/Free Full Text]

24. Mayer RJ, Davis RB, Schiffer CA, et al: Intensive postremission chemotherapy in adults with acute myeloid leukemia. Cancer and Leukemia Group B. N Engl J Med 331: 896-903, 1994[Abstract/Free Full Text]

25. Stevens RF, Hann IM, Wheatley K, et al: Marked improvements in outcome with chemotherapy alone in paediatric acute myeloid leukemia: Results of the United Kingdom Medical Research Council’s 10th AML trial. MRC Childhood Leukaemia Working Party. Br J Haematol 101: 130-140, 1998[Medline]

26. Riley LC, Hann IM, Wheatley K, et al: Treatment-related deaths during induction and first remission of acute myeloid leukaemia in children treated on the Tenth Medical Research Council acute myeloid leukaemia trial (MRC AML10). The MRC Childhood Leukaemia Working Party. Br J Haematol 106: 436-444, 1999[Medline]

27. Xu X, Wiencke JK, Niu T, et al: Benzene exposure, glutathione-s- transferase theta homozygous deletion, and sister chromatid exchanges. Am J Ind Med 33: 157-163, 1998[Medline]

28. Kelsey KT, Wiencke JK, Ward J, et al: Sister-chromatid exchanges, glutathiones-transferase theta deletion and cytogenetic sensitivity to diepoxybutane in lymphocytes from butadiene monomer production workers. Mutat Res 335: 267-273, 1995[Medline]

29. Norppa H, Hirvonen A, Jarventus H, et al: Role of GSTT1 and GSTM1 genotype in determining individual sensitivity to sister chromatid exchange induction by diepoxybutane in cultured human lymphocytes. Carcinogenesis 16: 1261-1264, 1995[Abstract/Free Full Text]

30. Pelin K, Hirvonen A, Norppa H: Influence of erythrocyte glutathione-s-transferase T1 on sister chromatid exchanges induced by diepoxybutane in cultured human lymphocytes. Mutagenesis 11: 213-215, 1996[Abstract/Free Full Text]

31. Landi S, Ponzanelli I, Hirvonen A, et al: Repeated analysis of sister chromatid exchange induction by diepoxybutane in cultured human lymphocytes: Effect of glutathione s-transferase T1 and M1 genotype. Mutat Res 351: 79-85, 1996[Medline]

32. Landi S, Norppa H, Frenzilli G, et al: Individual sensitivity to cytogenetic effects of 1,2: 3,4-diepoxybutane in cultured human lymphocytes: Influence of glutathione s-transferase M1, P1 and T1 genotypes. Pharmacogenetics 8: 461-471, 1998[Medline]

33. Hall AG, Autzen P, Cattan AR, et al: Expression of Mu class glutathione S- transferase correlates with event-free survival in childhood acute lymphoblastic leukemia. Cancer Res 54: 5251-5254, 1994[Abstract/Free Full Text]

34. Koberda J, Hellmann A: Glutathione S-transferase activity of leukemic cells as a prognostic factor for response to chemotherapy in acute leukemias. Med Oncol Tumor Pharmacother 8: 35-38, 1991[Medline]

35. Wrigley EC, McGown AT, Buckley H, et al: Glutathione-S- transferase activity and isoenzyme levels measured by two methods in ovarian cancer, and their value as markers of disease outcome. Br J Cancer 73: 763-769, 1996[Medline]

36. Green JA, Robertson LJ, Clark AH: Glutathione S-transferase expression in benign and malignant ovarian tumours. Br J Cancer 68: 235-239, 1993[Medline]

37. Hamada S, Kamada M, Furumoto H, et al: Expression of glutathione S-transferase-pi in human ovarian cancer as an indicator of resistance to chemotherapy. Gynecol Oncol 52: 313-319, 1994[Medline]

38. Chen C-L, Liu Q, Pui C-H, et al: Higher frequency of glutathione S-transferase deletions in black children with acute lymphoblastic leukemia. Blood 89: 1701-1707, 1997[Abstract/Free Full Text]

39. Howells REJ, Redman CWE, Dhar KK, et al: Association of glutathione S-transferase GSTM1 and GSTT1 null genotypes with clinical outcome in epithelial ovarian cancer. Clin Cancer Res 4: 2439-2445, 1998[Abstract/Free Full Text]

