|
Advertisement |
|
|
||
 |
|
|||||
|
|||||
|
 |
||||||
|
||||||
|
||||||
|
© 2002 American Society for Clinical Oncology Molecular Detection of Cytokeratin-19–Positive Cells in the Peripheral Blood of Patients With Operable Breast Cancer: Evaluation of Their Prognostic SignificanceByFrom the Laboratory of Tumor Cell Biology and Department of Biostatistics, School of Medicine, University of Crete, and Department of Medical Oncology, University General Hospital of Heraklion, Heraklion; and Medical Oncology Unit, Elena Venizelou Hospital, Athens, Greece. Address reprint requests to Vassilis Georgoulias, MD, PhD, Department of Medical Oncology, University General Hospital of Heraklion, PO Box 1352, 711 10 Heraklion, Crete, Greece; email: georgoul{at}med.uoc.gr
PURPOSE: To evaluate the prognostic significance of molecular detection of cytokeratin 19 (CK-19) mRNA-positive cells by nested reverse transcriptase polymerase chain reaction (RT-PCR) in the peripheral blood of women with stages I and II breast cancer before adjuvant chemotherapy. PATIENTS AND METHODS: The sensitivity and specificity of CK-19 mRNA detection by nested RT-PCR were investigated using MCF-7 and ARH-77 cells and blood from healthy women and patients with hematologic malignancies, metastatic colorectal cancer, and early and metastatic breast cancer. Peripheral blood from 148 patients with operable breast cancer, obtained before initiation of any adjuvant therapy, was tested for the presence of CK-19 mRNA-positive cells. RESULTS: The nested RT-PCR assay for CK-19 mRNA detected one MCF-7 tumor cell in 106 normal peripheral blood mononuclear cells in four of five experiments; no signal was detected with the CK-19–negative ARH-77 cells. CK-19 mRNA was detected in the peripheral blood of 3.7% of healthy blood donors, 14.3% of patients with hematologic malignancies, and 3.2% of patients with metastatic colorectal cancer. Detection rates for CK-19 mRNA-positive cells in the bone marrow/blood of patients with early or metastatic breast cancer were 63%/30% and 74%/52%, respectively. For stages I and II breast cancer, detection of CK-19–positive cells in the peripheral blood before adjuvant therapy was associated with reduced disease-free interval (P = .0007) and overall survival (P = .01). In multivariate analysis, detection of peripheral-blood CK-19–positive cells was an independent prognostic factor for disease relapse and death. CONCLUSION: Molecular detection of CK-19 mRNA-positive cells by RT-PCR in the peripheral blood of patients with stages I and II breast cancer before initiation of adjuvant therapy has independent prognostic value as a marker of poor clinical outcome.
AT THE TIME OF primary diagnosis of breast carcinoma, several clinicopathologic parameters, such as tumor size, involvement of axillary lymph nodes, histopathologic grade, and hormone receptor status, determine the prognosis and the individual treatment options.1-3 Moreover, after a 10-year follow-up, 15% to 20% of the patients with node-negative tumors may develop distant metastases,4 whereas approximately 40% of the patients with node-positive tumors may be free of disease and alive for 10 years or more.5,6 Breast cancer is considered a systemic disease because early tumor cell dissemination may occur even in patients with small tumors; using immunocytochemistry, several investigators have shown that epithelial cells can be identified in the bone marrow aspirates or the peripheral blood of otherwise metastases-free patients with stage I and II breast cancer (see review in7,8). The clinical importance of occult tumor cells in bone marrow has been confirmed in various prospective studies representing an independent predictive and prognostic factor for distant relapse and overall survival.9-14 Moreover, a meta-analysis of 20 studies demonstrated that for patients with breast cancer the detection of occult tumor cells in the bone marrow is associated with a decreased disease-free interval (relative risk, 1.34; 95% confidence interval [CI], 1.27 to 1.42).15 Several markers have been used to detect occult tumor cells in the bone marrow of patients with breast cancer. These markers represent proteins encoded by genes that are thought to be tissue specific and are expressed on epithelial but not on hematopoietic cells, such as bone marrow cells. The intermediate filament cytokeratin 19 (CK-19), which is stably and abundantly expressed in the majority of epithelial tumor cells, is one of the most frequently used markers. Immunocytochemical techniques are sensitive enough to detect