This Article Abstract Full Text (PDF) Purchase Article View Shopping Cart Alert me when this article is cited Alert me if a correction is posted Services Email this article to a colleague Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Save to my personal folders Download to citation manager Rights & Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Duggan, C. Articles by Cuzick, J. Search for Related Content PubMed PubMed Citation Articles by Duggan, C. Articles by Cuzick, J. Social Bookmarking                            What's this?

Inherited and Acquired Risk Factors for Venous Thromboembolic Disease Among Women Taking Tamoxifen to Prevent Breast Cancer

Catherine Duggan, Kevin Marriott, Rob Edwards, Jack Cuzick

From the Department of Epidemiology, Mathematics and Statistics, Wolfson Institute of Preventive Medicine, Charterhouse Square; and the Haematology Department, St Mary’s National Health Service Trust, London, United Kingdom.

Address reprint requests to Jack Cuzick, PhD, Department of Epidemiology, Mathematics and Statistics, Wolfson Institute of Preventive Medicine, Charterhouse Square, London EC1M 6BQ, United Kingdom; e-mail: jack.cuzick{at}cancer.org.uk.

	ABSTRACT

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION AUTHORS’ DISCLOSURES OF... REFERENCES

 
Purpose: Venous thromboembolism (VTE) is of particular concern in women receiving tamoxifen in a chemopreventive setting. We investigate the association between acquired and inherited risk factors for VTE in the International Breast Cancer Intervention Study (IBIS-I) trial of tamoxifen prophylaxis for women at increased risk of breast cancer.

Methods: We used a nested case-control study design to investigate the role of tamoxifen and acquired risk factors in the risk of developing a VTE.

Results: Tamoxifen was associated with a significantly increased risk of developing a major VTE (odds ratio [OR], 2.1; 95% CI, 1.1 to 4.1). Women who had surgery, immobilization, or fracture in the previous month had a greatly increased risk of developing a major VTE (OR, 4.7; 95% CI, 2.2 to 10.1). Prothrombin and factor V Leiden mutations were found exclusively among control women: factor V Leiden in eight of 159 control women (5.0%) and the prothrombin mutation in three control women (1.9%). Thirty-five women with a VTE and a blood sample were negative for these mutations. The upper one-sided 97.5% CI for the OR of having either mutation was 1.87. Being overweight, smoking, or taking hormone replacement therapy was not associated with VTE in this study, but the CIs were wide.

Conclusion: Tamoxifen and prior surgery, fracture, or immobilization were associated with a significantly increased risk of developing a VTE. Factor V Leiden and prothrombin mutations were not associated with thrombosis in this population.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION AUTHORS’ DISCLOSURES OF... REFERENCES

 
THE RISK of developing a venous thromboembolism (VTE) is related to a number of acquired and inherited risk factors. These include use of exogenous estrogens or estrogen agonists (eg, hormone replacement therapy, oral contraceptives, tamoxifen),¹ pregnancy,² obesity, and inherited mutations in genes predisposing to these events, such as the factor V Leiden and prothrombin G20210A mutation.

The International Breast Cancer Intervention Study (IBIS-I) is a randomized, double-blind, placebo-controlled, 5-year study of the effects of tamoxifen (20 mg daily for 5 years) in a population of women with an elevated risk of developing breast cancer.³ Here, we investigate whether the excess risk of developing a VTE associated with tamoxifen in women enrolled in IBIS-I can be predicted by either acquired or inherited risk factors (factor V Leiden or prothrombin G20210A mutations).

Tamoxifen, a selective estrogen receptor modulator, is widely used in the treatment of breast cancer, and has been shown to significantly reduce the incidence of breast cancer in healthy women at high risk of developing breast cancer.^3–5 However, tamoxifen, which has estrogen agonist properties, is associated with an increased risk of developing a VTE.^3,4

Studies have consistently demonstrated an increased risk of 2.0 to 3.6 for VTE among postmenopausal current users of hormone replacement therapy compared with nonusers.^6–8 More recent, larger studies confirmed these findings, where current users of hormone replacement therapy had an approximately two-fold higher risk of developing a VTE compared with nonusers.^9,10 The Women’s Health Initiative study investigated the influence of estrogen and progestin in postmenopausal women on a number of outcome measures including pulmonary embolism, and reported an increase in pulmonary embolisms (hazard ratio [HR], 2.13; 95% CI, 1.39 to 3.25) among postmenopausal women taking estrogen or progestins.¹¹

