Advertisement
Journal of Clinical Oncology  
Search for:
Limit by:
  Browse by Subject or Issue
Home Search or Browse JCO My JCO Subscriptions Customer Service Site Map

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yamamoto, S.
Right arrow Articles by Aozasa, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yamamoto, S.
Right arrow Articles by Aozasa, K.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
Journal of Clinical Oncology, Vol 21, Issue 3 (February), 2003: 447-452
© 2003 American Society for Clinical Oncology

Elevated Expression of Valosin-Containing Protein (p97) in Hepatocellular Carcinoma Is Correlated With Increased Incidence of Tumor Recurrence

Shinji Yamamoto, Yasuhiko Tomita, Shoji Nakamori, Yoshihiko Hoshida, Hiroaki Nagano, Keizo Dono, Koji Umeshita, Masato Sakon, Morito Monden, Katsuyuki Aozasa

From the Departments of Surgery and Clinical Oncology, and Pathology, Osaka University Graduate School of Medicine, Osaka, Japan.

Address reprint requests to Yasuhiko Tomita, MD, Department of Pathology (C3), Osaka University Graduate School of Medicine, 2-2 Yamadaoka, Suita Osaka 565-0871, Japan; email: yt{at}molpath.med.osaka-u.ac.jp.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Purpose: Valosin-containing protein (VCP; also known as p97) has been shown to be associated with antiapoptotic function and metastasis via activation of the nuclear factor-{kappa}B signaling pathway. In this study, association of VCP expression with recurrence of hepatocellular carcinoma (HCC) and patient survival was examined.

Patients and Methods: VCP expression in 170 patients (139 male and 31 female) with ages ranging from 31 to 81 years (median, 61 years) was analyzed by quantitative reverse-transcription polymerase chain reaction (RT-PCR) and immunohistochemistry, in which staining intensity in tumor cells was categorized as weaker (level 1) or equal to or stronger (level 2) than that in endothelial cells.

Results: Immunohistochemically, 57 patients (35.2%) showed level 1, and 105 patients (64.8%) showed level 2, VCP expression. Quantitative RT-PCR analysis revealed higher VCP mRNA expression in level 2 patients (n = 7) than level 1 (n = 4) (P < .05). Patients with VCP-level 2 HCC showed higher rate of portal vein invasion in the tumor (P < .01) and poorer disease-free and overall survival (P < .0001 and P < .05, respectively) compared with level 1 patients. Multivariate analysis revealed VCP expression level, tumor multiplicity, and degree of fibrosis in the noncancerous liver tissue to be independent prognosticators for disease-free and overall survival. VCP level was an indicator for disease-free survival in each early- (I and II) and advanced- (III and IV) stage group of pathologic tumor-node-metastasis classification (P < .001 and P < .01, respectively).

Conclusion: VCP expression level has prognostic significance for disease-free and overall survival of patients with HCC.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
HEPATOCELLULAR CARCINOMA (HCC) is one of the most common cancers worldwide, especially in Southeast Asia and Africa.1 The annual incidence rate of HCC in Japan is approximately 30 per 100,000 population, and its mortality is ranked third as a cancer death.1 Cirrhosis and chronic hepatitis caused by hepatitis B or C viral infection have been discussed in association with the development of HCC.2–6 Surgical resection is the main modality of treatment for HCC, but the prognosis remains poor even in curatively resected cases: 5-year survival rate is 25% to 50% after surgery, mainly owing to the high recurrence rate.7–11

Several histologic factors have been reported to be prognosticators for HCC. Among them, tumor size and vascular invasion, either portal or hepatic, were the main factors for tumor recurrence7–15; these two factors, together with the multiplicity of the tumor, were included in the tumor-node-metastasis (TNM) classification for HCC.16 However, prognoses of patients with solitary and small-sized tumors without microscopic vascular invasion were still unfavorable.17 Therefore, it is important to identify other prognostic factors responsible for the recurrence of HCC.

