Originally published as JCO Early Release 10.1200/JCO.2004.08.110 on November 24 2003
Journal of Clinical Oncology, Vol 22, No 1 (January 1), 2004: pp. 133-142
© 2004 American Society of Clinical Oncology.
Phase II Trial of Gefitinib in Recurrent Glioblastoma
Jeremy N. Rich,
David A. Reardon,
Terry Peery,
Jeannette M. Dowell,
Jennifer A. Quinn,
Kara L. Penne,
Carol J. Wikstrand,
Lauren B. Van Duyn,
Janet E. Dancey,
Roger E. McLendon,
James C. Kao,
Timothy T. Stenzel,
B.K. Ahmed Rasheed,
Sandra E. Tourt-Uhlig,
James E. Herndon, II,
James J. Vredenburgh,
John H. Sampson,
Allan H. Friedman,
Darell D. Bigner,
Henry S. Friedman
From the Departments of Medicine, Surgery, Pathology, and Cancer Center Biostatistics, Duke University Medical Center, Durham, NC; and the National Cancer Institute, Bethesda, MD
Address reprint requests to Jeremy N. Rich, MD, Duke University Medical Center, Box 2900, Durham, NC 27710; e-mail: rich0001{at}mc.duke.edu
 |
ABSTRACT
|
|---|
PURPOSE: To evaluate the efficacy and tolerability of gefitinib (ZD1839, Iressa; AstraZeneca, Wilmington, DE), a novel epidermal growth factor receptor tyrosine kinase inhibitor, in patients with recurrent glioblastoma.
PATIENTS AND METHODS: This was an open-label, single-center phase II trial. Fifty-seven patients with first recurrence of a glioblastoma who were previously treated with surgical resection, radiation, and usually chemotherapy underwent an open biopsy or resection at evaluation for confirmation of tumor recurrence. Each patient initially received 500 mg of gefitinib orally once daily; dose escalation to 750 mg then 1,000 mg, if a patient received enzyme-inducing antiepileptic drugs or dexamethasone, was allowed within each patient.
RESULTS: Although no objective tumor responses were seen among the 53 assessable patients, only 21% of patients (11 of 53 patients) had measurable disease at treatment initiation. Seventeen percent of patients (nine of 53 patients) underwent at least six 4-week cycles, and the 6-month event-free survival (EFS) was 13% (seven of 53 patients). The median EFS time was 8.1 weeks, and the median overall survival (OS) time from treatment initiation was 39.4 weeks. Adverse events were generally mild (grade 1 or 2) and consisted mainly of skin reactions and diarrhea. Drug-related toxicities were more frequent at higher doses. Withdrawal caused by drug-related adverse events occurred in 6% of patients (three of 53 patients). Although the presence of diarrhea positively predicted favorable OS from treatment initiation, epidermal growth factor receptor expression did not correlate with either EFS or OS.
CONCLUSION: Gefitinib is well tolerated and has activity in patients with recurrent glioblastoma. Further study of this agent at higher doses is warranted.
 |
INTRODUCTION
|
|---|
Despite advances in therapy, malignant gliomas remain essentially fatal, with a median survival of 10 to 12 months with maximal therapy [1]. Recurrent grade 4 gliomas (glioblastomas) have a strikingly low rate of clinical response and frequent treatment failure. Current therapies target tumors in a nonspecific fashion, usually through DNA damage. Novel targeted therapies currently under development include small-molecule inhibitors of receptor tyrosine kinases to block pathways mediating critical tumor phenotypes. The epidermal growth factor receptor (EGFR) pathway represents a particularly attractive therapeutic target in glioblastomas because EGFR is dysregulated in the majority of human malignant gliomas through overexpression, amplification, and activating mutations [24]. Activity of the EGF pathway in a variety of cancer types has been linked to an increase in motility, adhesion, invasion, and proliferation of tumor cells as well as an inhibition of apoptosis and induction of angiogenesis [5]. Several classes of EGFR inhibitors have been developed, including small-molecule tyrosine kinase inhibitors (TKIs), antibodies, immunotoxin conjugates, and antisense oligonucleotides. Because intracranial delivery of many agents is limited, the use of small-molecule TKIs offers a theoretical advantage over other modalities [6].
