|
|||||
|
|
||||||
Originally published as JCO Early Release 10.1200/JCO.2002.08.009 on July 1 2002 © 2002 American Society for Clinical Oncology Tyrosinase mRNA in Blood of Patients With Melanoma Treated With Adjuvant InterferonByFrom the Medical Oncology Department, Institut de Malalties Hemato-Oncològiques, and Dermatology Department, Hematopathology Laboratory, and Epidemiology Department, Institut de Investigacions Biomèdiques August Pi i Sunyer Hospital Clínic, University of Barcelona, Barcelona, Spain. Address reprint requests to Begoña Mellado, MD, Medical Oncology Department, Hospital Clínic, University of Barcelona, C/Villarroel, 170, 08036 Barcelona, Spain; email: bmellado{at}clinic.ub.es
PURPOSE: To evaluate the clinical significance of the detection of circulating melanoma cells in patients treated with adjuvant interferon and to determine their potential value as a marker of interferon response. PATIENTS AND METHODS: We prospectively analyzed 616 peripheral-blood samples from 120 melanoma patients with stage IIA (n = 33), IIB (n = 22), III (n = 50), or IV (surgically resected) (n = 15) disease receiving adjuvant interferon alfa-2b therapy. Tyrosinase mRNA was assayed by reverse transcriptase polymerase chain reaction (RT-PCR) as a marker of circulating melanoma cells before the start of interferon and every 2 to 3 months thereafter. RESULTS: With a median follow-up time of 32.3 months (range, 7.1 to 77.5 months), 47 patients (39.8%) relapsed and 31 (26%) died. During adjuvant interferon treatment, 76 patients (64%) had undetected circulating melanoma cells and 44 patients (36%) had a positive RT-PCR result in at least one sample. Actuarial 5-year disease-free survival was 62% in patients with persistently negative RT-PCR during interferon treatment and 38% for patients with positive RT-PCR during interferon (P = .02). Actuarial 5-year overall survival was 75% and 50%, respectively (P = .03). CONCLUSION: Patients with melanoma and tyrosinase mRNA detected in the blood during adjuvant interferon therapy had a worse prognosis compared with patients with undetected tyrosinase mRNA during treatment. Further investigation into the detection of circulating melanoma cells as a surrogate marker of response to adjuvant interferon therapy is warranted.
INTERFERON HAS recently became a widely used adjuvant therapy for high-risk melanoma patients since several studies have reported that it might reduce the risk of relapse and death of patients with surgically resected high-risk melanoma.1-4 Unfortunately, many patients still relapse despite of the administration of adjuvant interferon. In this scenario, it would be important to find markers of interferon response, with the ultimate goal of identifying those patients who are more likely to benefit from interferon therapy and those who would need newer therapeutic strategies. A series of studies have addressed the prognostic implications of the detection of circulating tumor cells in the blood from patients with melanoma treated surgically. Since the seminal study by Smith et al,5 many studies have assessed the presence of tyrosinase mRNA by reverse transcriptase polymerase chain reaction (RT-PCR) in the blood from melanoma patients as a marker of circulating melanoma cells. Tyrosinase mRNA is specifically expressed in melanocytes, Schwann cells, and melanoma cells. Since melanocytes do not circulate, the detection of tyrosinase mRNA in blood translates to the presence of circulating melanoma cells. Subsequent studies confirmed the ability to detect mRNA tyrosinase by RT-PCR in the blood of melanoma patients and investigated the potential clinical implications of this assay.6-28 We and others have reported that the presence of circulating malignant cells detected by the amplification of tyrosinase mRNA and/or other melanoma markers by RT-PCR has an adverse prognostic value in patients with melanoma.10-13,16-18,23-28 Additionally, we detected tyrosinase mRNA in the blood of patients months or years after the initial treatment. The finding of circulating melanoma cells during the late follow-up of clinically disease-free melanoma patients was also associated with a poor outcome.17 These data led us to look at melanoma as a systemic disease and to believe that a potential end point of adjuvant systemic immunotherapy could be to maintain patients with undetectable malignant cells in peripheral blood. Since adjuvant interferon treatment is now widely used in high-risk melanoma patients, we decided to investigate, in a prospective fashion, whether the prognostic value of circulating melanoma cells was maintained in patients treated with adjuvant interferon. We hypothesized that the presence of circulating melanoma cells during adjuvant interferon treatment could be a surrogate marker of tumor resistance, which may indicate the need to change the therapeutic strategy. To study this hypothesis, we prospectively tested tyrosinase mRNA, before and, on a serial basis, during treatment, in 120 melanoma patients who where rendered clinically free of disease by surgery and were receiving adjuvant interferon alfa-2b therapy at our institution. To our knowledge, this is the first time that such a study has been conducted, since in previously published studies patients were not treated with adjuvant interferon.