Recently, we identified the gene-encoding valosin-containing protein (VCP; also known as p97) as being associated with metastasis of the murine osteosarcoma cell line by using the mRNA subtraction technique.18 VCP, a member of the ATPases associated with various cellular activities (AAA) superfamily, is involved in the ubiquitin-dependent proteasome degradation pathway of inhibitor {kappa}B{alpha} (I{kappa}B{alpha}), an inhibitor of nuclear factor-{kappa}B (NF{kappa}B).19 Cell lines transfected with VCP show the constant activation of NF{kappa}B, rapid degradation of phosphorylated I{kappa}B{alpha} (p-I{kappa}B{alpha}), decreased apoptosis rates after tumor necrosis factor alpha stimulation, and increased metastatic potential.18 NF{kappa}B signaling is suggested to play an important role in proliferation and prevention of apoptosis of hepatocytes during liver regeneration.20

In this study, expression level of VCP in HCC was examined by reverse transcription-polymerase chain reaction (RT-PCR) and immunohistochemical analysis, and its correlation with recurrence and survival of patients with HCC was evaluated.


    PATIENTS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Patients
One hundred seventy patients who underwent curative resection for primary HCC at the Gastroenterological Surgery Division of Osaka University Hospital in Osaka, Japan, during the period from July 1987 to February 2000 were selected for this study. There were 139 male and 31 female patients, with ages ranging from 31 to 81 years (median, 61 years). Thirty-seven patients were positive for hepatitis B virus surface antigen, whereas 99 patients were positive for hepatitis C virus antibody. Preoperative diagnostic imagining examinations, including ultrasonography, computed tomography scan, and angiography, were performed in all patients. Liver function was assessed by combined findings of Pugh-Child’s classification, liver biochemistry including serum alpha-fetoprotein (AFP) level, and indocyanine green retention test. Preoperative transarterial embolization was performed in 62 patients (36%). According to the number of resected anatomic segments,21 surgical procedures used were classified as follows: limited resection (79 patients), subsegmentectomy (41 patients), segmentectomy (29 patients), lobectomy (16 patients), and extended lobectomy (five patients).

Surgically resected specimens were fixed in 10% formalin and routinely processed for paraffin embedding. Histologic sections cut at 4-µm thickness were stained with hematoxylin and eosin and reviewed by one of the authors (Y.H.) to determine the following categories: differentiation of tumor cells based on the criteria proposed by Edmondson and Steiner (I, well-differentiated; II, moderately differentiated; III, poorly differentiated; IV, undifferentiated),2 pattern of growth (expansive or infiltrative), formation of fibrous capsule around the tumor, portal vein invasion, tumor multiplicity, and positivity for the surgical margin. When tumor cells were present within 5 mm from the edge, surgical margin was defined as positive. Degree of inflammation and fibrosis in noncancerous hepatic tissues were shown as the histologic activity index (HAI) score.22 Regarding inflammatory grade, there were 13 patients with no activity (score of 0), 60 with minimal activity (score of 1 to 3), 84 with moderate activity (score of 4 to 7), and 13 with severe activity (score of >= 8). The degree of fibrosis was categorized as stage 0 (no fibrosis) in 14 patients, stage 1 (mild fibrosis) in 53, stage 3 (severe fibrosis) in 55, and stage 4 (cirrhosis) in 48.

After surgery, measurement of serum AFP level and ultrasonography and computed tomography scan were performed at 1- and 3-month intervals, respectively. When tumor recurrence was suspected, angiography was performed. The patients were observed until March 31, 2002; the follow-up periods for survivors ranged from 5 to 136 months (median, 43 months) after surgery.

Immunohistochemical Analysis
Immunoperoxidase procedure (avidin-biotin-complex method) was performed on paraffin-embedded sections. Antigen retrieval was performed with heating the sections in 10 mmol/L citrate buffer for 5 minutes. Anti-VCP (p97) monoclonal antibody (PROGEN Biotechnik, Heidelberg, Germany) was used as the primary antibody at a dilution of 1:3,000. Sections were counterstained lightly with methyl green. For negative controls, nonimmunized mouse immunoglobulin G (Vector Laboratories, Burlingame, CA) was used as a primary antibody. Positive staining in endothelial cells in the noncancerous areas in each specimen was used as internal positive control. Stained sections were evaluated in a blinded manner without prior knowledge of the clinicopathologic parameters. Staining intensity in the cytoplasm of the tumor cells was shown in comparison to that of endothelial cells and categorized as follows: weaker (level 1) or equal to or stronger (level 2) than that of endothelial cells. When staining intensity of the tumor cells was different among areas in the same specimen, the predominant pattern was chosen. Cases with negative endothelial cell staining were regarded as having poor antigen preservation and were excluded from further analysis.