as few as one or two tumor cells in 106 bone marrow mononuclear cells.16,17 The detection of occult tumor cells may be improved by the use of the reverse transcription polymerase chain reaction (RT-PCR) amplification technique, which can identify cell-specific mRNA; this method can detect up to one tumor cell in 107 normal peripheral blood or bone marrow mononuclear cells.13,18-22 The higher sensitivity of RT-PCR for the detection of occult tumor cells was clearly demonstrated by Schoenfeld et al.19 By using immunocytochemistry alone, they were able to detect CK-19–positive cells in four (5%) of 75 peripheral blood samples and 14 (22%) of 65 bone marrow samples of patients with breast cancer; conversely, using RT-PCR they observed CK-19 expression in 19 (25%) of 75 peripheral blood samples and 23 (35%) of 65 bone marrow samples. Slade et al,21 using a semiquantitative RT-PCR assay, also reported the detection of CK-19–positive cells in the peripheral blood of 54% of patients with breast cancer. So far, the bone marrow has been used as a source to investigate the clinical relevance of occult tumor cells in patients with operable breast cancer. The confirmed predictive and prognostic value of occult tumor cells in the bone marrow10,11 opens the way to modify the individual therapeutic decisions according to the presence or the absence of these cells. However, repeated and frequent bone marrow aspirations for the search of occult tumor cells may not easily be accepted by breast cancer patients who are otherwise healthy. Alternatively, the peripheral blood may be a more suitable source for such longitudinal investigations. To the best of our knowledge, there are no prospective studies in the literature evaluating the clinical significance of occult tumor cells in the peripheral blood of patients with operable breast cancer. We present here the initial data on the detection of CK-19 mRNA-positive cells by RT-PCR in the peripheral blood of a cohort of 148 patients with stage I and II breast cancer before the initiation of adjuvant systemic therapy; logistic regression analysis revealed that patients with CK-19 mRNA-positive cells in their peripheral blood have a significantly increased probability for distant relapse and decreased overall survival.
Cell Samples The human mammary carcinoma cell line MCF-7, which expresses the CK-19 gene, and the multiple myeloma cell line ARH-77, which does not express the CK-19 gene (both obtained from the American Type Culture Collection, Rockville, MD), were cultured in Dulbecco’s modified Eagle’s medium (Gibco Life Sciences, BRL, Grand Island, NY) supplemented with 10% bovine fetal serum (Gibco), L-glutamine 2 mmol/L (Sigma Chemical Company, Ltd, St Louis, MI) and pyruvate 1 mmol/L (Sigma). Cell cultures were maintained in 5% CO2 in air, and cells grown in monolayer were harvested by washing the dishes once with phosphate-buffered saline (PBS), pH 7.3, and then incubating the cells with PBS containing EDTA 0.53 mmol/L and 0.05% trypsin (Gibco) for 10 to 15 minutes at 37°C. The cells were washed with PBS and then were passed through 25-gauge 5/8 needles to dissociate them. Cells were counted and viability was assessed by trypan blue dye exclusion.
Patients and Clinical Samples Peripheral blood and bone marrow samples were diluted with PBS (vol/vol for peripheral blood and 1 vol bone marrow/4 to 5 vol PBS for bone marrow samples), and cells were dissociated by passing them through 25-gauge 5/8 needles. Peripheral blood mononuclear cells (PBMCs) and bone marrow mononuclear cells were obtained by gradient density centrifugation using Ficoll-Hypaque 1077 (Sigma) at 1,200 g for 30 minutes at 4°C. The interface cells were removed, washed twice with 50 mL of sterile PBS (pH 7.3), pelleted, and resuspended in 1 mL of PBS. The cells were pelleted again at 1,200 g for 2 minutes. Cell pellets were kept at -80°C until RNA extraction. Total RNA isolation was performed by using Trizol LS reagent (Gibco) according to the manufacturer’s instructions. All RNA preparation and handling steps took place in a laminar flow hood, under RNAse-free conditions. The isolated RNA was dissolved in diethylpyrocarbonate-treated water and stored at -80°C until used. RNA concentration was determined by absorbance readings at 260 nm with the Hitachi UV-VIS (U-2000) spectrophotometer (Tokyo, Japan). RNA integrity was tested by PCR amplification of the beta-actin housekeeping gene. As positive and negative controls, RNA samples were also prepared from the human tumor cell lines MCF-7 and ARH-77, respectively.
