This Article Abstract Full Text (PDF) Purchase Article View Shopping Cart Alert me when this article is cited Alert me if a correction is posted Services Email this article to a colleague Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Save to my personal folders Download to citation manager Rights & Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Jansson, A. Articles by Sun, X.-F. Search for Related Content PubMed PubMed Citation Articles by Jansson, A. Articles by Sun, X.-F. Social Bookmarking                            What's this?

Bax Expression Decreases Significantly From Primary Tumor to Metastasis in Colorectal Cancer

From the Division of Oncology, Department of Biomedicine and Surgery, Faculty of Health Sciences, Linköping University, Linköping, Sweden.

Address reprint requests to Agneta Jansson, MSc, Division of Oncology, Department of Biomedicine and Surgery, Faculty of Health Sciences, Linköping University, S-581 85 Linköping, Sweden; email: agnja{at}ibk.liu.se

	ABSTRACT

TOP ABSTRACT INTRODUCTION PATIENTS AND METHODS RESULTS DISCUSSION REFERENCES

 
PURPOSE: Bax is a proapoptotic member of the bcl-2 family. Previous studies about Bax have shown that the expression increases from normal to tumor tissue, but the clinical significance is contradictory. Our aims were to analyze the expression of Bax from normal mucosa to primary tumor and to metastases in colorectal cancer patient. We further investigated whether low Bax expression in the primary tumor or changed expression from normal mucosa to primary tumor and to metastases had biologic and clinical significance.

PATIENTS AND METHODS: The study included 135 patients with primary colorectal adenocarcinoma, of whom 31 had metastases in the lymph nodes and 75 had normal mucosa. Immunohistochemistry, DNA sequencing, and microsatellite analysis were used to detect Bax expression, mutations, and microsatellite instability.

RESULTS: The protein was observed in 132 of 135 tumors, all normal epithelial cells and metastases. The frequencies of weak expression were greater from well/moderately to poorly differentiated and to mucinous carcinomas. Bax expression was stronger from normal to tumor tissue, but subsequently decreased in metastases. The matched cases with lower expression in the metastases than in the primary tumor showed a more infiltrative growth pattern and more distal metastases.

CONCLUSION: The association of Bax expression with tumor differentiation/histologic types and a decreased expression in the metastases, suggests that Bax expression may be involved in tumor differentiation/histologic types and metastatic progression. We also propose the novel notion that changed Bax expression in the metastases compared with the primary tumors might provide information to determine the clinicopathologic characteristics of the tumor.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION PATIENTS AND METHODS RESULTS DISCUSSION REFERENCES

 
THERE ARE TWO different pathways to apoptosis, the death receptor pathway and the mitochondrial pathway. The death receptor pathway is triggered by members of the death receptor superfamily, and the mitochondrial pathway is triggered as a response to cellular stress such as DNA damage.¹ The Bcl-2 family plays an important role in regulating the mitochondrial pathway for apoptosis. Some of the Bcl-2 family members are proapoptotic (Bax, Bad, Bid) and function as promotors of apoptosis, whereas others are antiapoptotic (bcl-2, bcl-xl, Mcl-1) and work as repressors.² The proportion of the pro- and antiapoptotic members and the competitive dimerization between agonists and antagonists determine the sensitivity of cells to death stimuli.³ The Bax gene creates a 21-kd protein product that exists in both the cytoplasm and the mitochondria in all tissues. As a response to an apoptotic signal, most of the soluble cytoplasmic Bax move to the mitochondria to form membrane-bound dimers. Loss of apoptosis can affect tumor progression and metastasis formation.⁴ The apoptotic activity of p53 and its interaction with Bax and bcl-2 are important in tumor suppression in this pathway to apoptosis.^1,5 However, Bax may have other cellular pathways to apoptosis independently of p53. For instance, Bax is also a direct transcriptional target of c-Myc and contributes to c-Myc– induced apoptosis.⁶ Here we analyzed relationships of Bax alterations with apoptotic rate, bcl-2 expression, p53 expression, and p53 mutations and aimed to observe the possible interactions of these factors in apoptosis.