Patients The inclusion criterion was a histologically documented diagnosis of melanoma, stage IIA, IIB, III, or IV (metastasis surgically resected), treated by surgery followed by adjuvant interferon alfa-2b therapy. History of another malignancy was an exclusion criterion. The study was approved by the ethics committee of the hospital, and informed consent was obtained from each patient for participation in the study. Blood for RT-PCR was obtained at the same time as the blood extraction performed during previously established follow-up: the first collected 15 mL of blood was used for standard biochemistry and cell blood count; the next 10 mL were used for RT-PCR studies. Clinical stage and therapy were documented at the time of entry onto the study. The clinical outcome of the patients was prospectively followed. Clinical staging consisted of medical history, physical examination, cell blood count, blood biochemistry, and chest x-ray. Other complementary examinations were performed if clinically indicated. Clinical stage was defined based on American Joint Committee on Cancer guidelines. All patients received adjuvant interferon alfa-2b (Schering-Plough, Kenilworth, NJ). Patients with stage IIA or higher disease who refused high-dose interferon or in whom it was contraindicated received low-dose interferon (3 million units [MU] 3 days per week subcutaneously for 2 years). Patients with stage IIB, III, or IV disease received high-dose interferon (20 MU/m2/d intravenously 5 days per week for 4 weeks, followed by 10 MU/m2/d 3 days per week for 1 year). Intermediate-dose interferon (10 MU/d subcutaneously 5 days per week for 4 weeks, followed by 5 MU/d 3 days per week for 2 years) was administered to a subgroup of stage II and III patients included in an internal adjuvant study performed at our institution. A blood sample for RT-PCR was obtained 3 to 6 weeks after surgical treatment, before the start of interferon therapy (baseline PCR). During interferon therapy, patients were tested for tyrosinase mRNA in blood every 2 to 3 months until the end of the treatment (serial PCR). No clinical decisions were made based on the results of the RT-PCR assay.
Samples
RT-PCR Method For synthetic oligonucleotides, primer sequences were devised from published sequences of tyrosinase gene.9 Outer primers were as follows: HTYR1 (sense), TTGGCAGATTGTCTGTAGCC; and HTYR2 (antisense), AGGCATTGTGCATGCTGCT. Nested primers were as follows: HTRY3 (sense), GTCTTTATGCAATGGAACGC; and HTYR4 (antisense), GCTATCCCAGTAAGTGGACT. The outer primers amplified a PCR product of 284 base pairs (bp) and the nested primers amplified a fragment of 207 bp. Integrity of RNA for RT-PCR assay was determined by performing parallel RT-PCR reactions using primers specific for beta-globin11 and/or by running RNA in a 1% agarose gel. Samples that failed to show the 28s and 18s ribosomal bands were considered degraded and ineligible for the study. Negative controls of the RT-PCR reaction included a sample without RNA. The human melanoma-derived cell line SK-mel 28 (American Type Culture Collection, Rockville, MD) was used as a positive control. The sensitivity of our RT-PCR was determined by performing serial dilutions of SK-mel 28 cells in 10-7 normal mononucleated cells. With the described conditions, we were able to detect one SK-mel 28 cell in 106 mononucleated cells by RT-PCR and one SK-mel 28 cell in 107 mononucleated cells by Southern blot analysis.11,17 Southern blot analysis was performed to confirm that our RT-PCRamplified products were indeed from tyrosinase. After electrophoresis gels were transferred overnight to a nitrocellulose membrane with 20 times standard saline citrate buffer. Membranes were hybridized with an oligonucleotide complementary to a region in the tyrosinase c-DNA, using a nonisotopic fluorescein 3'-oligolabeling system (Amersham, Buckinghamshire, United Kingdom). Every sample was tested in two different RT-PCR assays. If both assays showed a 207-bp band, the sample was classified as positive. If no band was detected in either of the two assays, the sample was considered negative. If a discordance in a result was observed between two reactions (a positive and a negative result of the same sample), the sample was subjected to two additional independent RT-PCR assays. If one or both additional assays were positive, the sample was classified as positive. If the two additional assays were negative, the sample was classified as negative. We only had 24 (3.8%) of 616 samples with a single positive assay that could not be confirmed in any additional RT-PCR reaction. Southern blot analysis after nested RT- PCR was performed in these samples, and none of them became positive with RT-PCR plus Southern blot analysis. We considered these samples to be negative for further analysis.