RT-PCR TTATTGGCAGGTCAGGAGAAGAGCC (reverse; P2); TCCCGCGACTACAGCCACTACTACACGACC (forward; P3); CGCGACTTGATGTCCATGAGCCGCTGGTAC (reverse; P4); and for beta-actin: CATCCTGTCGGCAATGCCAGG (forward; A1) and CTTCTTGGGCATGGAGTCCTG (reverse; A2). The corresponding sizes of PCR products were 745 and 154 base pairs, respectively. These primers extend across at least an intron, so an eventual DNA contamination would not pose a significant problem. The CK-19 gene expression was evaluated by nested PCR as described by Datta et al.18 The conditions for beta-actin PCR were one cycle at 94°C for 2 minutes, followed by 35 cycles at 94°C for 30 seconds, 60°C for 30 seconds, and 72°C for 45 seconds and a final extension at 72°C for 4 minutes. Ten microliters of all PCR products were electrophoresed on 2% agarose gels and visualized with ethidium bromide.
Statistical Analysis
Sensitivity and Specificity of CK-19 mRNA Detection in Peripheral Blood In preliminary experiments, RNA extracted from MCF-7 and ARH-77 cells was amplified using the set of primers described in the Patients and Methods. The MCF-7 cell line was consistently positive, whereas the ARH-77 cell line was negative (Fig 1). Moreover, no amplification product could be detected by nested RT-PCR performed on RNA from both cell lines in the absence of the RT enzyme, which demonstrates that any contaminating DNA derived from the processed pseudogene would not amplify using the above-mentioned pair of primers.
Subsequently, the sensitivity of CK-19 mRNA detection was evaluated by nested RT-PCR analysis. For this purpose, MCF-7 cells were mixed with PBMCs from healthy blood donors in a cell ratio ranging from 1:10 to 1:106 cells, which mimics the clinical setting for detection of mammary cells in patients’ peripheral blood or bone marrow. Representative results of a positive nested RT-PCR are shown in Fig 2, demonstrating a dose-dependent 745-base pair signal whereas the 154-base pair signal, corresponding to the beta-actin gene, gave the same intensity in all dilutions. In four of five identical experiments, this assay was capable of detecting one MCF-7 cell among 106 normal hematopoietic cells.
RNA isolated from the PBMCs of 54 healthy female blood donors was also tested for the presence of CK-19 mRNA. As shown in Table 1 two samples (3.7%) were positive, whereas 52 samples (96.3%) were negative. Table 1 also demonstrates that 21 peripheral blood samples (42%) from 50 patients with metastatic breast cancer obtained before the initiation of front-line chemotherapy and/or hormone treatment were positive for CK-19 mRNA. Similarly, RNA isolated from the PBMCs of 28 patients with hematologic malignancies and 31 patients with metastatic colorectal cancer before the initiation of front-line chemotherapy revealed four (14.3%) and one (3.2%) CK-19 mRNA-positive samples, respectively. It should be mentioned that among the four CK-19 mRNA-positive patients with hematologic malignancies, two suffered from chronic myelogenous leukemia, one from myelodysplastic syndrome with excess of blasts, and one from chronic lymphocytic leukemia. All of samples from control patients and healthy blood donors were positive for beta-actin mRNA, which indicates the presence of intact RNA and successful first-strand cDNA preparation. These results indicate that the detection of CK-19 mRNA in the peripheral blood is highly associated with breast cancer, despite the fact that a small number of false-positive results (usually < 5%) may be obtained in healthy female blood donors.
Detection of Occult CK-19 mRNA-Positive Cells in the Bone Marrow Aspirates of Patients With Operable and Metastatic Breast Cancer Peripheral blood and bone marrow aspirates were simultaneously obtained from 27 patients with operable (stages I and II) and 46 with metastatic (stage IV) breast cancer, and all of these samples were analyzed for the detection of CK-19 mRNA-positive cells. The smears of all bone marrow aspirates were negative for the presence of malignant cells by conventional microscopic examination. Table 2 indicates that 17 (63%) and eight (30%) of 27 bone marrow and peripheral blood samples from patients with operable breast cancer, respectively, were CK-19 mRNA-positive. Similarly, 34 (74%) and 24 (52%) of 46 bone marrow and peripheral blood samples from patients with metastatic breast cancer, respectively, were CK-19 mRNA-positive.