Approximately 15% of the patients with unselected colorectal cancer exhibit genetic instability, characterized by microsatellite instability (MSI). Bax has been found to be inactivated in the presence of MSI through frameshift mutations at mononucleotide repeats inside the coding regions, which leads to a truncated protein and results in absence of Bax expression. There is no concordance in the use of microsatellites to determine MSI in previous studies, but several have shown that Bat-26 alone is able to detect 98% of the MSI tumors.^7,8 In the present study, we used Bat-26 to detect MSI and attempted to identify the relationship between MSI and Bax alterations.

Bax expression has been observed to increase from normal mucosa to primary tumor in colorectal cancer.^9,10 The results on the significance of Bax expression are contradictory. Some found that the absence of Bax was related to advanced stage and poor prognosis,^11,12 whereas others could not prove this relationship.¹³ However, they all investigated Bax expression in primary colorectal cancers in relation to clinicopathologic variables. Because the apoptotic function of Bax is important to counteract tumor growth, we hypothesized that changed Bax expression from normal tissue to primary tumors and metastases may provide additional information rather than only considering Bax expression in primary tumors. Thus we addressed the biologic and clinical significance of changed expression from normal mucosa to primary tumors and metastases related to patients’ sex, age, tumor location, Dukes’ stage, growth pattern, differentiation, and prognosis.

We used DNA sequencing to detect mutations in the poly G(8) region of Bax, immunohistochemistry to estimate Bax protein expression and microsatellite analysis to determine microsatellite status. The study included 135 patients with colorectal adenocarcinoma, of whom 31 had metastases available in the regional lymph nodes and 75 had normal tissue.

	PATIENTS AND METHODS

TOP ABSTRACT INTRODUCTION PATIENTS AND METHODS RESULTS DISCUSSION REFERENCES

 
Patients
Paraffin-embedded tissue blocks were collected from 135 patients who underwent surgical resection for primary colorectal adenocarcinoma diagnosed at Linköping University Hospital, Linköping, Sweden, between 1975 and 1986. Among them, there were 31 patients with metastases available in the regional lymph nodes and 75 with normal mucosa. No patient had received preoperative radiotherapy or chemotherapy for the cancer. The patients’ sex, age, tumor location, and Dukes’ stage were obtained from both surgical and pathologic records. The mean age was 71 years (range, 33 to 97 years). Two pathologists at our laboratory classified both growth pattern and histologic grade. The growth pattern is divided into expansive type and infiltrative type based on the patterns of growth and invasiveness. The growing margin of expansive type is sharply delineated, and the surrounding tissue is often a well-developed inflammatory lamina. The growing margin of infiltrative type is not recognizable, and the host response is often lacking. The latest date of follow-up was June 1999, and 75 patients had died from the cancer. p53¹⁴ and bcl-2 (unpublished data) expression determined by immunohistochemistry, p53 mutations¹⁵ identified by polymerase chain reaction (PCR)–single-stranded conformational polymorphism–DNA sequencing, and apoptotic cells¹⁶ detected by terminal deoxynucleotidyl transferase–mediated deoxygenin nick end-labeling assay were taken from previous studies carried out at our laboratory.

DNA Extraction
DNA was obtained from 30-µm thick formalin-fixed paraffin embedded tissue. The tissue was digested with proteinase K overnight at 58°C (Boehringer-Mannheim, Mannheim, Germany) and TEN-buffer (10 mmol/L of Tris x HCl [pH 8.0], 10 mmol/L EDTA, 0.1 mol/L of NaCl, and 2% sodium dodecyl sulfate). Furthermore, the DNA was extracted using phenol, phenol/chloroform (1:1), and finally chloroform, precipitated with ethanol, and redissolved in sterile water.