Additional risk factors for VTE include recent surgical procedures, especially hip replacement surgery and major surgery involving the abdomen, pelvis, and lower extremities; prolonged immobility; stroke; and trauma (especially fractures of the pelvis, hip, or leg).^12,13 Finally, smoking and obesity also seem to be associated with increased risk of developing a VTE,^14–17 although it seems that these risk factors may be of lesser importance than the factor V Leiden mutation or estrogen use.¹⁵

The most common inherited risk factor for VTE is a G1691A mutation in the factor V gene, resulting in the substitution of Arg506Gln, and hence the loss of one of three activated protein C (APC) cleavage sites in factor V.^18–21 This leads to the phenomenon of resistance to the anticoagulant activity of APC, and is associated with a significantly increased risk of thrombosis: approximately seven-fold for heterozygous individuals and 80-fold for homozygous individuals.^20–22 This mutation is found predominantly in white populations, in which the prevalence is about 5%.²³

Several studies have demonstrated a significant increase in risk of thrombosis in patients carrying the factor V Leiden mutation who also take estrogen-based oral contraceptives^24–26 Two recent studies demonstrated similar results for the factor V Leiden mutation and hormone replacement therapy use. A 15-fold increase in risk of developing a VTE was observed among women who both took hormone replacement therapy and who were carriers of the factor V Leiden mutation, whereas the mutation alone was associated with a three- to four-fold increase in risk.^27,28

The second most common genetic risk factor for thrombosis is a single mutation (G20210A) in the 3' untranslated region of the prothrombin gene.²⁹ Prothrombin is the precursor of the serine protease thrombin, a key enzyme in hemostasis and thrombosis. The G20210A mutation does not affect prothrombin function but is associated with an increased concentration of prothrombin in plasma.²⁹

The overall prevalence estimate for the prothrombin G20210A variant in white populations is estimated at 2%.^30,31 However, there seems to be a high degree of heterogeneity: in southern Europe, the prevalence was 3%, nearly twice as high as the prevalence in northern Europe (1.7%). The prothrombin variant appears rarely in individuals of Asian and African descent.³¹ The mutation is found in 5% to 16% of patients who have had a venous thrombosis^29,32,33 and in 18% of patients with familial thrombophilia.²⁹ Increased risk of venous thrombosis associated with the prothrombin G20210A gene mutation varies between three- and nine-fold,^32,34 and also is associated with increased risk of deep vein thrombosis (DVT) in women taking oral contraceptives.³⁵

	METHODS

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION AUTHORS’ DISCLOSURES OF... REFERENCES

 
Patients
A total of 96 women with a VTE were identified from the IBIS-I trial (Table 1). Additional details of the patient cohort are given in the main IBIS-I article.³ Venous thromboembolic events were defined in order of severity as pulmonary embolus, DVT, retinal thrombosis, or superficial thrombophlebitis. Women who experienced more than one event were categorized by the most severe event. We also collected data on cerebrovascular events (defined as transient ischemic attack, stroke, cerebral aneurysm, or subarachnoid hemorrhage), and myocardial infarctions.

To investigate the influence of these acquired risk factors on risk of developing a VTE, we selected two control women for each patient. These control women were matched only on age. A second set of control women was selected to investigate the role of factor V Leiden or prothrombin G20210A mutations on VTEs in the IBIS-I cohort. Again, two control women were selected for each patient, but the control women were matched on age, body mass index, smoking history, and hormone replacement therapy use, and were restricted to women who had a blood sample available for DNA extraction. Testing for factor V Leiden and prothrombin G20210A mutations was fully anonymous. All participants gave their written informed consent for anonymous testing for genetic risk factors, and were part of a protocol approved by the Research Ethics Committee.

Thirty-three patients with cerebrovascular events and 10 patients who had developed myocardial infarctions were also identified. Two matched control women for each of these patients were selected using the same criteria as for VTEs.