Ten patients (37%) with operable breast cancer and 12 (26%) with metastatic breast cancer did not display CK-19 mRNA-positive cells in either bone marrow aspirates or peripheral blood. Furthermore, nine (33%) and 10 (22%) patients with operable and metastatic breast cancer, respectively, had CK-19 mRNA-positive cells in their bone marrow aspirates but not in the peripheral blood. Conversely, eight (30%) and 24 (52%) of the patients with operable and metastatic breast cancer, respectively, presented occult CK-19 mRNA-positive cells simultaneously in the peripheral blood and the bone marrow. Finally, no patient with either operable or metastatic disease presented CK-19 mRNA-positive cells in the peripheral blood in the absence of such cells in bone marrow aspirates (Table 2).
Detection of CK-19 mRNA in the Peripheral Blood of Patients With Operable Breast Cancer
CK-19 mRNA-positive cells could be detected in the peripheral blood of 44 patients (29.7%) (Table 3). In univariate analyses, there was no statistically significantly association between the detection of CK-19 mRNA-positive cells and the patients’ menstrual status, stage of the disease, size and histologic grade of the tumor, number of involved lymph nodes, or estrogen or progesterone receptor positivity (Table 3).
Clinical Relevance of the Detection of Peripheral Blood CK-19 mRNA-Positive Cells in Patients With Operable Breast Cancer
Furthermore, the multivariate application of the Cox proportional model yielded only three factors with significant independent influence on the DFI: the presence of CK-19 mRNA-positive cells in the peripheral blood (hazard ratio, 5.09; 95% CI, 1.89 to 13.69), four or more involved lymph nodes (hazard ratio, 2.74; 95% CI, 1.05 to 7.14), and ER-negative status (hazard ratio, 2.7; 95% CI, 1.04 to 7.04) (Table 5).
Survival. During the follow-up period, eight patients (5.4%) died of breast cancer. As shown in Table 4, the presence of CK-19–positive cells in the blood was associated with decreased overall survival (hazard ratio, 6.13; 95% CI, 1.24 to 30.47). The Kaplan-Meier estimates of the overall survival rates for the CK-19 mRNA-positive and CK-19 mRNA-negative groups were significantly different (log-rank test, P = .011) in favor of patients who were CK-19 mRNA-negative in the peripheral blood (Fig 4).
In the Cox proportional hazards analysis, only the presence of CK-19 mRNA-positive cells in the peripheral blood, ER status, and tumor size were significant parameters influencing overall survival. Table 5 indicates that the hazard of death of patients with CK-19 mRNA-positive cells was increased by a factor of 8.59 (95% CI, 1.47 to 50.03). Similarly, the hazard of death was increased by a factor of 5.75 (95% CI, 1.08 to 30.30) in patients with ER-negative tumors and (multiplicatively) by a factor of 1.54 (95% CI, 1.03 to 2.31) for each extra centimeter of tumor size. The absence of a significant interaction between these factors indicates that their effects on the hazard of death were independent.
The established prognostic factors of tumor size and axillary lymph node status contained in the tumor-node-metastasis classification of breast cancer are incapable of identifying a subgroup of women who, although they present with early-stage disease, may be at high risk of relapse and death.1 This is due to the early dissemination of malignant cells from the original tumor through hematogenous and/or lymphatic pathways and the failure of the adjuvant treatment to eliminate them.8,28 Several studies have shown that the detection of occult carcinoma cells in the bone marrow by immunohistochemistry is associated with an increased risk of relapse and reduced survival in patients with early-stage breast cancer.9-11 Furthermore, the detection of disseminated carcinoma cells in the bone marrow using either an antibody directed against mucin11 or a common cytokeratin epitope29 has an independent prognostic value, which is superior to that of the axillary lymph node status in women with early-stage breast cancer. However, for the detection of occult tumor cells circulating in the peripheral blood, a more sensitive technique, such as nested RT-PCR, may be required. The RT-PCR for CK-19 mRNA is capable of detecting one tumor cell in one million normal cells, which is at least 10 times more sensitive than immunohistochemistry.19 In this study, we evaluated a nested RT-PCR assay for CK-19 mRNA as a detection marker of