Microsatellite Analyses
Bat-26 was used as a marker to determine the MSI by PCR. The primers were forward, TGACTACTTTTGACTTCAGCC; and reverse, AACCATTCAACATTTTTAACCC. Amplification was performed for 40 cycles consisting of denaturation at 92°C for 45 seconds, annealing at 52°C for 30 seconds, and extension at 72°C for 45 seconds. The reaction was carried out in a volume of 20 µL, which contained 1 x Taq Polymerase Buffer Solution (20 mmol/L of (NH₄)₂SO₄, 75 mmol/L of TRIS-HCl pH 8.5, 0.1% Tween 20 [volume-to-volume ratio]), 2 mmol/L of MgCl₂, 0.2 mmol/L of dNTP, 0.5 µmol/L of each primer, 0.5 units of Taq polymerase (Promega/SDS, Madison, WI) and 20 ng of DNA. The sample was then labeled with phosphorus-33–dATP (Amersham, Little Shalfont, Buckinghamshire, United Kingdom) in a secondary PCR and finally separated in 6% polyacrylamide containing 6 mol/L of urea and visualized by autoradiography. MSI was determined by the mobility shift of the product.

Mutational Analyses
A DNA segment of 92 base pairs including the poly G(8) region in Bax was amplified by using primers forward, TTCATCCAGGATCGAGCAG; and reverse, CGCTCAGCTTCTTGGTGG. Amplification was performed as described in the microsatellite analysis, except the annealing temperature was 54°C. The amplified DNA was purified from the primers using Witzard PCR Preps DNA Purification System (Promega/SDS). Sequence analyses were performed using the Thermo sequenase radiolabeled terminator cycle sequencing kit, US79750 (Amersham) and DNA was labeled with phosphorus-33–ddNTP (Amersham). The samples were loaded on a denaturing 6% (volume-to-volume ratio) polyacrylamide gel containing 6 mol/L of urea run at 85W and visualized by autoradiography.

Immunohistochemistry
Immunohistochemical staining was performed on 5-µm sections from paraffin-embedded blocks. Deparaffinization and rehydration were performed using xylene and alcohol. After washing with distilled water, the sections were pretreated in 10 mmol/L of citrate buffer in a microwave oven for 20 minutes. The sections were then treated with 1% H₂O₂ for 20 minutes and protein block solution (Dako, Carpinteria, CA) for 10 minutes. To determine Bax protein expression, rat monoclonal antibody in 1:50 was used (no. 13401A, clone G206-1276, immunoglobulin [Ig] M, 0.5 mg/mL, PharMingen, San Diego, CA) for 90 minutes. Subsequently, the sections were incubated with 1:200 biotinylated antirat antibody (DAKO A/S, Copenhagen, Denmark) and 1:300 peroxidase-conjugated streptavidin (DAKO A/S). 3.3 diaminobenzidine tetrahydrochloride (Sigma, St Louis, MO) was used for the peroxidase reaction and hematoxylin for counterstaining. Sections known to stain positively were included in each run with buffer instead of antibody as the negative control.

The Bax expression was examined independently by the authors without knowledge of the clinicopathologic data. The samples were judged as negative, weak, or strong expression depending on the staining intensity. As the majority of the cases showed homogeneous staining—either negative, weak, or strong—the percentage of positive cells was not counted. In the matched cases, we further investigated whether there was changed staining intensity from normal mucosa to primary tumor and metastases. In the normal mucosa, the staining intensity was equally strong from the base to the top of the crypts.

Statistical Analysis
The ² method was used to test the association of MSI, Bax expression, and clinicopathologic factors. When the expected value was lower than five, Fisher’s test was used. When the cases were paired, McNemar’s test was used. The Mann-Whitney U test was used to test the association between Bax expression and apoptotic index. Cox’s proportional hazards model was used to estimate the influence of Bax on the prognosis. All P values that are cited are two-sided; P values less than 5% were judged as statistically significant.