DNA Extraction and Polymerase Chain Reaction (PCR)
A blood sample was available for 35 of 96 patients who had experienced a VTE, and 159 of 192 control women had a blood sample available. Of 33 patients with a cerebrovascular event, 21 had a blood sample available; 49 of the selected control women had a blood sample available. There was no selection bias: Control women were selected before the availability of a blood sample was determined. Control women were analyzed (when a blood sample was available) for the presence of the factor V Leiden and prothrombin G20210A mutation even when a blood sample was unavailable for the corresponding patient. All blood samples had been taken during the first visit and stored at -70°C until analyzed. DNA was extracted from whole blood using standard procedures.

Factor V Leiden Mutation Detection
The factor V Leiden mutation is a single GA transition at position 1,691 in the factor V gene, which destroys an MnlI restriction enzyme cleavage site. This can be detected by PCR amplification (92°C for 30 seconds, 54°C for 60 seconds, 72°C for 45 seconds for 30 cycles) of a 267-bp fragment spanning the mutation site (primer 1, 5'-TGCCCAGTGCTTAACAAGACCA-3'; primer 2, 5'-TGTTATCACACTGGTGCTAA-3'; Amersham Pharmacia Biotech UK Ltd, Buckinghamshire, UK), followed by digestion and restriction fragment length polymorphism analysis with MnlI. This yields three fragments of 37, 67, and 163 bp in the wild-type factor V; two fragments of 67 and 200 bp from an individual homozygous for the mutation and all four fragments (37, 67, 163, and 200 bp) from a heterozygote. The fragments are separated by 2% agarose gel electrophoresis, stained using ethidium bromide, and visualized using ultraviolet light.

Prothrombin G20210A Mutation Detection
The G20210A mutation does not disrupt a natural recognition site for any restriction enzyme. Primers were therefore designed to introduce a HindIII cleavage site only if the mutant allele was present. This involves insertion of a single base into the wild-type sequence at the 3' end of the primer, so that the recognition site overlaps the primer 3' end and new strand 5' end: primer 1, 5'-TCTAGAAACAGTTGCCTGGC-3'; primer 2, 5'ATAGCACTGGGAGCATTGAA*GC-3'. The nucleotide with the asterisk in mutagenic primer 2 is not present in the normal sequence, and introduces a HindIII site in the amplified fragment if the G20210A mutation also is present.

Amplification by PCR (92°C for 30 seconds, 62°C for 60 seconds, 72°C for 45 seconds for 30 cycles) followed by subsequent digestion with HindIII yields one fragment of 345 bp in the wild-type sequence, two fragments of 322 and 23 bp, respectively in a homozygous individual, and three fragments of 345, 322, and 23 bp, respectively, in a heterozygous individual. Although the 23-bp fragment is too small to be seen on the gel, the larger two fragments can be separated on a 1.6% agarose gel and visualized as described.

Statistical Analyses
Conditional logistic regression for matched case-control groups was used to investigate the influence of randomized treatment, body mass index, hormone replacement therapy use, smoking status, prior surgery (within 3 months before developing a VTE), immobilization, and fracture of lower extremities on the risk of developing a VTE. All CIs are at the 95% level and two-sided P values are used.

End points were defined as major venous thromboembolic events (pulmonary emboli, DVT, and retinal thrombi) and all venous thromboembolic events that included all of the above plus superficial thrombophlebitis. Similar analyses were carried out to investigate the influence of randomized treatment, body mass index, hormone replacement therapy use, and smoking status on risk of developing cerebrovascular events or myocardial infarctions.

	RESULTS

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION AUTHORS’ DISCLOSURES OF... REFERENCES

 
Table 1 lists the number and type of VTEs that occurred in the IBIS-I study, and the treatment that these patients received. In total, 96 VTEs were observed, including 57 major events (32 DVT, 23 pulmonary emboli, two retinal thrombi), and 39 superficial thrombophlebitises (Table 1). Table 2 lists the acquired risk factors for the women who experienced a VTE. Six women reported as having other VTEs and categorized as major events in our original report³ were further evaluated and recategorized as DVT (three women, all controls) or superficial thromboemboli (three patients, all tamoxifen).