circulating breast cancer cells in the peripheral blood of patients with operable breast cancer before the initiation of any adjuvant therapy. We analyzed our findings to assess the prognostic significance of CK-19 mRNA detection in the peripheral blood in association with the other known prognostic factors and the clinical outcome of these patients. The nested RT-PCR for CK-19 mRNA showed a sensitivity of detecting one tumor cell among 106 normal PBMCs, which is in accordance with previous reports.19 CK-19 mRNA was detectable in the blood of 3.7% of healthy blood donors, 14.3% of patients with hematologic malignancies, and 3.2% of patients with metastatic colorectal cancer. Similarly, other investigators have also detected CK-19 transcripts in the PBMCs of healthy subjects.30,31 In contrast, some other investigators have failed to confirm this finding,19,32-34 albeit using the same primers as in the present study.18,22,35-37 These conflicting results may be due to the different experimental conditions used in each study. For example, different investigators using the same primers may have different results18,30 depending on the amount of RNA used at the beginning of the reaction or the number of amplification cycles. The results may also be different between one-step RT-PCR versus nested RT-PCR. In the first case, the specificity is increased but the sensitivity may be reduced to as low as detecting 104 tumor cells in 10 mL of blood; the opposite is true for the nested reaction.38,39 Alternatively, the false-positive results may be due to the detection of CK-19 pseudogenes a and b40 or even due to sample contamination with epithelial cells of the skin during vein puncture.41 Although the primers used in this study do not rule out amplification of these CK-19 pseudogenes, all blood samples were obtained at the middle of vein puncture in order to avoid blood contamination with epithelial cells. Furthermore, because the RT-PCR assay detects minimal amounts of specific mRNA among a plethora of other RNA, the risk of illegitimate transcription of the CK-19 gene is increased. This may involve the ectopic transcription of the CK-19 gene in hematopoietic cells42,43 or the expression of any gene in any cell type.44 However, there are studies indicating that by altering the experimental conditions, such as the hybridization temperature, the number of cycles, or the sequence of primers, especially for the nested PCR assay, it is feasible to reduce the sensitivity of detecting these low-level transcripts.45 CK-19 mRNA-positive cells were detected in the bone marrow and the peripheral blood of 63% and 30% of patients with early and 74% and 52% of patients with metastatic breast cancer, respectively. Similar to our results, others have also reported higher detection rates for CK-19 mRNA-positive cells in the bone marrow than in the peripheral blood.19 In the prospectively studied cohort of 148 patients with early breast cancer, CK-19 mRNA-positive cells were detected in the peripheral blood of 44 patients (29.7%). Surprisingly, there was no statistically significant association between the detection of CK-19 mRNA-positive cells and important parameters of tumor burden, such as stage of disease, size and histologic grade of the tumor, and number of involved axillary lymph nodes. This apparent inconsistency may be due to the different dissemination pathways that breast cancer cells utilize, ie, lymphatic spread of the tumor is independent of hematogenous dissemination. In a recent immunocytochemical comparative analysis of bone marrow and lymph node micrometastasis in 150 node-negative patients with stage I and II breast cancer, CK-positive cells were detected in the bone marrow of 44 patients (29%), whereas only 13 patients (9%) had CK-positive cells in the lymph nodes.29 Simultaneous microdissemination to bone marrow and lymph nodes was seen in only two patients, and no correlation was found between bone marrow micrometastases and the other known risk factors. This may be explained by the distinct biologic characteristics of the disseminated cancer cells. Early hematogenous dissemination has been associated with increased tumor angiogenesis as well as a number of tumor-associated characteristics, such as expression of urokinase plasminogen activator receptor, overexpression of the erbB2 oncogene, and deficient expression of major histocompatibility complex class I molecules.8 Considering that solid tumors