Gefitinib (ZD1839, Iressa; AstraZeneca, Wilmington, DE) is a novel, oral low-molecular weight, adenosine triphosphate mimetic of the anilinoquinazoline family that reversibly inhibits the tyrosine kinase activity associated with EGFR [7,8]. Gefitinib has shown an acceptable side-effect profile in phase I studies [911] and therapeutic activity in several phase II studies of several systemic cancers [12,13], leading to recent United States Food and Drug Administration approval for monotherapy for the treatment of patients with locally advanced or metastatic non-small-cell lung cancer after failure of both platinum-based and docetaxel chemotherapies.
We undertook this trial to determine the activity and tolerability of gefitinib in the treatment of patients with glioblastoma at first recurrence. After trial initiation, gefitinib was found to be significantly metabolized by the CYP3A4 cytochrome P450 hepatic enzymes [14]. Because of the high utilization rate of CYP3A4 enzyme-inducing antiepileptic drugs (EIAEDs) and dexamethasone in the brain tumor patient population, we sought to also define the effect of enzyme-inducing drugs on the tolerated dose through an intrapatient dose escalation. In addition, we evaluated the expression of both wild-type EGFR and a constitutively active EGFR mutant (EGFRvIII) [1519] in patient samples with therapeutic response.
 |
PATIENTS AND METHODS
|
|---|
Eligibility
Patients were required to have histologically confirmed glioblastoma in first relapse. Fresh frozen tumor sample for analysis was obtained at the time of relapse to confirm recurrent disease. Histology was reviewed by one of the authors (R.E.M.) and graded according to the WHO's four-tiered system [20]. Patients were not required to have residual measurable disease, were not allowed any prior EGFR-based therapy, and were allowed no chemotherapy or radiotherapy within 4 weeks of study entry (6 weeks for a nitrosourea).
Patients had to be at least 18 years of age, nonpregnant, and not breastfeeding, have a life expectancy of greater than 12 weeks, have a Karnofsky performance status 60%, and be on a nonincreasing dose of corticosteroids for at least 1 week. Normal laboratory measures of hepatic, renal, and bone marrow function were required as defined as a leukocyte count 3,000/µL, an absolute neutrophil count 1,500/µL, a platelet count 100,000/µL, a creatinine level and total bilirubin less than 1.5x the upper limit of institutional normal, and plasma AST and ALT levels 2.5x the upper limit of institutional normal. Patients were not allowed to receive any other investigational agents or have a history of allergic reactions attributed to compounds of similar chemical or biologic composition to gefitinib. Exclusion criteria included uncontrolled severe intercurrent illness, and HIV-positive patients receiving combination antiretroviral therapy.
All patients were required to understand and to be willing to sign a written informed consent document approved by the Duke Institutional Review Board. This study was executed and completed before Health Insurance Portability and Accountability Act regulations took effect.
Treatment Plan and Dose Modifications
Gefitinib was administered to all patients at an initial oral dose of 500 mg/d. Patients who received dexamethasone and/or EIAEDs and/or other CYP3A4-inducing agents without toxicities after 2 weeks of receiving gefitinib had the gefitinib dose escalated to 750 mg/d. If no side effects were noted after an additional 2 weeks, the dose was escalated to 1,000 mg/d. All patients underwent a baseline ophthalmologic examination with slit-lamp and visual acuity assessment.
Therapy was continued until disease progression, significant clinical decline, unacceptable toxicity, or patient decision. Toxicity was graded using the National Cancer Institute Common Toxicity Criteria, version 2.0 [21].
For grade 2 skin rashes and diarrhea that were unacceptable to the patient for symptomatic reasons, gefitinib was temporarily held until resolution and subsequently restarted at the same dose. If symptomatic grade 2 diarrhea and skin rash recurred after reinstituting gefitinib at the same dose, treatment was held until resolution to grade 1 or less, and gefitinib was reinstituted at a dose lowered by 250 mg daily. For other significant grade 2 nonhematologic toxicity, treatment was held until resolution and reinstituted at a dose lowered by 250 mg daily. For grade 3 or 4 toxicity, treatment was discontinued, and the patient was re-evaluated at least weekly until toxicity resolution to grade 1 or less. Treatment was then reinstituted at a dose lowered by 250 mg daily. Patients with unresolved toxicity after 2 weeks were taken off study. If a patient dose was lowered, no increase was undertaken.