Quantitative RT-PCR Analysis of VCP
Total RNA was extracted from fresh frozen samples in 11 cases of HCC with TRIzoL reagent (Invitrogen, Carlsbad, CA). Ten micrograms of DNase I-treated total RNA was used for reverse transcription with Superscript II (Invitrogen). An aliquot representing 100 ng of input RNA was amplified by quantitative real-time PCR using TaqMan PCR Reagent Kit (Applied Biosystems, Foster City, CA) with the ABI PRISM 7700 Sequence Detection System (Applied Biosystems) as follows: 50°C for 2 minutes, 95°C for 10 minutes, and 40 cycles at 95°C for 15 seconds and 60°C for 1 minute.23,24 Forward primer 5'-TCACCCACACTGTGCCCATCTACGA-3', reverse primer 5'-CAGCGGAACCGCTCATTCGCCAATGG-3', and probe 5'-6-carboxyfluorescein (FAM)-ATGCCC-6-caboxytetramethylrhodamine (TAMRA)–CCCCCATGCCATCCTGCGTp-3' was used for amplification of beta-actin, and forward primer 5'-AAACCGTGGTAGAGGTGCCA-3', reverse primer 5'-CTTGGAAGGTGTCATGCCAA-3', and probe 5'- (FAM) CAGTATCCTGTGGAGCACCCAGACAAATTC (TAMRA)-3' for VCP. RNA extracted from noncancerous hepatic sample in one case was used as a standard. After reverse transcription, standard cDNA was serially diluted to obtain five standard solutions for use in PCR reaction to generate the reference curve. Relative amount of cDNA in each sample was measured by interpolation in the standard curve,24 and then relative ratio of VCP/beta-actin expression was calculated for each HCC sample.

Statistics
Statistical analysis was performed by using JMP software (SAS Institute Inc, Cary, NC). Correlation between expression level of VCP at quantitative RT-PCR and immunohistochemistry was evaluated by one-way analysis of variance. Correlation between VCP expression at immunohistochemistry and clinicopathologic parameters was evaluated by using the {chi}2 test and Fisher’s exact probability test. Overall and disease-free survival rates were calculated by using the Kaplan-Meier method,25 and difference in survival curves was analyzed by using the log-rank test. Independent prognostic factors were analyzed by the Cox proportional hazards regression model with stepwise manner.26 The presence of a statistically significant difference was denoted by P < .05.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
VCP Expression in HCC
Eight (4.7%) of 170 sections that did not show endothelial staining by immunohistochemistry were regarded as having poor antigen preservation and were excluded from further analysis. The remaining 162 cases showing endothelial staining were evaluated for VCP expression. Forty-two cases showed a constant level 1 staining in the cytoplasm of HCC in every area of the tumor, whereas 15 cases showed level 2 staining at the peripheral zone but level 1 in the larger central area of the tumor. In total, 57 cases (35.2%) were regarded as having level 1 VCP expression. The remaining 105 cases (64.8%) showed level 2 staining throughout the tumors (Fig 1Go).



View larger version (132K):
[in this window]
[in a new window]
 
Fig 1. (A, B) Valosin-containing protein (VCP) level 1 hepatocellular carcinoma (HCC). Tumor cells are weakly stained with VCP compared with the endothelial cells. (C, D) VCP level 2 HCC. Tumor cells show strong VCP staining similar to that of the endothelial cells (magnification x100). H and E, hematoxylin and eosin; VCP, VCP immunohistochemistry.

 
Quantitative RT-PCR analysis was performed in four HCCs with level 1 and seven with level 2 expression. Relative ratio of VCP/beta-actin expression in cases with level 1 and 2 expression was 3.1 ± 1.3 and 9.0 ± 4.0 (mean ± SD), respectively (P < .05; Fig 2Go). All but one of level 1 cases showed the lower VCP expression than level 2 cases at the RT-PCR analysis.