	RESULTS

TOP ABSTRACT INTRODUCTION PATIENTS AND METHODS RESULTS DISCUSSION REFERENCES

 
Bax Expression
Bax immunostaining was observed in the cytoplasm in 132 of 135 primary tumors, 75 with normal mucosa and 31 with metastases in the regional lymph nodes. Although some cases also showed nuclear staining, it did not have any significance concerning clinical and pathologic characteristics. Therefore in the analyses we only considered cytoplasmic Bax expression as weak (including three negative primary tumors) or strong. As shown in Table 1, we investigated the frequencies of cases with weak or strong staining in the normal mucosa, primary tumors, and lymph node metastases. When all the cases were included, the frequency of strong Bax expression was greater from normal samples (36%) to primary tumors (59%), but then decreased in metastases (13%, P < .001). Further, when the data from matched cases in three groups (group A, matched normal samples and primary tumors; group B, matched primary tumors and metastases; and group C, matched normal, primary tumors, and metastases) were evaluated, the frequencies were also clearly greater from normal samples to primary tumors (group A, P = .002 and group C, P = .13) but markedly decreased from primary tumors to metastases (group B, P = .04 and group C, P = .003) (Fig 1A and 1B). In these matched cases, almost all the primary tumors (97%) had either the same or stronger Bax expression compared with the normal mucosa; only three cases expressed weaker staining. Furthermore, enhanced Bax expression in primary tumor was 62% in Dukes’ stage A, 48% in stage B, 48% in stage C, and 27% in stage D. All the metastases had either the same or weaker expression compared with their primary tumors, and none showed stronger staining. Seven metastases had even lower expression than the corresponding normal mucosa.

View larger version (94K): [in this window] [in a new window]   Fig 1. Immunohistochemical analysis of Bax protein in colorectal cancer. (A) The expression of Bax is weak in the normal mucosa but increases in the corresponding tumor, (B) and then decreases in the corresponding metastasis; (C) weak staining in mucinous sample.

	DISCUSSION

TOP ABSTRACT INTRODUCTION PATIENTS AND METHODS RESULTS DISCUSSION REFERENCES

 
Enhanced Bax expression from normal mucosa to primary tumor has been reported in rats with chemically induced colonic adenocarcinomas.¹⁷ A similar result on Bax expression was found in human normal mucosa and colorectal cancer.^9,10 However, there was no information about Bax expression in the progression from primary tumor to metastases. In the present study, we observed enhanced Bax expression from normal mucosa to tumor (36% of normal samples with strong staining and 59% of primary tumors), especially in the early stage (62% in Dukes’ stage A, 48% in stage B, 48% in stage C, and 27% in stage D). Interestingly, we further found that the frequencies of cases with stronger staining were dramatically decreased in metastases in the regional lymph nodes (13%) compared with those of primary tumors. Some cases had even lower expression in the metastases compared with the normal mucosa. Furthermore, in the matched cases, all the metastatic tumors exhibited either weaker or the same expression compared with the primary tumors, and none showed stronger staining. A previous study performed on primary tumors from women with metastatic breast cancer showed that 98% of carcinomas-in-situ showed Bax positive expression. However, 34% of the tumors whose cells infiltrated through the stroma had complete or nearly complete loss of Bax expression. These infiltrating cells probably represent the metastatic disease.¹⁸ Taking all of these findings together, we presume that during tumorigenesis from normal mucosa to primary tumors, especially in the early stage of colorectal cancer, the cells might try to repress the tumor development through upregulation of Bax. During this period, other members of the bcl-2 family may play a greater role against apoptosis than Bax; for example, bcl-X_l acts antiapoptotic partly independently of Bax expression.¹⁹ Enhanced Bax expression in primary tumor might also be merely a nonspecific response. As the tumor progresses further, Bax may be downregulated. Therefore, reduced Bax expression may be a late event, representing a mechanism that contributes to the development of a metastatic phenotype.