Measurement of Effect
Quantification of gefitinib antiglioma efficacy was assessed by 6-month progression-free survival (PFS) and magnetic resonance imaging (MRI) quantification of tumor response. Patients were re-evaluated for response every 8 weeks. The baseline and follow-up scans for each patient were centrally reviewed to determine the overall radiographic response. Comparisons of objective assessments, excluding progressive disease, were based on major changes in tumor size on the gadolinium-MRI scan compared with the baseline scan. Determination of progressive disease was based on comparison to the previous scan with the smallest measurements. Clinical diagnosis of progressive disease was determined by progressive clinical decline attributed to the progression of tumor.
EGFR Immunohistochemistry
Immunohistochemical analysis for wild-type EGFR and EGFRvIII was performed on paraffin-embedded and frozen tumor tissue, as previously described [22,23] with modifications. Polyvalent rabbit anti-EGFR wild-type serum (antiexon27) was produced by immunization of New Zealand white rabbits with bacterially expressed protein representing a portion of the wild-type EGFR extracellular domain not present in EGFRvIII (Wikstrand et al, manuscript in preparation). Staphylococcal protein-A column purified immunoglobulin (Ig) G from this serum recognizes only the wild-type form of EGFR. Antiexon27 and negative control normal rabbit IgG (Sigma, St Louis, MO) were performed as previously described. Monoclonal antibodies L8A4 (IgG1) [23] and EGFR-1 (IgG2b; Pharmingen, San Diego, CA) were used on frozen tissue as previously described. For formalin-fixed slides, endogenous peroxidase was blocked via 3% H2O2 methanol, rehydrated in phosphate-buffered saline, blocked with 10% normal horse serum (S-2000; Vector Laboratories, Burlingame, CA), then incubated with primary reagents at 4°C overnight. Primary antibodies were visualized by biotinylated horse antimouse IgG(H+L) secondary reagent (BA-2001, Vector) for 45 minutes and a tertiary development system (HRP-strepavidin, Vectastain Elite ABC kit, Vector) according to the manufacturer's directions. Slides were developed using diaminobenzidine, counterstained with hematoxylin, and read by two separate observers who were blinded to the response to therapy.
EGFR DNA Quantification
A DNA-based real-time quantitative polymerase chain reaction assay was used to measure the gene amplification of EGFR in tumor tissue from biopsies performed before registration, as previously described [24], using fluorescent Taqman probes to amplify a C-terminal portion of the gene. A 106-base pair region from the C-terminal portion of the EGFR gene (forward primer: 5'AGCCATGCCCGCATTAGCTC3', reverse primer: 5'AAAGGAATGCAACTTCCCAA3') and a 74-base pair product (internal control) from the IFNG gene (forward primer: 5'GCAGAGCCAAATTGTCTCCT3', reverse primer: 5'GGTCTCCACACTCCTTTGGA3') were coamplified using 10 ng of tumor DNA as template. The EGFR and IFNG forward primers were labeled at the 5' end with 6-carboxyflourescein. One microliter of polymerase chain reaction product was added to 0.5 µL of a ROX (Applied Biosystems, Foster City, CA) 400 size standard and 17 µL of formamide and analyzed. The quantitative analysis of the signal intensity was performed with the ABI GeneScan 3.1 program (Applied Biosystems, Foster City, CA). A standard curve was generated using known standards. The relative amplification of EGFR was determined by the quotient of the areas under the signal intensity curves of EGFR and IFNG.
Statistical Considerations
Because previous studies for patients with recurrent glioblastoma have shown a 6-month PFS rate of approximately 21% [25], this single-stage study of 53 assessable patients was designed to differentiate between a 6-month PFS rate of 15% and 30% with type I and II error rates of 0.091.