View larger version (12K):
[in this window]
[in a new window]
 
Fig 2. Valosin-containing protein (VCP)/beta-actin relative ratio of mRNA expression in hepatocellular carcinoma with VCP level 1 and 2. All but one case with VCP level 1 showed ratios lower than those of level 2 (P < .05). Bars, mean ± SD.

 
Uni- and Multivariate Analyses for Prognostic Factors in HCC
Significant difference was observed in the presence of portal vein invasion between HCC with VCP level 1 (40.0%) and level 2 (61.9%) expression (P < .01; Table 1Go). There was no significant relation between VCP level and other clinicopathologic factors.


View this table:
[in this window]
[in a new window]
 
Table 1. Relationship Between Valosin-Containing Protein (VCP) Expression and Clinicopathologic Factors
 
Five-year disease-free and overall survival rates of the 162 patients with HCC were 26.7% and 64.9%, respectively. Tumor recurrence during the course was found in remnant liver in 109 patients, lymph node in four, bone in two, and other organs in three. Prognostic significance of VCP expression was analyzed for disease-free and overall survival. Patients with level 1 HCC had better 5-year survival rates than those with level 2 HCC (disease-free survival rate, 50.5% v 15.3%; P < .0001; overall survival rate, 79.2% v 57.0%; P < .05; Fig 3Go; Table 2Go). Twenty-eight (49.1%) of 57 level 1 patients developed recurrent HCC at 32.0 ± 4.2 (mean ± SD) months after the surgery, whereas 90 (85.7%) of 105 level 2 patients developed recurrent HCC at 19.1 ± 2.3 months (P < .01).



View larger version (22K):
[in this window]
[in a new window]
 
Fig 3. Disease-free (A) and overall (B) survival of patients with valosin-containing protein (VCP) level 1 and 2 hepatocellular carcinoma. Significant difference was observed between the two groups (A, P < .0001; B, P < .05).

 

View this table:
[in this window]
[in a new window]
 
Table 2. Univariate Analysis of Clinicopathologic Factors for Disease-Free and Overall Survival of Patients With Hepatocellular Carcinoma
 
Serum AFP level, tumor multiplicity, presence of portal vein invasion, degree of fibrosis in the noncancerous liver tissue (HAI index of 0 v 1 to 4 and 0 to 1 v 3 to 4), and pathologic TNM (pTNM) stage were significant factors for disease-free and overall survival (Table 2Go). Inflammatory status in the noncancerous liver tissues (two categorizations, HAI index of 0 to 3 v > 3 and 0 to 7 v > 7) significantly affected disease-free survival but did not affect overall survival.

Multivariate analysis was performed with factors proven to be significant in the univariate analysis, revealing VCP expression level, tumor multiplicity, and degree of fibrosis in the noncancerous liver tissue (different categorizations, HAI index of 0 v 1 to 4 for disease-free; 0 to 1 v 3 to 4 for overall) to be independent prognostic factors for disease-free and overall survival.

Prognostic Significance of VCP Expression in pTNM Classification
Prognostic significance of VCP expression was further analyzed in patients with HCC according to the pTNM classification system.19 There was a significant difference in disease-free survival between patients with VCP level 1 and 2 expression in both early (I and II) and advanced (III and IV) stage groups (P < .001 and P < .01, respectively; Fig 4Go).



View larger version (21K):
[in this window]
[in a new window]
 
Fig 4. Disease-free survival rates of patients with valosin-containing protein (VCP) level 1 and 2 hepatocellular carcinoma in (A) early (I and II) and (B) advanced (III and IV) pathologic tumor-node-metastasis stages. Significant difference was observed between VCP level 1 and 2 patients in both groups (A, P < .001; B, P < .01).

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
To establish appropriate therapeutic modalities for HCC, precise estimation for tumor recurrence is essential. Although conventional TNM staging, which mainly consists of tumor size, vascular invasion, and tumor multiplicity, is a significant prognosticator for disease-free and overall survival of patients with HCC,8,10,11 increased recurrence rates among patients even at low stage (I and II) has been reported.8,10,11 To reinforce the accuracy of prognostication of the TNM staging system, several biologic factors, such as cellular proliferation indices, DNA ploidy pattern in tumor, and aberrant gene expression,27 have been proposed as candidates for prognosticators. However, the prognostic significance of these factors is still controversial among studies.27 This study was conducted to clarify whether VCP expression level could be a new prognostic factor for HCC.