Similarly, 40 women (70.2%) who experienced a major venous thromboembolic event had been randomly assigned to receive tamoxifen compared with 17 women (29.8%) in the placebo arm (OR, 2.1; 95% CI, 1.1 to 4.1; Table 3). Thus, the risk of developing a major thromboembolic event for women taking tamoxifen is approximately two-fold greater than that for women taking placebo.

Detection and Prevalence of the Factor V Leiden and Prothrombin G20210A Mutations Among Women With VTE and Age-Matched Controls
The factor V Leiden mutation was detected in eight of 159 control women analyzed (5.0%). The prothrombin G20210A mutation was detected in three of 159 control women (1.9%). No mutations were found among the 35 women with a VTE who had a blood sample available (Table 4), suggesting that for women taking tamoxifen, factor V Leiden and prothrombin G20210A mutations cannot usefully predict those at increased risk of developing a VTE. No homozygotes were detected for either the factor V Leiden or the prothrombin G20210A mutation.

Other Acquired Risk Factors for Thromboembolic Events
Hormone replacement therapy use (past or never use v current use), smoking status (current v never or past), and body mass index (analyzed either as a continuous variable, or categorized as or > 25 kg/m²) were not significantly associated with increased risk of developing a VTE, although the 95% CIs were sufficiently wide that risks on the order of two-fold could not be ruled out.

Multiple logistic regression produced risks similar to those seen in the univariate analysis (Table 3). There was some evidence that the effect of prior surgery, immobilization, or fracture and tamoxifen was more than multiplicative (positive interaction), although the test for interaction was not significant for these two covariates (P = .18 and P = .41 for major and all events, respectively). It is not possible to determine if this positive interaction is real because of the small number of patients with these characteristics. Nevertheless, women with both factors had an odds ratio of 12.9 (95% CI, 3.5 to 47.6) for a major event compared with those with neither factor, and half of the major events in the tamoxifen arm occurred in women with recent surgery or fractures.

Cerebrovascular Events and Myocardial Infarctions
In total, 33 cerebrovascular events were observed in IBIS-I, including 24 cerebrovascular accidents or strokes and nine transient ischemic attacks. Seventeen of these occurred in the placebo arm and 16 occurred in the tamoxifen arm. None of the women who had a cerebrovascular event carried either the factor V Leiden or the prothrombin G20210A mutation.

Similarly, none of the 10 women who developed a myocardial infarction (five in the tamoxifen arm and five in the placebo arm) were carriers of these mutations. Neither tamoxifen, body mass index (analyzed as a continuous or a categorical variable), use of hormone replacement therapy, nor smoking status were associated with the incidence of either cerebrovascular events or myocardial infarctions in the IBIS-I cohort.

	DISCUSSION

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION AUTHORS’ DISCLOSURES OF... REFERENCES

 
The ability of tamoxifen to reduce the incidence of estrogen receptor–positive breast cancer by about 50% has been demonstrated in prevention trials.⁴ However, the use of tamoxifen as a preventive agent may be limited by the increased risk of side effects. Of these, vascular events seem to be the most important. Recent surgery, immobilization, or fracture was strongly associated with increased risk for venous thromboembolic events, and appropriate antithrombotic measures should be used in these circumstances for women receiving tamoxifen. Where possible, tamoxifen should be discontinued 1 month before major surgery and administration should not resume until mobility has been achieved.

The risk of developing a VTE associated with tamoxifen reported in this article differs somewhat from that in the main report. This partly is due to the case-control approach used here, but more importantly, the reclassification of six other events into three major events and three superficial events. This has led to a decrease in the OR for major events for tamoxifen from 2.5 to 2.1. This is probably a more accurate estimate and accords well with estimates reported in other studies.⁴