usually contain multiple clones, it is possible that only a small subset of cancer cells of the primary tumor have the biologic characteristics to become disseminated tumor cells. Therefore, the likelihood of finding disseminated cancer cells may not necessarily parallel the primary tumor load, nor can it be predicted by the well-known risk factors. More importantly, the detection of CK-19 mRNA-positive cells in the blood had prognostic implications for the patients with stage I and II breast cancer because it was associated with reduced DFI (P = .0007) and overall survival (P = .01). The Cox proportional hazards analysis indicated that the detection of CK-19 mRNA-positive cells in the peripheral blood, the number of involved axillary lymph nodes, and the status of ER expression by the tumor were the only important factors affecting the duration of DFI. During the follow-up period, only eight patients died as a result of disease relapse. Although the odds ratio is large, suggesting that there is an association between the detection of CK-19 mRNA-positive cells in the peripheral blood and the hazard of death, the small sample yields wide confidence intervals. Thus it is necessary to be cautious about the interpretation of this finding. In the multivariate analysis, the presence of CK-19 mRNA-positive cells in the peripheral blood, the status of ER expression, and the size of the tumor were the only significant factors affecting the overall survival of the patients. These results clearly demonstrate the significant and independent prognostic value of CK-19 mRNA detection by RT-PCR in the peripheral blood of patients with stages I and II breast cancer. Tumor cell detection by RT-PCR relies on the selective amplification of mRNA transcripts of genes presumably expressed only in tumor cells and not in normal tissues. Such tumor-specific genes are not known for the majority of common solid tumors, and therefore tumor cell detection usually relies on the amplification of epithelial genes involved in tissue differentiation or the malignant transformation. The cytokeratins are proteins expressed in a majority of epithelial tumors and in most of the cells of these tumors.8 The malignant nature of CK-positive cells in the bone marrow has been confirmed through genomic analysis using fluorescence in situ hybridization, where multiple chromosomal aberrations and amplification of the c-erbB2 gene have been demonstrated in these cells.46,47 Although the prognostic value of the immunohistochemical detection of CK-positive cells in the bone marrow has been established,9-11,29 the significance of CK-19 mRNA detection by RT-PCR in the peripheral blood of patients with operable breast cancer has been, up until now, largely unknown. In this study, we found that the detection of CK-19 mRNA-positive cells in the peripheral blood of patients with stages I and II breast cancer before the initiation of any adjuvant treatment is a significant adverse prognostic factor associated with shortened DFI and overall survival. While the administration of cytotoxic chemotherapy does not completely eliminate CK-positive tumor cells,28 possibly because of the dormant and noncycling nature of these cells, other treatments, such as monoclonal antibodies, may prove to be more effective.48,49 Future studies should examine the use of RT-PCR CK-19 mRNA detection, preferably with a quantitative method, in monitoring minimal residual disease after the administration of novel adjuvant therapies.
Supported in part by the Cretan Association for Biomedical Research and a research grant from the Hellenic General Secretary of Research (HGSR). A.S. was a recipient of an HGSR research fellowship.
1. Carter CL, Allen C, Henson DE: Relation of tumor size, lymph node status, and survival in 24740 breast cancer cases. Cancer 63: 181-187, 1989[CrossRef][Medline]
2. McGuire WL: Breast cancer prognostic factors: Evaluation guidelines. J Natl Cancer Inst 83: 154-155, 1991
3. Goldhirsch A, Wood WC, Senn HJ, et al: Meeting highlights: International consensus panel on the treatment of primary breast cancer. J Natl Cancer Inst 87: 1441-1445, 1995 4. DeVita VT Jr: Breast cancer therapy: Exercising all our options. N Engl J Med 320: 527-529, 1989[Medline]
5. Overgaard M, Hansen PS, Overgaard J, et al: Postoperative radiotherapy in high-risk premenopausal women with breast cancer. N Engl J Med 337: 949-955, 1997