Patient characteristics (sex, age, viral association, and 5-year survival rates) in this series were similar to those of previous reports from Japan,8,11 other Asian,9,10,12 and Western countries.7 Uni- and multivariate analyses in this study showed the prognostic significance of tumor multiplicity, serum AFP index, presence of portal vein invasion, pTNM stage, and degree of fibrosis in the noncancerous lesion, as reported previously.8–12,28 These findings indicate that the results obtained from these cases are applicable to HCC in other countries.

In this study, VCP expression level was examined in 11 cases by combined quantitative RT-PCR and immunohistochemical analyses and in 151 cases by immunohistochemistry alone. In the 11 cases, there was a clear correlation in VCP expression between the protein (immunohistochemistry) and mRNA (RT-PCR) level, which indicates the reliability of immunohistochemistry for evaluation of VCP expression.

Among the clinicopathologic factors examined, a significant correlation was observed between increased VCP expression and the presence of portal vein invasion of the tumor cells, which was in agreement with our previous study, in which we found that VCP overexpression is correlated with increased metastatic potential of tumor cells in the experimental metastasis model.18 For a successful tumor formation in the portal vein, antiapoptotic pathway including NF{kappa}B signaling might be important in preventing cells from developing apoptosis.18,29 Our previous study indicated that VCP is associated with antiapoptotic function and metastasis via activation of the NF{kappa}B signaling pathway.18 Kirimlioglu et al30 showed the correlation between decreased apoptotic rate and increased rate of portal vein invasion in HCC. Taken together, the present results show the importance of VCP expression for growth of HCC in the portal vein system.

Uni- and multivariate analyses revealed the VCP expression level to be an independent prognosticator for HCC recurrence and patient survival. In addition, VCP level proved to be a prognosticator for recurrence of the disease in patients at both the early (I and II) and advanced (III and IV) stages of pTNM classification: the 5-year disease-free survival rate in patients with VCP level 1 and 2 was 64.5% and 21.5% at low stage, respectively, and 22.0% and 0% at high stage, respectively. Combination of VCP level and pTNM classification is a useful tool for prediction of prognosis for patients with HCC.

Recently, improvement of prognosis of HCC patients by adjuvant therapies, such as chemotherapy,31,32 immunotherapy,33,34 and combined chemo- and immunotherapy35 has been reported. The grouping system described above could be a valuable guide for choosing various modalities of adjuvant therapy. In patients with early-stage VCP level 1 HCC, favorable outcome could be expected without adjuvant therapy, whereas patients with level 2 and/or advanced-stage HCC should receive intensive treatment with adjuvant therapy.

In conclusion, VCP expression as determined by immunohistochemistry could be used as a new prognosticator for HCC. This study shows that stratification of HCC patients based on the stage of disease, tumor multiplicity, and VCP expression level is useful for prediction of prognosis for HCC patients. This system might open a new way to explore effective modalities of treatment for HCC.


View this table:
[in this window]
[in a new window]
 
Table 3. Multivariate Analysis of Clinicopathologic Factors for Disease-Free and Overall Survival of Patients With Hepatocellular Carcinoma
 

    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
1. Parkin DM, Whelan SL, Ferlay J, et al (eds): Cancer Incidence in Five Continents (vol VII). Lyon, France, International Agency for Research on Cancer, 1997

2. Edmondson H, Steiner P: Primary carcinoma of the liver: A study of 100 cases among 48, 900 necropsy. Cancer 7:462–503, 1954[CrossRef][Medline]

3. Beasley RP: Hepatitis B virus: The major etiology of hepatocellular carcinoma. Cancer 61:1942–1956, 1988[CrossRef][Medline]

4. Okuda K, Fujimoto I, Hanai A, et al: Changing incidence of hepatocellular carcinoma in Japan. Cancer Res 47:4967–4972, 1987[Abstract/Free Full Text]

5. Simonetti RG, Cottone M, Craxi’ A, et al: Prevalence of antibodies to hepatitis C virus in hepatocellular carcinoma. Lancet 2:1338, 1989[Medline]