Statistic Analysis
Patients A total of 120 patients participated in this study. Patients characteristics and treatment are described in Table 1. Clinical stage was IIA for 33 patients, IIB for 22 patients, III for 50 patients, and IV for 15 patients. Sites of metastasis in stage IV patients were skin in five patients, lymph nodes in five patients, skin and lymph nodes in two patients, single lung node in two patients, and the intestines in one patient. The median follow-up time was 32.3 months (range, 7.1 to 77.5 months). At the time of this analysis, two patients had been lost to follow-up and were not included in the prognosis studies. Forty patients received low-dose interferon (25, stage IIA; five, IIB; four, III; six, stage IV), 16 received an intermediate dose (eight, stage IIA; seven, IIB; one, III), and 64 received high-dose interferon (10, stage IIB; 45, III; nine, IV). In eight patients treated with high-dose interferon, treatment was discontinued because of severe toxicity (neurotoxicity in one patient, psychiatric toxicity in two patients, hepatic toxicity in two patients, retinal thrombosis in one patient, endocarditis in one patient, and Reynaud syndrome in one patient). In the low-dose group, therapy was discontinued in two patients: one patient developed myasthenia gravis and another patient spontaneously decided to stop therapy. In the intermediate-dose group, no discontinuations of treatment occurred. Six hundred sixteen blood samples were tested for tyrosinase mRNA. The median number of RT-PCR tests per patient was six (range, two to 11).
RT-PCR Results RNA samples showing the 28s and 18s ribosomal bands were considered eligible for the study. Samples showing a band of 207 bp in at least two separate reactions after a second round of amplification with nested primers were considered positive (Fig 1). Using the same RT-PCR technique, we had previously reported11,17 no false-positive results among 58 samples from nonmelanoma control patients (20 healthy subjects and 38 patients with other cancers). Hence, no illegitimate transcription in the hematopoietic cells was observed among the nonmelanoma controls with the experimental conditions used.
RT-PCR Results and Clinical Features Twenty-one patients (17.5%) were positive and 99 (82.5%) were negative for tyrosinase before the start of interferon therapy. Forty-four patients (36%) were positive and 76 (64%) were negative for tyrosinase during interferon therapy. Fifty-three patients (44%) had at least a positive result either before or during therapy. The median number of positive tests per patient was two (range, one to five). Among the 99 patients with a negative result before the start of interferon, 31 (31%) had positive results under therapy. Among the 21 patients with positive baseline RT-PCR for tyrosinase (ie, before starting adjuvant interferon), eight (38%) reverted to negative during interferon therapy and 13 (62%) remained positive under treatment. The percentage of RT-PCR in different stages of disease and by dose of interferon, before and during therapy, is shown in Table 2. The RT-PCR results did not correlate with clinical stage. No correlation was found between RT-PCR results and Breslow thickness, Clark level, tumor site, histology, sex, or age (data not shown).
Preinterferon RT-PCR Results and Prognosis Of the 118 eligible patients for prognostic studies, 47 (39.8%) relapsed and 31 (26%) died from melanoma dissemination. For the whole group, median DFS was 41 months and median OS was not reached. Twenty-one (17.8%) out of 118 patients had a positive preinterferon (baseline) RT-PCR and 97 (82.2%) were negative. Median DFS was not reached for patients with baseline-negative results, and it was 45.2 months for positive patients (P = .9). Median OS was not reached in either of the two groups (P = .2). Clinical stage and dose of interferon were factors associated with DFS and OS in the univariate analysis. Patients receiving high-dose interferon had a significantly lower DFS and OS than patients receiving an intermediate or low dose. Median DFS was 27.6 months for the low-dose group, 36.6 months for the intermediate-dose group, and 19.3 months for the patients receiving a high dose of interferon (P = .04). Median OS was 30.7 months for the patients treated with low-dose interferon, 42.6 months for the intermediate-dose group, and 31.4 months for the high-dose group (P = .04). These results are consistent with the fact that patients in the high-dose group had a more advanced stage of disease. In the multivariate analysis, the dose of interferon was not an independent prognostic factor for DFS and OS, while clinical stage maintained its prognostic value for DFS (P = .000073) and OS (P = .00072).