6. Ragaz J, Jackson SM, Le N, et al: Adjuvant radiotherapy and chemotherapy in node-positive premenopausal women with breast cancer. N Engl J Med 337: 956-962, 1997
7. Lambrechts AC, van Veer LJ, Rodenhuis S: The detection of minimal numbers of contaminating epithelial tumor cells in blood or bone marrow: Use, limitations and future of RNA-based methods. Ann Oncol 9: 1269-1276, 1998
8. Pantel K, Cote RJ, Fodstad O: Detection and clinical importance of micrometastatic disease. J Natl Cancer Inst 91: 1113-1124, 1999 9. Cote RJ, Rosen PP, Lesser ML, et al: Prediction of early relapse in patients with operable breast cancer by detection of occult bone marrow micrometastases. J Clin Oncol 9: 1749-1756, 1991[Abstract]
10. Braun S, Pantel K, Muller P, et al: Cytokeratin-positive cells in the bone marrow and survival of patients with stage I, II or III breast cancer. N Engl J Med 342: 525-533, 2000
11. Diel IJ, Kaufmann M, Costa SD, et al: Micrometastatic breast cancer cells in bone marrow at primary surgery: Prognostic value in comparison with nodal status. J Natl Cancer Inst 88: 1652-1658, 1996 12. Mansi JL, Easton D, Berger U, et al: Bone marrow micrometastases in primary breast cancer: Prognostic significance after 6 years’ follow up. Eur J Cancer 27: 1552-1555, 1991[Medline]
13. Fields KK, Elfenbein GJ, Trudeau WL, et al: Clinical significance of bone marrow metastases as detected using the polymerase chain reaction in patients with breast cancer undergoing high-dose chemotherapy and autologous bone marrow transplantation. J Clin Oncol 14: 1868-1876, 1996 14. Harbeck N, Untch M, Pache L, et al: Tumour cell detection in the bone marrow of breast cancer patients at primary therapy: Results of a 3-year median follow-up. Br J Cancer 69: 566-571, 1994[Medline] 15. Funke I, Schraut W: Meta-analyses of studies on bone marrow micrometastases: An independent prognostic impact remains to be substantiated. J Clin Oncol 16: 557-566, 1998[Abstract] 16. Chaiwun B, Saad AD, Groshen S, et al: Immunohistochemical detection of occult carcinoma in bone marrow and blood: Critical analysis of efficiency of separation, preparation and limits of detection in a model system. Diagn Oncol 2: 267-276, 1992 17. Pantel K, Schlimok G, Angstwurmm M, et al: Methodological analysis of immunocytochemical screening for disseminated epithelial tumor cells in bone marrow. J Hematother 3: 165-173, 1994[Medline] 18. Datta YH, Adams PT, Drobyski WR, et al: Sensitive detection of occult breast cancer by the reverse-transcriptase polymerase chain reaction. J Clin Oncol 12: 475-482, 1994[Abstract] 19. Schoenfeld A, Kruger KH, Gomm J, et al: The detection of micrometastases in the peripheral blood and bone marrow of patients with breast cancer using immunohistochemistry and reverse transcriptase polymerase chain reaction for keratin 19. Eur J Cancer 33: 854-861, 1997[CrossRef][Medline] 20. Vannucchi AM, Bosi A, Glinz S, et al: Evaluation of breast tumor cell contamination in the bone marrow and leukapheresis collections by RT-PCR for cytokeratin-19. Br J Haematol 103: 610-617, 1998[CrossRef][Medline]
21. Slade MJ, Smith BM, Sinnett HD, et al: Quantitative polymerase chain reaction for the detection of micrometastases in patients with breast cancer. J Clin Oncol 17: 870-879, 1999 22. Zhong XY, Kaul S, Diel I, et al: Analysis of sensitivity and specificity of cytokeratin 19 reverse transcriptase-polymerase chain reaction for the detection of occult breast cancer in bone marrow and leukapheresis products. J Cancer Res Clin Oncol 125: 286-291, 1999[CrossRef][Medline] 23. Cox DR: The Analysis of Binary Data. London, United Kingdom, Methuen, 1970 24. Collett D: Modelling Binary Data. London, United Kingdom, Chapman and Hall, 1999 25. Collett D: Modeling Survival Data in Medical Research. London, United Kingdom, Chapman and Hall, 1994 26. Altman GD: Practical Statistics for Medical Research. London, United Kingdom, Chapman and Hall, 1991 27. Armitage P, Berry G: Statistical Methods in Medical Research, ed 3 . Oxford, United Kingdom, Blackwell Scientific, 1994
28. Braun S, Kentenich C, Janni W, et al: Lack of effect of adjuvant chemotherapy on the elimination of single dormant tumor cells in the bone marrow of high-risk breast cancer patients. J Clin Oncol 18: 80-86, 2000