6. Di Bisceglie A: Hepatitis C and hepatocellular carcinoma. Semin Liver Dis 15:64–69, 1995[Medline]

7. Fong Y, Sun RL, Jarnagin W, et al: An analysis of 412 cases of hepatocellular carcinoma at a Western center. Ann Surg 229:790–799, 1999[CrossRef][Medline]

8. The Liver Cancer Study Group of Japan: Predictive factors for long term prognosis after partial hepatectomy for patients with hepatocellular carcinoma in Japan. Cancer 74:2772–2780, 1994[CrossRef][Medline]

9. Lai EC, Fan ST, Lo CM, et al: Hepatic resection for hepatocellular carcinoma: An audit of 343 patients. Ann Surg 221:291–298, 1995[Medline]

10. Lau H, Fan ST, Ng IO, et al: Long term prognosis after hepatectomy for hepatocellular carcinoma: A survival analysis of 204 consecutive patients. Cancer 83:2302–2311, 1998[CrossRef][Medline]

11. Takenaka K, Kawahara N, Yamamoto K, et al: Results of 280 liver resections for hepatocellular carcinoma. Arch Surg 131:71–76, 1996[Abstract/Free Full Text]

12. Poon RT, Fan ST, Ng IO, et al: Different risk factors and prognosis for early and late intrahepatic recurrence after resection of hepatocellular carcinoma. Cancer 89:500–507, 2000[CrossRef][Medline]

13. Lauwers GY, Vauthey JN: Pathological aspects of hepatocellular carcinoma: A critical review of prognostic factors. Hepatogastroenterology 3:1197–1202, 1998

14. Shimada M, Takenaka K, Taguchi K, et al: Prognostic factors after repeat hepatectomy for recurrent hepatocellular carcinoma. Ann Surg 227:80–85, 1998[CrossRef][Medline]

15. Shimada M, Hasegawa H, Gion T, et al: Risk factors of the recurrence of hepatocellular carcinoma originating from residual cancer cells after hepatectomy. Hepatogastroenterology 46:2469–2475, 1999[Medline]

16. Sobin LH, Wittekind CH: TNM classification of Malignant Tumors (ed 5). New York, NY, Wiley, 1997, pp 74–77

17. Adachi E, Maeda T, Matsumata T, et al: Risk factors for intrahepatic recurrence in human small hepatocellular carcinoma. Gastroenterology 108:768–775, 1995[CrossRef][Medline]

18. Asai T, Tomita Y, Nakatsuka S, et al: VCP (p97) regulates NFkappaB signaling pathway, which is important for metastasis of osteosarcoma cell line. Jpn J Cancer Res 93:296–304, 2002[CrossRef][Medline]

19. Dai RM, Chen E, Longo DL, et al: Involvement of valosin-containing protein, an ATPase Co-purified with IkappaBalpha and 26 S proteasome, in ubiquitin-proteasome-mediated degradation of IkappaBalpha. J Biol Chem 273:3562–3573, 1998[Abstract/Free Full Text]

20. Michalopoulos GK, DeFrances MC: Liver regeneration. Science 276:60–66, 1997[Abstract/Free Full Text]

21. Couinaud C: Lobes et segments hepatiques: Note sur l’architecture anatomique et chirurgicale du foie. Presse Med 62:709–711, 1954

22. Knodell RG, Ishak KG, Black WC, et al: Formulation and application of a numerical scoring system for assessing histological activity in asymptomatic chronic active hepatitis. Hepatology 1:431–435, 1981[Medline]

23. Holland PM, Abramson RD, Watson R, et al: Detection of specific polymerase chain reaction product by utilizing the 5'—3' exonuclease activity of Thermus aquaticus DNA polymerase. Proc Natl Acad Sci U S A 88:7276–7280, 1991[Abstract/Free Full Text]

24. Heid CA, Stevens J, Livak KJ, et al: Real time quantitative PCR. Genome Res 6:986–994, 1996[Abstract/Free Full Text]

25. Kaplan E, Meier P: Nonparametric estimation from incomplete observations. J Am Stat Assoc 53:457–481, 1958[CrossRef]

26. Cox DR: Regression models and life tables. J R Stat Soc 34:197–220, 1972

27. Ng IO: Prognostic significance of pathological and biological factors in hepatocellular carcinoma. J Gastroenterol Hepatol 13:666–670, 1998[Medline]