RT-PCR Results During Interferon Therapy and Prognosis
In patients in whom recurrence was diagnosed, the pattern of clinical relapse was identical independent of RT-PCR result. Eighty-seven percent (20 of 24) of the positive patients and 83% (19 of 23) of the negative patients developed distant metastasis. Three positive (13%) and four negative (17%) patients developed a locoregional relapse.
RT-PCR Positivity Before and/or During Interferon Therapy and Prognosis
RT-PCR Results and Dose of Interferon
In this report we show that circulating melanoma cells, detected by tyrosinase mRNA amplification by RT-PCR, during adjuvant interferon therapy were associated with a significantly increased risk of relapse and death. In previous work, we showed that the presence of tyrosinase mRNA in the blood of patients with melanoma, at the time of primary tumor diagnosis or during follow-up, correlated with a high risk of relapse and death.11,17 A number of clinical studies have also demonstrated that the presence of circulating melanoma cells is linked to a poor prognosis.10-13,16-18,23-28 In the present work, we specifically studied patients receiving adjuvant interferon therapy. Our hypothesis was that interferon may be able to eliminate microscopic disease present at the time of diagnosis of high-risk melanoma patients, and that the persistence of circulating cells in patients receiving interferon may be indicative of treatment failure. Two studies support that a persistently negative RT-PCR result during interferon treatment would be associated with the lack of circulating melanoma cells rather than downregulation of tyrosinase mRNA caused by interferon. In a study published by Brossart et al,9 tyrosinase mRNA was detected in blood and bone marrow in patients with stage IV melanoma treated with interferon and interleukin-2, before and during therapy. The same group showed, with a semiquantitative RT-PCR assay for tyrosinase, that the amount of transcript correlated with response to immunotherapy.8 Here, we observed that positivity for tyrosinase mRNA in blood during the interferon treatment significantly correlated with a lower DFS and OS. Overall, these data provide novel evidence for the detection of circulating melanoma cells as an adverse prognostic marker during adjuvant interferon. Since the doses of interferon differed among patients, we performed a subset analysis of the study to explore a possible dose effect. In this analysis, the significant prognostic value of RT-PCR was maintained in patients treated with high-dose interferon. In the low- and intermediate-dose groups, the prognosis of RT-PCRpositive patients was also worse than that for RT-PCRnegative patients, but the differences were not statistically significant. Although we cannot formally rule out a dose effect, this result may also be due to the fact that the majority of patients received high doses of interferon and, in addition, the fact that the high-dose group included the patients with poorest prognosis who had a higher number of relapses/deaths. These two points result in a higher statistical power to detect significant differences in the high-dose group in comparison with the intermediate- or low-dose group. Additional patients would be required to further characterize this observation. In the present study, positivity for baseline tyrosinase mRNA in peripheral blood before the start of interferon therapy did not correlate with clinical stage or prognosis. This result differs from the correlations seen with stage and prognosis observed in our first series.11 This difference among the current and prior study11 might be due at least to the following considerations. First, there was a tighter grouping of intermediate/high-risk patients in this study compared with previous ones. In our previous publication,11 we included patients who had from stage I to bulky visceral stage IV disease, whereas in the present study, we included only patients with stage II and III disease, as well as a very limited group of patients with resected stage IV disease. Second, the timing of blood extraction must be considered. In our previous study, samples were drawn during the perioperative period, whereas in the present study, the first blood extraction was 3 to 6 weeks after surgery. We cannot rule out that this difference in the timing of blood extraction might have affected the results. Third, in the first study, patients did not receive adjuvant interferon, whereas in the present study, all patients were treated with interferon, which might possibly affect the prognostic implication of a baseline RT-PCR sample. We have to note, however, that a correlation between the effects (or the lack thereof) of interferon on individual patient outcomes and the presence or absence of tyrosinase mRNA in blood cannot be established because we did not have a parallel, matched control population not receiving interferon during the period of the study. To characterize this issue, it would be necessary to conduct a study to assay sequentially the mRNA tyrosinase in blood from patients randomized to receive interferon versus control. An as yet unresolved issue of the detection of circulating cells by RT-PCR is the low reproducibility of the results among different laboratories19,20 and in the same laboratory, when samples from the same patient are taken on different day time-points20 or even at the same time.12 The low reproducibility has been attributed to technical differences in sample preparation, RNA and cDNA synthesis, RT-PCR protocols, the small number of patients per study, the intermittent shedding of tumor cells into the blood, and to the small amount of circulating tumor cells. In our study, we observed isolated RT-PCRpositive samples that could not be confirmed in three additional separate RT-PCR reactions, and we considered them to be negative for further analysis. These unconfirmed "positive" results represent 3.8% of the analyzed samples. They may be false-positive results of the technique or indicate the presence of a very small amount of tyrosinase transcript in the blood. The last possibility is supported by results of a real-time PCR semiquantitative study21 showing that lower amounts of transcript of tyrosinase or MART-1 were found in samples with low reproducibility. In contrast, the amount of transcript of the target mRNA was significantly higher in samples with a positive result confirmed in four separate reactions. We cannot exclude that this minority of patients represents a different group with a lower volume of disease and a different clinical outcome. In conclusion, the detection of tyrosinase mRNA in the blood of patients with melanoma during adjuvant interferon therapy is associated with an increased risk of relapse and death from the disease. The use of a multiple marker assay and/or a semiquantitative RT-PCR assay may improve the usefulness of the serial detection of circulating melanoma cells as a surrogate marker of adjuvant treatment efficacy in melanoma.