The mechanism for the effect of estrogen and selective estrogen receptor modulators on the increased rate of VTE is unknown. Various studies of the coagulation system have documented changes in the activation of coagulation and fibrinolytic systems in women exposed to exogenous estrogens and to tamoxifen. However, these changes have been small and are unlikely to account for the increased risk of developing a VTE.^36–39 It has been suggested that low-dose oral contraception and hormone replacement therapy may cause acquired resistance to APC and thus contribute to the risk of developing a VTE.^39–41 A recently published study examined the effect of tamoxifen on levels of APC, antithrombin, protein C antigen, and total protein S. Among tamoxifen-treated women, antithrombin and protein S but not protein C or APC ratio were reduced, and it was postulated that these reductions may relate to the increased risk of venous thrombosis associated with tamoxifen treatment.⁴²

Many studies have demonstrated the role of inherited resistance to APC via the factor V Leiden mutation in the etiology of VTEs. Similarly, the prothrombin G20210A mutation is also associated with an increased risk of developing a VTE. Therefore, it is surprising that none of the women in the IBIS-I study with a VTE were heterozygous or homozygous for either the prothrombin G20210A or factor V Leiden mutations. It would seem that activity-related risk factors leading to immobility might be so dominant that inherited risk factors provide only a minor contribution to risk.⁴³

Aromatase inhibitors such as anastrozole have a much lower risk of VTEs than does tamoxifen,⁴⁴ and these offer an attractive option both for treatment and prevention of breast cancer. They are currently being evaluated in ongoing chemoprevention trials.

In conclusion, the increased risk of developing a VTE may limit the use of tamoxifen in a preventive setting, especially for women with risk factors for this condition. Screening for inherited risk factors does not seem to be useful in identifying women at high risk of developing VTEs. Attention should be focused on the use of appropriate antithrombotic measures, especially after major surgery or during periods of immobility.

	AUTHORS’ DISCLOSURES OF POTENTIAL CONFLICTS OF INTEREST

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION AUTHORS’ DISCLOSURES OF... REFERENCES

 
The following authors or their immediate family members have indicated a financial interest. No conflict exists for drugs or devices used in a study if they are not being evaluated as part of the investigation. Acted as a consultant within the last 2 years: Jack Cuzick, AstraZeneca. Received more than $2,000 a year from a company for either of the last 2 years: Jack Cuzick, AstraZeneca.

	NOTES

 
Supported by Cancer Research United Kingdom.

	REFERENCES

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION AUTHORS’ DISCLOSURES OF... REFERENCES

 
1. Grady D, Wenger NK, Herrington D, et al: Postmenopausal hormone therapy increases risk for venous thromboembolic disease: The Heart and Estrogen/Progestin Replacement Study. Ann Intern Med 132:689–696, 2000[Abstract/Free Full Text]

2. Eldor A: Thrombophilia, thrombosis and pregnancy. Thromb Haemost 86:104–111, 2001[Medline]

3. IBIS Working Party and Principal Investigators: First results from the IBIS Breast Cancer Prevention Trial. Lancet 360:817–824, 2002[CrossRef][Medline]

4. Cuzick J, Powles T, Veronesi U, et al: Overview of the main outcomes in breast-cancer prevention trials. Lancet 361:296–300, 2003[CrossRef][Medline]

5. Fisher B, Costantino JP, Wickerham DL, et al: Tamoxifen for prevention of breast cancer: Report of the National Surgical Adjuvant Breast and Bowel Project P-1 Study. J Natl Cancer Inst 90:1371–1388, 1998[Abstract/Free Full Text]

6. Daly E, Vessey MP, Hawkins MM, et al: Risk of venous thromboembolism in users of hormone replacement therapy. Lancet 348:977–980, 1996[CrossRef][Medline]

7. Grodstein F, Stampfer MJ, Goldhaber SZ, et al: Prospective study of exogenous hormones and risk of pulmonary embolism in women. Lancet 348:983–987, 1996[CrossRef][Medline]

8. Jick H, Derby LE, Myers MW, et al: Risk of hospital admission for idiopathic venous thromboembolism among users of postmenopausal oestrogens. Lancet 348:981–983, 1996[CrossRef][Medline]

9. Perez Gutthann S, Garcia Rodriguez LA, Castellsague J, et al: Hormone replacement therapy and risk of venous thromboembolism: Population based case-control study. BMJ 314:796–800, 1997[Abstract/Free Full Text]