28. Ko S, Kanehiro H, Hisanaga M, et al: Liver fibrosis increases the risk of intrahepatic recurrence after hepatectomy for hepatocellular carcinoma. Br J Surg 89:57–62, 2002[CrossRef][Medline]

29. Tietze MK, Wuestefeld T, Paul Y, et al: IkappaBalpha gene therapy in tumor necrosis factor-alpha- and chemotherapy-mediated apoptosis of hepatocellular carcinomas. Cancer Gene Ther 7:1315–1323, 2000[CrossRef][Medline]

30. Kirimlioglu H, Dvorchick I, Ruppert K, et al: Hepatocellular carcinomas in native livers from patients treated with orthotopic liver transplantation: biologic and therapeutic implications. Hepatology 30:502–510, 2002

31. Ono T, Yamanoi A, Nazmy, et al: Adjuvant chemotherapy after resection of hepatocellular carcinoma causes deterioration of long-term prognosis in cirrhotic patients: Meta-analysis of three randomized controlled trials. Cancer 91:2378–2385, 2001[CrossRef][Medline]

32. Muto Y, Moriwaki H, Ninomiya M, et al: Prevention of second primary tumors by an acyclic retinoid, polyprenoic acid, in patients with hepatocellular carcinoma: Hepatoma Prevention Study Group. N Engl J Med 334:1561–1567, 1996[Abstract/Free Full Text]

33. Kubo S, Nishiguchi S, Hirohashi K, et al: Randomized clinical trial of long-term outcome after resection of hepatitis C virus-related hepatocellular carcinoma by postoperative interferon therapy. Br J Surg 89:418–422, 2002[CrossRef][Medline]

34. Takayama T, Sekine T, Makuuchi M, et al: Adoptive immunotherapy to lower postsurgical recurrence rates of hepatocellular carcinoma: A randomised trial. Lancet 356:802–807, 2000[CrossRef][Medline]

35. Sakon M, Nagano H, Dono K, et al: Combined intraarterial 5-fluorouracil and subcutaneous interferon-alpha therapy for advanced hepatocellular carcinoma with tumor thrombi in the major portal branches. Cancer 94:435–442, 2002[CrossRef][Medline]

Submitted June 12, 2002; accepted November 21, 2002.


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Facebook Facebook   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
Cancer Res.Home page
M. Moenner, O. Pluquet, M. Bouchecareilh, and E. Chevet
Integrated Endoplasmic Reticulum Stress Responses in Cancer
Cancer Res., November 15, 2007; 67(22): 10631 - 10634.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
Y. Qiu, Y. Tomita, B. Zhang, I. Nakamichi, E. Morii, and K. Aozasa
Pre-B-Cell Leukemia Transcription Factor 1 Regulates Expression of Valosin-Containing Protein, a Gene Involved in Cancer Growth
Am. J. Pathol., January 1, 2007; 170(1): 152 - 159.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
E. G. Mimnaugh, W. Xu, M. Vos, X. Yuan, and L. Neckers
Endoplasmic Reticulum Vacuolization and Valosin-Containing Protein Relocalization Result from Simultaneous Hsp90 Inhibition by Geldanamycin and Proteasome Inhibition by Velcade
Mol. Cancer Res., September 1, 2006; 4(9): 667 - 681.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
Y.-C. Hsu, H.-H. Fu, Y.-M. Jeng, P.-H. Lee, and S.-D. Yang
Proline-Directed Protein Kinase FA Is a Powerful and Independent Prognostic Predictor for Progression and Patient Survival of Hepatocellular Carcinoma
J. Clin. Oncol., August 10, 2006; 24(23): 3780 - 3788.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Noguchi, T. Takata, Y. Kimura, A. Manno, K. Murakami, M. Koike, H. Ohizumi, S. Hori, and A. Kakizuka
ATPase Activity of p97/Valosin-containing Protein Is Regulated by Oxidative Modification of the Evolutionally Conserved Cysteine 522 Residue in Walker A Motif
J. Biol. Chem., December 16, 2005; 280(50): 41332 - 41341.
[Abstract] [Full Text] [PDF]