This article was published ahead of print at www.jco.org. Supported by Plan Nacional I+D (SAS97-0093) (to T.C., B.M.). L.G. was supported by Amgen (1996) and a research grant from Asociación Española de la Lucha Contra el Cáncer (1997). M.C.V. was supported by Beca Instituto de Salud Carlos III.
1. Kirkwood JM, Strawderman MH, Ernstoff MS, et al: Interferon alfa-2b adjuvant therapy of high-risk resected cutaneous melanoma: The Easter Cooperative Oncology Group Trial EST 1684. J Clin Oncol 14: 7-17, 1996[Abstract]
2. Kirkwood JM, Ibrahim JG, Sondak VK, et al: High- and low-dose interferon alfa-2b in high-risk melanoma: First analysis of intergroup trial E1690/S9111/C9190. J Clin Oncol 18: 2444-2458, 2000
3. Kirkwood JM, Ibrahim JG, Sosman JA, et al: High-dose interferon alfa-2b significantly prolongs relapse-free and overall survival compared with GM2-KHL/QS-21 vaccine in patients with resected stage IIB-III melanoma: Results of Intergroup Trial E1694/S9512/C509801. J Clin Oncol 19: 2370-2380, 2001 4. Grob JJ, Dreno B, de la Salmonière P, et al: Randomised trial of interferon alfa-2a therapy in resected primary melanoma thicker than 1.5 mm without clinically detectable node metastases. Lancet 351: 1905-1910, 1998[CrossRef][Medline] 5. Smith B, Selby P, Southgate J, et al: Detection of melanoma cells in peripheral blood by means of reverse transcriptase and polymerase chain reaction. Lancet 338: 1227-1229, 1991[CrossRef][Medline]
6. Hoon DSB, Wang Y, Dale PS, et al: Detection of occult melanoma cells in blood with a multiple-marker polymerase chain reaction assay. J Clin Oncol 13: 2109-2116, 1995 7. Brossart P, Keilholz U, Willhauck M, et al: Hematogenous spread of malignant melanoma cells in different stages of disease. J Inves Dermatol 101: 887-890, 1993[CrossRef][Medline]
8. Brossart P, Shmier JW, Krüger S, et al: A polymerase chain reaction-based semiquantitative assessment of malignant melanoma cells in peripheral blood. Cancer Res 55: 4065-4068, 1995 9. Brossart P, Keilholz U, Scheibenbogen C, et al: Detection of residual tumor cells in patients with malignant melanoma responding to immunotherapy. J Immunother 15: 38-41, 1994[Medline]
10. Battayanni Z, Grob J, Xerri L: PCR detection of circulating melanocytes as a prognostic marker in patients with melanoma. Arch Dermatol 131: 443-447, 1995
11. Mellado B, Colomer D, Castel T, et al: Detection of circulating neoplastic cells by RT-PCR in malignant melanoma: Correlation with clinical stage and prognosis. J Clin Oncol 14: 2091-2097, 1996 12. Farthmann B, Ebverle J, Krasagakis K, et al: RT-PCR for tyrosinase-mRNA-positive cells in peripheral blood: Evaluation strategy and correlation with known prognostic markers in 123 melanoma patients. J Invest Dermatol 110: 263-267, 1998[CrossRef][Medline]
13. Kunter U, Buer J, Probst M, et al: Peripheral blood tyrosinase messenger RNA detection and survival in malignant melanoma. J Natl Cancer Inst 88: 590-594, 1996 14. Glaser R, Rass K, Seiter S, et al: W. Detection of circulating melanoma cells by specific amplification of tyrosinase complementary DNA is not a reliable tumor marker in melanoma patients. J Clin Oncol 15: 2818-2825, 1997[Abstract] 15. Jung FA, Buzaid AC, Ross MI, et al: Evaluation of tyrosinase mRNA as a tumor marker in the blood of melanoma patients. J Clin Oncol 15: 2826-2831, 1997[Abstract]