10. Varas-Lorenzo C, Garcia-Rodriguez LA, Cattaruzzi C, et al: Hormone replacement therapy and the risk of hospitalization for venous thromboembolism: A population-based study in southern Europe. Am J Epidemiol 147:387–390, 1998[Abstract/Free Full Text]

11. Rossouw JE, Anderson GL, Prentice RL, et al: Risks and benefits of estrogen plus progestin in healthy postmenopausal women: Principal results from the Women’s Health Initiative randomized controlled trial. JAMA 288:321–333, 2002[Abstract/Free Full Text]

12. Edelsberg J, Ollendorf D, Oster G: Venous thromboembolism following major orthopedic surgery: Review of epidemiology and economics. Am J Health Syst Pharm 58:S4–S13, 2001 (suppl 2)[Abstract/Free Full Text]

13. Geerts WH, Heit JA, Clagett GP, et al: Prevention of venous thromboembolism. Chest 119:132S–175S, 2001 (suppl 1)[Free Full Text]

14. de Moerloose P, Wutschert R, Heinzmann M, et al: Superficial vein thrombosis of lower limbs: Influence of factor V Leiden, factor II G20210A and overweight. Thromb Haemost 80:239–241, 1998[Medline]

15. Lowe GD, Haverkate F, Thompson SG, et al: Prediction of deep vein thrombosis after elective hip replacement surgery by preoperative clinical and haemostatic variables: The ECAT DVT Study—European Concerted Action on Thrombosis. Thromb Haemost 81:879–886, 1999[Medline]

16. Meier CR, Jick H: Tamoxifen and risk of idiopathic venous thromboembolism. Br J Clin Pharmacol 45:608–612, 1998[CrossRef][Medline]

17. Heit JA, Silverstein MD, Mohr DN, et al: The epidemiology of venous thromboembolism in the community. Thromb Haemost 86:452–463, 2001[Medline]

18. Bertina RM, Koeleman BP, Koster T, et al: Mutation in blood coagulation factor V associated with resistance to activated protein C. Nature 369:64–67, 1994[CrossRef][Medline]

19. Voorberg J, Roelse J, Koopman R, et al: Association of idiopathic venous thromboembolism with single point-mutation at Arg506 of factor V. Lancet 343:1535–1536, 1994[CrossRef][Medline]

20. Rosendaal FR, Koster T, Vandenbroucke JP, et al: High risk of thrombosis in patients homozygous for factor V Leiden. Blood 85:1504–1508, 1995[Abstract/Free Full Text]

21. Simioni P, Prandoni P, Lensing AW, et al: The risk of recurrent venous thromboembolism in patients with an Arg506->Gln mutation in the gene for factor V (factor V Leiden). N Engl J Med 336:399–403, 1997[Abstract/Free Full Text]

22. Koster T, Rosendaal FR, de Ronde H, et al: Venous thrombosis due to poor anticoagulant response to activated protein C: Leiden Thrombophilia Study. Lancet 342:1503–1506, 1993[CrossRef][Medline]

23. Ridker PM, Miletich JP, Hennekens CH, et al: Ethnic distribution of factor V Leiden in 4047 men and women: Implications for venous thromboembolism screening. JAMA 277:1305–1307, 1997[Abstract/Free Full Text]

24. Vandenbroucke JP, Koster T, Briet E, et al: Increased risk of venous thrombosis in oral-contraceptive users who are carriers of factor V Leiden mutation. Lancet 344:1453–1457, 1994[CrossRef][Medline]

25. Bloemenkamp KW, Rosendaal FR, Helmerhorst FM, et al: Enhancement by factor V Leiden mutation of risk of deep-vein thrombosis associated with oral contraceptives containing a third-generation progestagen. Lancet 346:1593–1596, 1995[CrossRef][Medline]

26. Rintelen C, Mannhalter C, Ireland H, et al: Oral contraceptives enhance the risk of clinical manifestation of venous thrombosis at a young age in females homozygous for factor V Leiden. Br J Haematol 93:487–490, 1996[CrossRef][Medline]

27. Herrington DM, Vittinghoff E, Howard TD, et al: Factor V Leiden, hormone replacement therapy, and risk of venous thromboembolic events in women with coronary disease. Arterioscler Thromb Vasc Biol 22:1012–1017, 2002[Abstract/Free Full Text]