Similar to Sturm at al,¹² we also demonstrated that Bax expression in the primary tumor decreased from well/moderately differentiated (66%) to poorly differentiated tumors (45%), suggesting that Bax expression was involved in tumor differentiation. Moreover, we found that the mucinous/signet-ring cell carcinomas showed even lower frequency of Bax expression (31%). Mucinous carcinomas have been recognized as a histologic subtype with differences from nonmucinous tumors in clinicopathologic features, such as local recurrence and distal metastases, leading to poor survival. Mucinous colorectal carcinomas also differ from the nonmucinous in their genetic lesions and are associated with a higher frequency of MSI²⁰ and more frequent K-ras mutations,²¹ but wild-type p53²² and less apoptotic activity.²³ Decreased Bax expression in the mucinous carcinomas likely indicated that Bax was repressed. Consequently, the apoptotic process was inhibited, which may promote cell survival and further lead to more aggressive clinical features. In colorectal cancers, low Bax expression was correlated with more depth of tumor invasion, lymph vessel invasion, advanced stage, and worse prognosis.^11,12,24 However, in colon cancers, Bax expression was not related to Dukes’ stage, relapse, and prognosis.¹³ In the present study, we did not find an association between Bax expression in primary tumor with Dukes’ stage and prognosis, but we did observe that the cases with decreased Bax expression from primary tumors to the corresponding metastases showed a more infiltrative growth pattern, more distant metastases, and a weak trend toward poor prognosis. Furthermore, the seven cases with even lower Bax expression in the metastases than the corresponding normal mucosa had all infiltrating growth patterns. Therefore, we presumed that the changed Bax expression from normal/primary to metastatic tumors could be a mechanism that contributed to metastatic progression, perhaps by decreasing the tendency of the metastatic cells to undergo apoptosis. Indeed, we observed that weak Bax expression in primary tended toward a low apoptotic rate, although there was no information about the apoptotic rate in the lymph node metastases. Taken together, the results in regard to the clinicopathologic significance of Bax expression showed that low Bax expression in the primary tumors or decreased expression in the primary tumors compared with the metastases seems to be related to poorer differentiation, advanced stages, and worse prognosis.

In the present study, when low Bax and absent bcl-2 expression were combined, there was a strong correlation to advanced Dukes’ stage. This suggests that not only the level of Bax expression but also the ratio to bcl-2 expression may play an important role in the aggressiveness of colorectal cancer. bcl-2–negative tumors may be advanced in the tumor progression and be less dependent on bcl-2 for the survival. The reason for this may be of the reduced levels of Bax.¹⁸

We found five Bax frameshift mutations of 75 tumors, and four of them exhibited low Bax expression. This suggests that the mutations resulted in a decreased expression. Similar results were reported by Sturm et,¹² where all Bax mutated cases showed negative Bax expression. However, this does not explain why there were other tumors showing low Bax expression without Bax mutations. Because low Bax expression was strongly correlated with MSI tumors, independently of mutations in the Bax gene, this indicates that MSI is involved in the Bax expression through other mechanisms than mutations in the poly G(8) region. Recently, Mitchell et al⁶ found a positive link between c-myc overexpression and increased Bax mRNA expression, suggesting that Bax is required for c-Myc–induced apoptosis. Their findings may reveal an alternative way to induce apoptosis through an interaction of c-myc and Bax, which might to some extent explain our results where decreased Bax expression may be controlled by the c-myc expression.

In summary, because Bax expression was decreased from primary tumors to metastases, and from well/moderately to poorly differentiated tumors and to mucinous carcinoma, this might suggest that Bax expression is involved in tumor differentiation/histologic type and metastatic progression. We also analyzed the significance of changed Bax expression in the metastases compared with the corresponding primary tumor, observing that decreased expression in the metastases was correlated with infiltrative growth pattern and distance metastases. It may be of interest in future studies to confirm whether the changed expression from primary tumor to metastases provides valuable information for determining clinicopathologic characteristics of the tumors.