Home page
Ann. Surg. Oncol.Home page
S. Yamamoto, Y. Tomita, T. Uruno, Y. Hoshida, Y. Qiu, N. Iizuka, I. Nakamichi, A. Miyauchi, and K. Aozasa
Increased Expression of Valosin-Containing Protein (p97) Is Correlated With Disease Recurrence in Follicular Thyroid Cancer
Ann. Surg. Oncol., November 1, 2005; 12(11): 925 - 934.
[Abstract] [Full Text] [PDF]


Home page
Ann OncolHome page
S. Yamamoto, Y. Tomita, Y. Hoshida, S. Toyosawa, H. Inohara, M. Kishino, M. Kogo, M. Nakazawa, S. Murakami, N. Iizuka, et al.
Expression level of valosin-containing protein (VCP) as a prognostic marker for gingival squamous cell carcinoma
Ann. Onc., September 1, 2004; 15(9): 1432 - 1438.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S. Yamamoto, Y. Tomita, Y. Hoshida, N. Iizuka, S. Kidogami, H. Miyata, S. Takiguchi, Y. Fujiwara, T. Yasuda, M. Yano, et al.
Expression Level of Valosin-Containing Protein (p97) Is Associated with Prognosis of Esophageal Carcinoma
Clin. Cancer Res., August 15, 2004; 10(16): 5558 - 5565.
[Abstract] [Full Text] [PDF]


Home page
Ann. Surg. Oncol.Home page
S. Yamamoto, Y. Tomita, Y. Hoshida, N. Iizuka, M. Monden, S. Yamamoto, K. Iuchi, and K. Aozasa
Expression Level of Valosin-Containing Protein (p97) Is Correlated With Progression and Prognosis of Non-Small-Cell Lung Carcinoma
Ann. Surg. Oncol., July 1, 2004; 11(7): 697 - 704.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
Y. Tsujimoto, Y. Tomita, Y. Hoshida, T. Kono, T. Oka, S. Yamamoto, N. Nonomura, A. Okuyama, and K. Aozasa
Elevated Expression of Valosin-Containing Protein (p97) Is Associated with Poor Prognosis of Prostate Cancer
Clin. Cancer Res., May 1, 2004; 10(9): 3007 - 3012.
[Abstract] [Full Text] [PDF]


Home page
Ann. Surg. Oncol.Home page
S. Yamamoto, Y. Tomita, Y. Hoshida, H. Nagano, K. Dono, K. Umeshita, M. Sakon, O. Ishikawa, H. Ohigashi, S. Nakamori, et al.
Increased Expression of Valosin-Containing Protein (p97) is Associated With Lymph Node Metastasis and Prognosis of Pancreatic Ductal Adenocarcinoma
Ann. Surg. Oncol., February 1, 2004; 11(2): 165 - 172.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S. Yamamoto, Y. Tomita, Y. Hoshida, M. Sakon, M. Kameyama, S. Imaoka, M. Sekimoto, S. Nakamori, M. Monden, and K. Aozasa
Expression of Valosin-Containing Protein in Colorectal Carcinomas as a Predictor for Disease Recurrence and Prognosis
Clin. Cancer Res., January 15, 2004; 10(2): 651 - 657.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
S. Yamamoto, Y. Tomita, Y. Hoshida, S. Takiguchi, Y. Fujiwara, T. Yasuda, M. Yano, S. Nakamori, M. Sakon, M. Monden, et al.
Expression Level of Valosin-Containing Protein Is Strongly Associated With Progression and Prognosis of Gastric Carcinoma
J. Clin. Oncol., July 1, 2003; 21(13): 2537 - 2544.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yamamoto, S.
Right arrow Articles by Aozasa, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yamamoto, S.
Right arrow Articles by Aozasa, K.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

About
JCO
 Editorial
Roster
 Advertising
Information
 Librarians &
Institutions
 Rights &
Permissions
 PDA Services

Copyright © 2003 by the American Society of Clinical Oncology, Online ISSN: 1527-7755. Print ISSN: 0732-183X
Terms and Conditions of Use
  HighWire Press HighWire Press™ assists in the publication of JCO Online