28. Rosendaal FR, Vessey M, Rumley A, et al: Hormonal replacement therapy, prothrombotic mutations and the risk of venous thrombosis. Br J Haematol 116:851–854, 2002[CrossRef][Medline]

29. Poort SR, Rosendaal FR, Reitsma PH, et al: A common genetic variation in the 3'-untranslated region of the prothrombin gene is associated with elevated plasma prothrombin levels and an increase in venous thrombosis. Blood 88:3698–3703, 1996[Abstract/Free Full Text]

30. Zivelin A, Rosenberg N, Faier S, et al: A single genetic origin for the common prothrombotic G20210A polymorphism in the prothrombin gene. Blood 92:1119–1124, 1998[Abstract/Free Full Text]

31. Rosendaal FR, Doggen CJ, Zivelin A, et al: Geographic distribution of the 20210 G to A prothrombin variant. Thromb Haemost 79:706–708, 1998[Medline]

32. Hillarp A, Zoller B, Svensson PJ, et al: The 20210 A allele of the prothrombin gene is a common risk factor among Swedish outpatients with verified deep venous thrombosis. Thromb Haemost 78:990–992, 1997[Medline]

33. Cattaneo M, Chantarangkul V, Taioli E, et al: The G20210A mutation of the prothrombin gene in patients with previous first episodes of deep-vein thrombosis: Prevalence and association with factor V G1691A, methylenetetrahydrofolate reductase C677T and plasma prothrombin levels. Thromb Res 93:1–8, 1999[CrossRef][Medline]

34. Leroyer C, Mercier B, Oger E, et al: Prevalence of 20210 A allele of the prothrombin gene in venous thromboembolism patients. Thromb Haemost 80:49–51, 1998[Medline]

35. Martinelli I, Taioli E, Bucciarelli P, et al: Interaction between the G20210A mutation of the prothrombin gene and oral contraceptive use in deep vein thrombosis. Arterioscler Thromb Vasc Biol 19:700–703, 1999[Abstract/Free Full Text]

36. Mannucci PM, Bettega D, Chantarangkul V, et al: Effect of tamoxifen on measurements of hemostasis in healthy women. Arch Intern Med 156:1806–1810, 1996[Abstract/Free Full Text]

37. Helmerhorst FM, Bloemenkamp KW, Rosendaal FR, et al: Oral contraceptives and thrombotic disease: Risk of venous thromboembolism. Thromb Haemost 78:327–333, 1997[Medline]

38. Oberhoff C, Szymeczek J, Hoffmann O, et al: Adjuvant antiestrogen treatment with tamoxifen in postmenopausal women with breast cancer: A longitudinal study of blood coagulation and fibrinolysis. Breast Cancer Res Treat 50:73–81, 1998[CrossRef][Medline]

39. Rosing J, Hemker HC, Tans G: Molecular biology and pathophysiology of APC resistance: Current insights and clinical implications. Semin Thromb Hemost 24:329–335, 1998[Medline]

40. Rosing J, Middeldorp S, Curvers J, et al: Low-dose oral contraceptives and acquired resistance to activated protein C: A randomised cross-over study. Lancet 354:2036–2040, 1999[CrossRef][Medline]

41. Hoibraaten E, Mowinckel MC, de Ronde H, et al: Hormone replacement therapy and acquired resistance to activated protein C: Results of a randomized, double-blind, placebo-controlled trial. Br J Haematol 115:415–420, 2001[CrossRef][Medline]

42. Cushman M, Costantino JP, Bovill EG, et al: Effect of tamoxifen on venous thrombosis risk factors in women without cancer: The Breast Cancer Prevention Trial. Br J Haematol 120:109–116, 2003[CrossRef][Medline]

43. Lane DA, Grant PJ: Role of hemostatic gene polymorphisms in venous and arterial thrombotic disease. Blood 95:1517–1532, 2000[Free Full Text]

44. ATAC Trialists Group: Anastrozole alone or in combination with tamoxifen versus tamoxifen alone for adjuvant treatment of postmenopausal women with early breast cancer: First results of the ATAC randomised trial. Lancet 359:2131–2139, 2002[CrossRef][Medline]

Submitted October 21, 2002; accepted July 18, 2003.