	ACKNOWLEDGMENTS

 
This work was supported by grants from the Swedish Cancer Society, Stockholm, and the Research Council of South East Sweden, Östergötland, Sweden.

	REFERENCES

TOP ABSTRACT INTRODUCTION PATIENTS AND METHODS RESULTS DISCUSSION REFERENCES

 
1. Hengartner MO: The biochemistry of apoptosis. Nature 407: 770-776, 2000[CrossRef][Medline]

2. Adams JM, Cory S: The Bcl-2 protein family: Arbiters of cell survival. Science 28: 1322-1326, 1998

3. Oltvai ZN, Milliman CL, Korsmeyer SJ: Bcl-2 heterodimerizes in vivo with a conserved homolog, Bax, that accelerates programmed cell death. Cell 74: 609-619, 1993[CrossRef][Medline]

4. Reed JC: Bcl-2 family proteins. Oncogene 17: 3225-3236, 1998[CrossRef][Medline]

5. Simms LA, Radford-Smith G, Biden KG, et al: Reciprocal relationship between the tumor suppressors p53 and BAX in primary colorectal cancers. Oncogene 17: 2003-2008, 1998[CrossRef][Medline]

6. Mitchell KO, Ricci MS, Miyashita T, et al: Bax is a transcriptional target and mediator of c-Myc-induced apoptosis. Cancer Res 60: 6318-6325, 2000[Abstract/Free Full Text]

7. Hoang JM, Cottu PH, Thuille B, et al: BAT-26, an indicator of the replication error phenotype in colorectal cancers and cell lines. Cancer Res 57: 300-303, 1997[Abstract/Free Full Text]

8. Iacopetta BJ, Soong R, House AK, et al: Gastric carcinomas with microsatellite instability: Clinical features and mutations to the TGF-beta type II receptor, IGFII receptor, and BAX genes. J Pathol 187: 428-432, 1999[CrossRef][Medline]

9. Maurer CA, Friess H, Buhler SS, et al: Apoptosis inhibiting factor Bcl-xL might be the crucial member of the Bcl-2 gene family in colorectal cancer. Dig Dis Sci 43: 2641-2648, 1998[CrossRef][Medline]

10. Krajewska M, Moss SF, Krajewski S, et al: Elevated expression of Bcl-X and reduced Bak in primary colorectal adenocarcinomas. Cancer Res 56: 2422-2427, 1996[Abstract/Free Full Text]

11. Ogura E, Senzaki H, Yamamoto D, et al: Prognostic significance of Bcl-2, Bcl-xL/S, Bax and Bak expressions in colorectal carcinomas. Oncol Rep 6: 365-369, 1999[Medline]

12. Sturm I, Kohne CH, Wolff G, et al: Analysis of the p53/BAX pathway in colorectal cancer: Low BAX is a negative prognostic factor in patients with resected liver metastases. J Clin Oncol 17: 1364-1374, 1999[Abstract/Free Full Text]

13. Bukholm IK, Nesland JM: Protein expression of p53, p21 (WAF1/CIP1), bcl-2, Bax, cyclin D1 and pRb in human colon carcinomas. Virchows Arch 436: 224-228, 2000[CrossRef][Medline]

14. Sun XF, Carstensen JM, Zhang H, et al: Prognostic significance of cytoplasmic p53 oncoprotein in colorectal adenocarcinoma. Lancet 340: 1369-1373, 1992[CrossRef][Medline]

15. Jansson A, Gentile M, Sun X-F: p53 mutations are present in colorectal cancer with cytoplasmic p53 accumulation. Int J Cancer 92: 338-341, 2001[CrossRef][Medline]

16. Evertsson S, Bartik Z, Zhang H, et al: Apoptosis in relation to proliferating cell nuclear antigen and Dukes’ stage in colorectal adenocarcinoma. Int J Oncol 15: 53-58, 1999[Medline]