The primary end point of the study was 6-month PFS, with secondary end point measurements of tumor response rate, event-free survival (EFS), overall survival (OS), and drug toxicity. All patients who met eligibility criteria and were assessable for PFS were included in efficacy analyses. PFS, EFS, and OS were measured as the time between registration and disease progression; disease progression, toxicity, or death; or death, respectively. The product-limit estimator developed by Kaplan and Meier was used to graphically summarize these end points. Relative to PFS, EFS, and OS, the log-rank test was used to compare subgroups defined by the following patient characteristics: age, sex, Karnofsky performance status, extent of resection, systemic toxicity, immunohistochemistry (wild-type EGFR and EGFRvIII), and EGFR DNA amplification. Patient follow-up was updated through June 5, 2003. All statistical analyses were conducted at the 0.05 level of significance.
All patients who received the drug were included in toxicity analysis. The toxicity of gefitinib experienced by patients was tabulated by type and most severe grade.
 |
RESULTS
|
|---|
Patients and Eligibility
Fifty-seven patients were enrolled from May 2001, to November 2002 (Table 1). Four patients were enrolled but were deemed nonassessable for efficacy as follows: one patient died before receiving any drug; one patient developed a CSF infection after surgery and never received drug; one patient developed a pulmonary embolism after 15 days of therapy then developed an intracerebral hemorrhage after anticoagulation; and one patient had stable disease on MRI at 6 weeks of therapy but was diagnosed with a second malignancy (breast carcinoma), requiring protocol discontinuation. The last two patients were included in the toxicity analysis.
Prior therapy administered to the 53 assessable patients is listed in Table 1. Every patient had undergone prior surgical resection and external-beam radiotherapy. One patient received I125 radioactive seeds. Prior chemotherapy was administered as adjunctive therapy to surgery as carmustine-impregnated wafers (n = 9, 17%) or radiation (n = 5, 9%) and/or adjuvant therapy (n = 35, 66%). Patients were treated with either no chemotherapy or up to 12 prior cycles of chemotherapy (median, four cycles) with a median of two chemotherapy agents (range, zero to five agents), including nitrosoureas, temozolomide, irinotecan, etoposide, and retinoic acid. Many patients were treated with combinations of chemotherapeutic agents or rotated on different chemotherapeutic agents, as a standard practice, without evidence of progression. Nine patients (17%) had no prior chemotherapy.
Every patient underwent an open biopsy (one patient, 2%) or resection (gross total resection: no residual enhancement, n = 11, 21%; near total resection: < 0.2 cm of enhancement, n = 16, 30%; subtotal resection: between 0.2 and 1 cm of residual contrast enhancement, n = 14, 26%; and partial resection: > 1 cm of residual contrast enhancement, n = 11, 21%) for confirmation of tumor recurrence.
Follow-up continued for the majority of patients after disease progression. Sixteen patients entered hospice without further therapy. Thirty-seven patients received additional therapy, generally chemotherapy.
Measurement of Therapeutic Effect, Time to Progression, and Survival
Most patients (n = 42, 79%) did not have significant measurable disease ( > 1 cm contrast enhancement) at treatment initiation because of resection. No patient had either complete response or partial response, and 31 patients had radiographic progressive disease (58.4%) within the first 2 months. In total, 51 of the 53 assessable patients eventually developed progressive disease, with two patients remaining on therapy at the time of manuscript preparation (Fig 1A). The median EFS (free of progression or event requiring removal from the protocol) was 8.1 weeks (95% CI, 7.9 to 9.1 weeks). By 3, 6, and 9 months, 36%, 13%, and 9% of patients, respectively, had not experienced disease progression. One patient received four additional cycles of gefitinib despite early radiographic progression at cycle 2 on retrospective MRI review. In this article, this patient is treated as having received two cycles of protocol therapy. Of the 22 patients (42%) with radiographic stable disease, five patients were removed for reasons other than radiographic progression; two patients were removed for grade 4 toxicity (one with rash and diarrhea and the other with rash alone), one patient, who had grade 4 diarrhea, was removed by patient decision, and two patients were removed because of clinical decline without radiographic changes. Of the patients with stable disease, the median EFS was 17 weeks (range, 8 to 68 weeks). Nine patients (17.3%) received at least six cycles of therapy. Two patients (4%) remain on therapy after 10 and 17 cycles.