16. Ghossein RA, Coit D, Brennan M, et al: Prognostic significance of peripheral blood and bone marrow tyrosinase mRNA in malignant melanoma. Clin Cancer Res 4: 419-428, 1998
17. Mellado B, Gutierrez L, Castel T, et al: Prognostic significance of the detection of circulating malignant cells by RT-PCR in long-term clinically disease-free melanoma patients. Clin Cancer Res 5: 1843-1848, 1999 18. Proestble TM, Jiang W, Hogel J, et al: Correlation of RT-PCR for tyrosinase in peripheral blood of malignant melanoma patients with clinical stage, survival and other risk factors. Br J Cancer 82: 118-123, 2000[CrossRef][Medline] 19. Keilholz U, Willhauck M, Rimoldi D, et al: Reliability for RT-PCR based assay for the detection of circulating melanoma cells: A quality-assurance initiative of the EORTC Melanoma Cooperative Group. Eur J Cancer 34: 750-753, 1998[CrossRef][Medline]
20. Reinhold U, Berkin A, Bosserhoff K, et al: Interlaboratory evaluation of a new reverse transcriptase polymerase chain reaction-based enzyme-linked immunosorbent assay for the detection of circulating melanoma cells: A multicenter study of the Dermatologic Cooperative Oncology Group. J Clin Oncol 19: 1723-1727, 2001 21. De Vries UJ, Fourkour A, Punt CJA, et al: Reproducibility of the detection of tyrosinase and MART-1 transcripts in the peripheral blood of melanoma patients: A quality control study using real-time quantitative RT-PCR. Br J Cancer 80: 883-891, 1999[CrossRef][Medline] 22. Max N, Wolf K, Spike B, et al: Nested quantitative real time PCR for detection of occult tumor cells. Recent Results Cancer Res 158: 25-31, 2001[Medline] 23. Hoon DS, Wang Y, Dale PS, et al: Detection of occult melanoma cells in blood with a multiple-marker polymerase chain reaction assay. J Clin Oncol 13: 2109-2116, 2000
24. Hoon DS, Bostick P, Kuo C, et al: Molecular markers in blood as surrogate prognostic indicators of melanoma recurrence. Cancer Res 60: 2253-2257, 2000 25. Curry BJ, Myers K, Hersey P, et al: Polymerase chain reaction detection of melanoma cells in the circulation: Relation to clinical stage, surgical treatment and recurrence from melanoma. J Clin Oncol 16: 1760-1769, 1998[Abstract]
26. Curry BJ, Myers K, Hersey P: MART-1 is expressed less frequently on circulating melanoma cells in patients who develop distant compared with locoregional metastases. J Clin Oncol 17: 2562-2571, 1999 27. Brownbridge GG, Gold J, Edward M, et al: Evaluation of the use of tyrosinase-specific and melanA/MART-1 specific reverse transcriptase-coupled-polymerase chain reaction to detect melanoma cells in peripheral blood samples from 299 patients with malignant melanoma. Br J Dermatol 144: 279-287, 2001[CrossRef][Medline]
28. Palmieri G, Strazzullo M, Ascierto PA, et al: Polymerase chain reaction-based detection of circulating melanoma cells as an effective marker of tumor progression: Melanoma Cooperative Group. J Clin Oncol 17: 304-311, 1999 29. Boyum A: Separation of leukocytes from blood and bone marrow. Scand Clin Invest 21: 51-55, 1968 30. Chomczynski P, Sacchi N: Single-step method for RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156-159, 1987[Medline] Submitted July 31, 2001; accepted May 15, 2002.
This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|||||||||||
|
Copyright © 2002 by the American Society of Clinical Oncology, Online ISSN: 1527-7755. Print ISSN: 0732-183X
|