40. Krynetski EY, Evans WE: Pharmacogenetics as a molecular basis for individualized drug therapy: The thiopurine S-methyltransferase paradigm. Pharm Res 16: 342-349, 1999[Medline]

41. Leith CP, Kopecky KJ, Chen IM, et al: Frequency and clinical significance of the expression of the multidrug resistance proteins MDR1/P-glycoprotein, MRP1, and LRP in acute myeloid leukemia: A Southwest Oncology Group Study. Blood 94: 1086-1099, 1999[Abstract/Free Full Text]

42. Del Poeta G, Venditti A, Stasi R, et al: P-glycoprotein and terminal transferase expression identify prognostic subsets within cytogenetic risk classes in acute myeloid leukemia. Leuk Res 23: 451-465, 1999[Medline]

43. Advani R, Saba HI, Tallman MS, et al: Treatment of refractory and relapsed acute myelogenous leukemia with combination chemotherapy plus the multidrug resistance modulator PSC 833 (Valspodar). Blood 93: 787-795, 1999[Abstract/Free Full Text]

44. Wattel E, Solary E, Hecquet B, et al: Quinine improves the results of intensive chemotherapy in myelodysplastic syndromes expressing P glycoprotein: Results of a randomized study. Br J Haematol 102: 1015-1024, 1998[Medline]

45. Martinez A, San Miguel JF, Valverde B, et al: Functional expression of MDR-1 in acute myeloid leukemia: Correlation with the clinical-biological, immunophenotypical, and prognostic disease characteristics. Ann Hematol 75: 81-86, 1997[Medline]

Submitted August 11, 2000; accepted October 30, 2000.


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Facebook Facebook   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
JCOHome page
E. Goekkurt, S.-E. Al-Batran, J. T. Hartmann, U. Mogck, G. Schuch, M. Kramer, E. Jaeger, C. Bokemeyer, G. Ehninger, and J. Stoehlmacher
Pharmacogenetic Analyses of a Phase III Trial in Metastatic Gastroesophageal Adenocarcinoma With Fluorouracil and Leucovorin Plus Either Oxaliplatin or Cisplatin: A Study of the Arbeitsgemeinschaft Internistische Onkologie
J. Clin. Oncol., June 10, 2009; 27(17): 2863 - 2873.
[Abstract] [Full Text] [PDF]


Home page
Neuro OncolHome page
N. Barahmani, S. Carpentieri, X.-N. Li, T. Wang, Y. Cao, L. Howe, L. Kilburn, M. Chintagumpala, C. Lau, and M. F. Okcu
Glutathione S-transferase M1 and T1 polymorphisms may predict adverse effects after therapy in children with medulloblastoma
Neuro-oncol, January 1, 2009; 11(3): 292 - 300.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
B. D. Lawenda, K. M. Kelly, E. J. Ladas, S. M. Sagar, A. Vickers, and J. B. Blumberg
Should Supplemental Antioxidant Administration Be Avoided During Chemotherapy and Radiation Therapy?
J Natl Cancer Inst, June 4, 2008; 100(11): 773 - 783.
[Abstract] [Full Text] [PDF]


Home page
haematolHome page
G. J.L. Kaspers and C. M. Zwaan
Pediatric acute myeloid leukemia: towards high-quality cure of all patients
Haematologica, November 1, 2007; 92(11): 1519 - 1532.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
D. L. Howell, K. C. Ward, H. D. Austin, J. L. Young, and W. G. Woods
Access to Pediatric Cancer Care by Age, Race, and Diagnosis, and Outcomes of Cancer Treatment in Pediatric and Adolescent Patients in the State of Georgia
J. Clin. Oncol., October 10, 2007; 25(29): 4610 - 4615.
[Abstract] [Full Text] [PDF]