View larger version (13K):
[in this window]
[in a new window]
|
Fig 1. Kaplan-Meier curves of (A) time to progression and (B) overall survival from treatment initiation.
|
|
Median survival has been 39.4 weeks (95% CI, 24.3 to 59.4 weeks), with a 1-year survival probability of 35.6% (Fig 1B). Of the 53 assessable patients, 19 patients remain alive.
Toxicity
Fifty-five patients were included in the toxicity analysis (Table 2). As expected, the most common toxicities were rash and diarrhea [911,26]. Of the 33 patients who developed rash, most were grade 1 to 2 (n = 25, 75.7%). The rash generally occurred early; 15 patients developed the rash during the first cycle, 10 during the second cycle, and eight thereafter (four patients during cycle 3, three during cycle 4, and one during cycle 5). Doses at which rash started were 500 mg for 10 patients (six of whom were not on EIAEDs), 750 mg in six patients, and 1,000 mg in 17 patients (one was on non-enzyme-inducing antiepileptics). Of the 22 patients with diarrhea, 10 patients developed diarrhea during cycle 1, eight during cycle 2, one during cycle 3, and four during cycle 4. The diarrhea occurred at a dose of 500 mg in six patients (three patients were not on EIAEDs), 750 mg in four patients, and 1,000 mg in 12 patients. Other toxicities that were encountered that were felt to be possibly related to gefitinib use included conjunctivitis, onycholysis, anorexia, weight loss, and AST and ALT elevation (no toxicities other than rash or diarrhea were noted in patients off EIAEDs).
Several patients experienced adverse events that were felt to be secondary to their cancer rather than gefitinib treatment, including seizure, cerebral edema, CNS hemorrhage, lower extremity deep vein thrombosis, confusion, muscle weakness, and incontinence. Most of the neurologic events occurred within the context of a progressive tumor. No patient experienced pulmonary toxicity, cellulitis, nausea, vomiting, electrolyte changes, or renal dysfunction.
Wild-Type EGFR and EGFRvIII Expression: Protein and DNA Amplification
Immunohistochemical analysis of operative specimens obtained at treatment initiation for the expression of both wild-type EGFR and the constitutively active mutant form, EGFRvIII, was performed (Table 3). Seventy-nine percent of patient samples expressed wild-type EGFR protein, whereas 49% of tumors expressed EGFRvIII. Four (15%) of 26 patients expressing EGFRvIII did not express wild-type EGFR. Overexpression of EGFR DNA was associated with wild-type EGFR protein expression in 14 (93%) of 15 patients and EGFRvIII expression in five (33%) of 15 patients. Wild-type EGFR was expressed in 19 (70%) of 27 tumors without EGFR DNA amplification, whereas EGFRvIII was expressed in 15 (56%) of 27 tumors without amplification.
Factors Related to Response, Progression, and Survival
We analyzed the relationship between several patient factors and either EFS (Table 4) or OS from treatment initiation (Table 5). The presence of diarrhea during therapy was a positive predictor for OS (Fig 2) but not EFS. The development of skin toxicity during therapy and extent of resection (ie, absence of measurable disease) were borderline significant as predictors of EFS (Fig 3A and B). The relationship between surgical resection and EFS was significant with further subgroup analysis (Fig 3C). Patients who underwent gross total or near total resections at initiation of therapy had both a significantly improved EFS (total resection: n = 27; median EFS, 15.9 weeks; 95% CI, 8.0 to 23.7 weeks; subtotal resection: n = 26; median EFS, 7.9 weeks; 95% CI, 7.4 to 8.1 weeks; P < .0001) and OS from treatment initiation (total resection: n = 27; median OS, 66.0 weeks; 95% CI, 31.6 weeks to not reached; subtotal resection: n = 26; median OS, 25.1 weeks; 95% CI, 17.9 to 40.4 weeks; P = .0058). Because all patients were diagnosed with glioblastoma and had prior surgical resection and external-beam radiation, these factors were not analyzed. Although only nine of 53 patients were not pretreated with chemotherapy, a trend was seen in improved duration of PFS, although it was not statistically significant. Sex, age, performance status, expression of either wild-type or mutant EGFR on immunohistochemistry, and DNA amplification did not predict either disease control or survival.