29. Braun S, Cevalti B, Assemi C., et al: Comparative analysis of micrometastasis to the bone marrow and lymph nodes of node-negative breast cancer patients receiving no adjuvant chemotherapy. J Clin Oncol 19: 1468-1475, 2001 30. Krismann M, Todt B, Schroder J, et al: Low specificity of cytokeratin 19 reverse transcriptase-polymerase chain reaction analyses for detection of hematogenous lung cancer dissemination. J Clin Oncol 13: 2769-2775, 1995[Abstract] 31. Burchill SA, Bradbury MF, Pittman K, et al: Detection of epithelial cancer cells in peripheral blood by reverse transcriptase-polymerase chain reaction. Br J Cancer 71: 278-281, 1995[Medline] 32. Moscinski LC, Trudeau WL, Fields KK, et al: High-sensitivity detection of minimal residual breast carcinoma using the polymerase chain reaction and primers for cytokeratin-19. Diagn Mol Pathol 5: 173-180, 1995 33. Kruger W, Krzizanowski C, Holweg M, et al: Reverse transcriptase-polymerase chain reaction detection of cytokeratin-19 mRNA in bone marrow and blood of breast cancer patients. J Cancer Res Clin Oncol 122: 679-686, 1996[CrossRef][Medline] 34. Traweek ST, Liu J, Battifora H: Keratin gene expression in non-epithelial tissues: Detection with polymerase chain reaction. Am J Pathol 142: 1111-1118, 1993[Abstract] 35. Berois N, Varangot M, Osinaga E, et al: Detection of rare human breast cancer cells: Comparison of an immunomagnetic separation method with immunochemistry and RT-PCR. Anticancer Res 17: 2639-2646, 1997[Medline] 36. Berois N, Varangot M, Aizen B, et al: Molecular detection of cancer cells in bone marrow and peripheral blood of patients with operable breast cancer: Comparison of CK-19, MUC1 and CEA using RT-PCR. Eur J Cancer 36: 717-723, 2000[Medline]
37. Peck K, Sher YP, Shih JY, et al: Detection and quantitation of circulating cancer cells in the peripheral blood of lung cancer patients. Cancer Res 58: 2761-2765, 1998 38. Eltahir EM, Mallinson DS, Birnie GD, et al: Putative markers for the detection of breast carcinoma cells in blood. Br J Cancer 77: 1203-1207, 1998[Medline]
39. Schoenfeld A, Luqmani Y, Smith D, et al: Detection of breast cancer micrometastases in axillary lymph nodes by using polymerase chain reaction. Cancer Res 54: 2986-2990, 1994 40. Ruud P, Fodstad O, Hovig E: Identification of a novel cytokeratin 19 pseudogene that may interfere with reverse transcriptase-polymerase chain reaction assays used to detect micrometastatic tumor cells. Int. J Cancer 80: 119-125, 1999
41. Ko
42. Novacs M, Bendit I, Garicochea B, et al: Reverse transcriptase-polymerase chain reaction analysis of cytokeratin 19 expression in the peripheral blood mononuclear cells of normal female blood donors. Mol Pathol 50: 209-211, 1997 43. Jung R, Kruger W, Hosch S, et al: Specificity of reverse transcriptase polymerase chain reaction assays designed for the detection of circulating cancer cells is influenced by cytokines in vivo and in vitro. Br J Cancer 78: 1194-1198, 1998[Medline]
44. Chelly J, Concordet JP, Kaplan JC, et al: Illegitime transcription: Transcription of any gene in any cell type. Proc Natl Acad Sci U S A 86: 2617-2621, 1989 45. He Q, Marjamaki M, Soini H, et al: Primers are decisive for sensitivity of PCR. Biotechniques 17: 82-87, 1994[Medline] 46. Engel H, Kleespies C, Friedrich J, et al: Detection of circulating tumour cells in patients with breast or ovarian cancer by molecular cytogenetics. Br J Cancer 81: 1165-1173, 1999[CrossRef][Medline] 47. Muller P, Weckermann D, Rietmuller G, et al: Detection of genetic alterations in micrometastatic cells in bone marrow of cancer patients by fluorescence in situ hybridization. Cancer Genet Cytogenet 88: 8-16, 1996[CrossRef][Medline] 48. Schlimok G, Pantel K, Loibner H, et al: Reduction of metastatic carcinoma cells in bone marrow by intravenously administered monoclonal antibody: Towards a novel surrogate test to monitor adjuvant therapies of solid tumours. Eur J Cancer 31: 1799-1803, 1995[CrossRef]
49. Braun S, Hepp F, Kentenich C, et al: Monoclonal antibody therapy with edrecolomab in breast cancer patients: Monitoring of elimination of disseminated cytokeratin-positive tumor cells in bone marrow. Clin Cancer Res 5: 3999-4004, 1999 Submitted August 21, 2001; accepted May 7, 2002.
This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|
|||||||||||
|
|||||||||||
|
|
Copyright © 2002 by the American Society of Clinical Oncology, Online ISSN: 1527-7755. Print ISSN: 0732-183X
|
TOP
ABSTRACT
INTRODUCTION
, Grunewald E, Totzke G, et al: High percentage of false-positive results of cytokeratin 19 RT-PCR in blood: A model for the analysis of illegitimate gene expression. Oncology 59: 81-88, 2000