Home page
haematolHome page
G. Leone, L. Pagano, D. Ben-Yehuda, and M. T. Voso
Therapy-related leukemia and myelodysplasia: susceptibility and incidence
Haematologica, October 1, 2007; 92(10): 1389 - 1398.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Monzo, S. Brunet, A. Urbano-Ispizua, A. Navarro, G. Perea, J. Esteve, R. Artells, M. Granell, J. Berlanga, J. M. Ribera, et al.
Genomic polymorphisms provide prognostic information in intermediate-risk acute myeloblastic leukemia
Blood, June 15, 2006; 107(12): 4871 - 4879.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
J.-M. Lee, M.-T. Wu, Y.-C. Lee, S.-Y. Yang, J.-S. Chen, H.-H. Hsu, P.-M. Huang, S.-W. Kuo, C.-J. Lee, and C.-J. Chen
Association of GSTP1 Polymorphism and Survival for Esophageal Cancer
Clin. Cancer Res., July 1, 2005; 11(13): 4749 - 4753.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. M. Allan, A. G. Smith, K. Wheatley, R. K. Hills, L. B. Travis, D. A. Hill, D. M. Swirsky, G. J. Morgan, and C. P. Wild
Genetic variation in XPD predicts treatment outcome and risk of acute myeloid leukemia following chemotherapy
Blood, December 15, 2004; 104(13): 3872 - 3877.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. F. Okcu, M. Selvan, L.-E Wang, L. Stout, R. Erana, G. Airewele, P. Adatto, K. Hess, F. Ali-Osman, M. Groves, et al.
Glutathione S-Transferase Polymorphisms and Survival in Primary Malignant Glioma
Clin. Cancer Res., April 15, 2004; 10(8): 2618 - 2625.
[Abstract] [Full Text] [PDF]


Home page
JAMAHome page
W. L. Carroll
Race and Outcome in Childhood Acute Lymphoblastic Leukemia
JAMA, October 15, 2003; 290(15): 2061 - 2063.
[Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
C. Sweeney, V. Nazar-Stewart, P. L. Stapleton, D. L. Eaton, and T. L. Vaughan
Glutathione S-transferase M1, T1, and P1 Polymorphisms and Survival among Lung Cancer Patients
Cancer Epidemiol. Biomarkers Prev., June 1, 2003; 12(6): 527 - 533.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
W E Evans
Pharmacogenomics: marshalling the human genome to individualise drug therapy
Gut, May 1, 2003; 52(90002): ii10 - 18.
[Abstract] [Full Text]


Home page
JCOHome page
K. S. Baker, J. R. Anderson, T. E. Lobe, M. D. Wharam, S. J. Qualman, R. B. Raney, F. B. Ruymann, R. B. Womer, W. H. Meyer, M. P. Link, et al.
Children From Ethnic Minorities Have Benefited Equally as Other Children From Contemporary Therapy for Rhabdomyosarcoma: A Report From the Intergroup Rhabdomyosarcoma Study Group
J. Clin. Oncol., November 15, 2002; 20(22): 4428 - 4433.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. T. Voso, F. D'Alo', R. Putzulu, L. Mele, A. Scardocci, P. Chiusolo, R. Latagliata, F. Lo-Coco, S. Rutella, L. Pagano, et al.
Negative prognostic value of glutathione S-transferase (GSTM1 and GSTT1) deletions in adult acute myeloid leukemia
Blood, September 26, 2002; 100(8): 2703 - 2707.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
J. Stoehlmacher, D. J. Park, W. Zhang, S. Groshen, D. D. Tsao-Wei, M. C. Yu, and H.-J. Lenz
Association Between Glutathione S-Transferase P1, T1, and M1 Genetic Polymorphism and Survival of Patients With Metastatic Colorectal Cancer
J Natl Cancer Inst, June 19, 2002; 94(12): 936 - 942.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. Pinkel, W. G. Woods, B. J. Lange, F. O. Smith, and T. A. Alonzo
Treatment of children with acute myeloid leukemia
Blood, June 1, 2001; 97(11): 3673 - 3675.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Davies, S. M.
Right arrow Articles by Perentesis, J. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Davies, S. M.
Right arrow Articles by Perentesis, J. P.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

About
JCO
 Editorial
Roster
 Advertising
Information
 Librarians &
Institutions
 Rights &
Permissions
 PDA Services

Copyright © 2001 by the American Society of Clinical Oncology, Online ISSN: 1527-7755. Print ISSN: 0732-183X
Terms and Conditions of Use
  HighWire Press HighWire Press™ assists in the publication of JCO Online