CiteULike    Complore    Connotea    Del.icio.us    Digg    Facebook    Reddit    Technorati    Twitter    What's this?

This article has been cited by other articles:

				K. Visvanathan, R. T. Chlebowski, P. Hurley, N. F. Col, M. Ropka, D. Collyar, M. Morrow, C. Runowicz, K. I. Pritchard, K. Hagerty, et al. American Society of Clinical Oncology Clinical Practice Guideline Update on the Use of Pharmacologic Interventions Including Tamoxifen, Raloxifene, and Aromatase Inhibition for Breast Cancer Risk Reduction J. Clin. Oncol., July 1, 2009; 27(19): 3235 - 3258. [Abstract] [Full Text] [PDF]

				L. B. Michaud, J. P. Karpinski, K. L. Jones, and J. Espirito Dietary supplements in patients with cancer: Risks and key concepts, part 1 Am. J. Health Syst. Pharm., February 15, 2007; 64(4): 369 - 381. [Abstract] [Full Text] [PDF]

				N. Abramson, J. P. Costantino, J. E. Garber, N. Berliner, D. L. Wickerham, and N. Wolmark Effect of Factor V Leiden and Prothrombin G20210->A Mutations on Thromboembolic Risk in the National Surgical Adjuvant Breast and Bowel Project Breast Cancer Prevention Trial. J Natl Cancer Inst, July 5, 2006; 98(13): 904 - 910. [Abstract] [Full Text] [PDF]

				M. Adess, R. Eisner, S. Nand, J. Godwin, H. L. Messmore Jr, and W. H. Wehrmacher Thromboembolism in Cancer Patients: Pathogenesis and Treatment Clinical and Applied Thrombosis/Hemostasis, July 1, 2006; 12(3): 254 - 266. [Abstract] [PDF]

				M. Sonmezer and K. Oktay Fertility preservation in young women undergoing breast cancer therapy. Oncologist, May 1, 2006; 11(5): 422 - 434. [Abstract] [Full Text] [PDF]

				B. Fisher, J. P. Costantino, D. L. Wickerham, R. S. Cecchini, W. M. Cronin, A. Robidoux, T. B. Bevers, M. T. Kavanah, J. N. Atkins, R. G. Margolese, et al. Tamoxifen for the Prevention of Breast Cancer: Current Status of the National Surgical Adjuvant Breast and Bowel Project P-1 Study J Natl Cancer Inst, November 16, 2005; 97(22): 1652 - 1662. [Abstract] [Full Text] [PDF]

				O. Vitseva, D. A. Flockhart, Y. Jin, S. Varghese, and J. E. Freedman The Effects of Tamoxifen and Its Metabolites on Platelet Function and Release of Reactive Oxygen Intermediates J. Pharmacol. Exp. Ther., March 1, 2005; 312(3): 1144 - 1150. [Abstract] [Full Text] [PDF]

				A. Decensi, P. Maisonneuve, N. Rotmensz, D. Bettega, A. Costa, V. Sacchini, A. Salvioni, R. Travaglini, P. Oliviero, G. D'Aiuto, et al. Effect of Tamoxifen on Venous Thromboembolic Events in a Breast Cancer Prevention Trial Circulation, February 8, 2005; 111(5): 650 - 656. [Abstract] [Full Text] [PDF]

				W. McCaskill-Stevens, J. Wilson, J. Bryant, E. Mamounas, L. Garvey, J. James, W. Cronin, and D. L. Wickerham Contralateral Breast Cancer and Thromboembolic Events in African American Women Treated With Tamoxifen J Natl Cancer Inst, December 1, 2004; 96(23): 1762 - 1769. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Purchase Article View Shopping Cart Alert me when this article is cited Alert me if a correction is posted Services Email this article to a colleague Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Save to my personal folders Download to citation manager Rights & Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Duggan, C. Articles by Cuzick, J. Search for Related Content PubMed PubMed Citation Articles by Duggan, C. Articles by Cuzick, J. Social Bookmarking                            What's this?