View larger version (14K):
[in this window]
[in a new window]
|
Fig 3. Kaplan-Meier curves of event-free survival as a function of (A) skin toxicity and (B, C) extent of surgical resection: (B) presence or absence of measurable contrast enhancement and (C) gross or near total resection (GTR/NTR) versus biopsy or subtotal or partial resection (STR/BS).
|
|
 |
DISCUSSION
|
|---|
We report the first clinical trial with gefitinib, a small-molecule TKI of EGFR, in the treatment of glioblastoma. With 53 assessable patients, our study demonstrates tolerability and modest activity of this therapy in patients with this lethal cancer. The majority of patients (56.6%) experienced failure of therapy (ie, progressive radiographic or clinical disease or development of significant toxicity) by the first 8-week evaluation, but a subpopulation has done well, with six patients undergoing nine 4-week cycles of therapy and one patient remaining on treatment for 17 cycles. The 6-month PFS was the primary end point because all patients underwent surgical resection. We observed a 6-month PFS rate of 13.2%, which is worse than observed in patients with first relapse glioblastoma treated with temozolomide (21%) but better than procarbazine (8%) [25]. Of note, patients in the current protocol were enrolled after a longer period relative to diagnosis (median, 37 weeks; range, 12 to 164 weeks) and were more heavily pretreated with chemotherapy. The limited toxicity and modest efficacy seen in this trial suggests the potential utility of this agent.
EGFR offers a particularly promising target in glioblastoma therapy because of the frequent increase in EGFR pathway activity in these tumors, the myriad pro-tumorigenic phenotypic effects of EGFR activation, and the lack of effective therapies. As in systemic cancers, the clinical trial design of anti-EGFR treatments like gefitinib poses significant challenges [27], including determining which patients respond best to these therapies and determining the optimal treatments regimen (dose, monotherapy v combination, and so on). We sought to determine the expression of both the wild-type and constitutively active mutant EGFR forms in our patients before treatment. As in other cancer types, the expression of either EGFR form was neither associated with an increased sensitivity to gefitinib nor did the absence of EGFR expression or amplification preclude tumor control by gefitinib [12,28]. We are currently investigating the activation states of EGFR and the downstream components to gefitinib response. Unfortunately, preclinical studies to date have failed to determine prognostic indicators of tumor response.
The importance of treatment relative to the maximum-tolerated dose has been controversial in the use of targeted therapies. Rather, many have advocated a treatment at a dose where target inhibition is seen. Skin toxicity and diarrhea have been shown to be related to systemic EGFR antagonism and sometimes correlated with treatment response in some trials [12], but patients with other cancer types have also responded to gefitinib in the absence of toxicity [13,29]. Although we found a borderline significant relationship between the presence of rash and EFS but not OS from treatment initiation, significant rash was seen in a minority of patients, and development of diarrhea was linked to improved OS. Thus, we may be underestimating the importance of measures of systemic EGFR effects in relationship to potential drug activity in patients. A recent report of gefitinib in malignant gliomas and meningiomas suggests that patients treated with EIAEDs may tolerate a dose of 1,500 mg [30]. Similar drops in pharmacokinetic measures were seen with brain tumor patients taking EIAEDs and another EGFR TKI, erlotinib (OSI-774), which seems to also demonstrate activity in this patient population [31]. Drug levels may be of particular importance in the brain tumor population because patients who undergo surgical resection have substantial residual tumor protected by a blood-brain barrier. Another small-molecule TKI, imatinib (STI571), has been recently shown to have little brain penetration [32,33], suggesting that low-molecular weight inhibitors may not have free brain access. Another challenge in the brain tumor population is the frequent use of EIAEDs and corticosteroids as a potential source of drug interactions with gefitinib, a CYP3A4-metabolized agent. We have tried to address the potential for drug interactions through a two-step intrapatient dose escalation in the current trial. The low toxicity seen suggests that still greater doses may be tolerated by some patients on P450-inducing drugs.