17. Hirose Y, Yoshimi N, Suzui M, et al: Expression of bcl-2, bax, and bcl-XL proteins in azoxymethane-induced rat colonic adenocarcinomas. Mol Carcinog 19: 25-30, 1997[CrossRef][Medline]

18. Krajewski S, Blomqvist C, Franssila K, et al: Reduced expression of proapoptotic gene BAX is associated with poor response rates to combination chemotherapy and shorter survival in women with metastatic breast adenocarcinoma. Cancer Res 55: 4471-4478, 1995[Abstract/Free Full Text]

19. Cheng EH, Levine B, Boise LH, et al: Bax-independent inhibition of apoptosis by Bcl-XL. Nature 379: 554-556, 1996[CrossRef][Medline]

20. Kim H, Jen J, Vogelstein B, et al: Clinical and pathological characteristics of sporadic colorectal carcinomas with DNA replication errors in microsatellite sequences. Am J Pathol 145: 148-156, 1994[Abstract]

21. Laurent-Puig P, Olschwang S, Delattre O, et al: Association of Ki-ras mutation with differentiation and tumor-formation pathways in colorectal carcinoma. Int J Cancer 49: 220-223, 1991[Medline]

22. Hanski C, Tiecke F, Hummel M, et al: Low frequency of p53 gene mutation and protein expression in mucinous colorectal carcinomas. Cancer Lett 103: 163-170, 1996[CrossRef][Medline]

23. Zhang H, Evertsson S, Sun X: Clinicopathological and genetic characteristics of mucinous carcinomas in the colorectum. Int J Oncol 14: 1057-1061, 1999[Medline]

24. Kanavaros P, Stefanaki K, Valassiadou K, et al: Expression of p53, p21/waf, bcl-2, Rb and Ki67 proteins in colorectal adenocarcinomas. Med. Oncol 16: 23-30, 1999

Submitted November 16, 2000; accepted September 14, 2001.

CiteULike    Complore    Connotea    Del.icio.us    Digg    Facebook    Reddit    Technorati    Twitter    What's this?

This article has been cited by other articles:

				W. S. El-Deiry, C. C. Sigman, and G. J. Kelloff Imaging and Oncologic Drug Development J. Clin. Oncol., July 10, 2006; 24(20): 3261 - 3273. [Abstract] [Full Text] [PDF]

				K. Fransen, M. Klintenas, A. Osterstrom, J. Dimberg, H.-J. Monstein, and P. Soderkvist Mutation analysis of the BRAF, ARAF and RAF-1 genes in human colorectal adenocarcinomas Carcinogenesis, April 1, 2004; 25(4): 527 - 533. [Abstract] [Full Text] [PDF]

				D. Fallik, F. Borrini, V. Boige, J. Viguier, S. Jacob, C. Miquel, J.-C. Sabourin, M. Ducreux, and F. Praz Microsatellite Instability Is a Predictive Factor of the Tumor Response to Irinotecan in Patients with Advanced Colorectal Cancer Cancer Res., September 15, 2003; 63(18): 5738 - 5744. [Abstract] [Full Text] [PDF]

				P. G. Johnston, A. B. Benson III, P. Catalano, M. S. Rao, P. J. O'Dwyer, and C. J. Allegra Thymidylate Synthase Protein Expression in Primary Colorectal Cancer: Lack of Correlation With Outcome and Response to Fluorouracil in Metastatic Disease Sites J. Clin. Oncol., March 1, 2003; 21(5): 815 - 819. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Purchase Article View Shopping Cart Alert me when this article is cited Alert me if a correction is posted Services Email this article to a colleague Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Save to my personal folders Download to citation manager Rights & Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Jansson, A. Articles by Sun, X.-F. Search for Related Content PubMed PubMed Citation Articles by Jansson, A. Articles by Sun, X.-F. Social Bookmarking                            What's this?