Our results suggest that targeting EGFR activity in glioblastoma by gefitinib may offer benefit. Gefitinib may offer improved therapeutic benefit with different approaches. First, future trials may be designed to escalate the dose of gefitinib until evidence of significant systemic activity is present either through real-time pharmacokinetics or surrogate markers of systemic anti-EGFR activity, as established by skin biopsy or the development of rash or diarrhea. Although systemic activity does not define activity in the tumor, it may represent a minimal level of activity. Ideally, the activity of gefitinib at the tumor site could be measured by the pretreatment activity of EGFR and downstream mediators with subsequent determination of drug delivery into the tumor as well as suppression of EGFR pathway components. Primary brain tumors pose a challenge in the acquisition of tumor tissue. Therefore, clinical trials incorporating short-term pretreatment with gefitinib before resection followed by chronic therapy may offer an important set of data to link doses, delivery, target suppression, and patient outcome. Finally, it is clear that a single targeted therapy is unlikely to control the complex biology of glioblastoma as monotherapy. Rather, the future use of gefitinib in combination with other complementary targeted therapies or cytotoxic therapies of radiation and chemotherapy may significantly improve clinical efficacy. We have seen preclinical evidence of synergistic therapeutic effects between an EGFR TKI and an inhibitor of mammalian target of rapamycin (J. Rich, manuscript in preparation) in the treatment of malignant glioma, suggesting that gefitinib and rapamycin analogs may offer a therapeutic advantage.
 |
Authors' Disclosures of Potential Conflicts of Interest
|
|---|
The authors indicated no potential conflicts of interest.
 |
Acknowledgment
|
|---|
We thank the Duke Brain Tumor Center staff for the essential support they provided this study.
 |
NOTES
|
|---|
Supported by Federal funds from the National Cancer Institute, National Institutes of Health, Bethesda, MD (grant No. R21 CA91548), and foundation funds from Accelerate Brain Cancer Cure.
Presented in part at the 39th Annual Meeting of the American Society of Clinical Oncology, May 31June 3, 2003, Chicago, IL.
Authors' disclosures of potential conflicts of interest are found at the end of this article.
 |
REFERENCES
|
|---|
1. Scott CB, Scarantino C, Urtasun R, et al: Validation and predictive power of Radiation Therapy Oncology Group (RTOG) recursive partitioning analysis classes for malignant glioma patients: A report using RTOG 90-06. Int J Radiat Oncol Biol Phys 40:5155, 1998[CrossRef][Medline]
2. Bigner SH, Humphrey PA, Wong AJ, et al: Characterization of the epidermal growth factor receptor in human glioma cell lines and xenografts. Cancer Res 50:80178022, 1990[Abstract/Free Full Text]
3. Humphrey PA, Wong AJ, Vogelstein B, et al: Amplification and expression of the epidermal growth factor receptor gene in human glioma xenografts. Cancer Res 48:22312238, 1988[Abstract/Free Full Text]
4. Agosti RM, Leuthold M, Gullick WJ, et al: Expression of the epidermal growth factor receptor in astrocytic tumours is specifically associated with glioblastoma multiforme. Virchows Arch A Pathol Anat Histopathol 420:321325, 1992[CrossRef][Medline]
5. Sugawa N, Yamamoto K, Ueda S, et al: Function of aberrant EGFR in malignant gliomas. Brain Tumor Pathol 15:5357, 1998[CrossRef][Medline]
6. Villano JL, Mauer AM, Vokes EE: A case study documenting the anticancer activity of ZD1839 (Iressa) in the brain. Ann Oncol 14:656658, 2003[Free Full Text]
7. Culy CR, Faulds D: Gefitinib. Drugs 62:22372248, 2002[CrossRef][Medline]
8. Ciardiello F, Tortora G: A novel approach in the treatment of cancer: Targeting the epidermal growth factor receptor. Clin Cancer Res 7:29582970, 2001[Abstract/Free Full Text]
9. Baselga J, Rischin D, Ranson M, et al: Phase I safety, pharmacokinetic, and pharmacodynamic trial of ZD1839, a selective oral epidermal growth factor receptor tyrosine kinase inhibitor, in patients with five selected solid tumor types. J Clin Oncol 20:42924302, 2002[Abstract/Free Full Text]
10. Herbst RS, Maddox AM, Rothenberg ML, et al: Selective oral epidermal growth factor receptor tyrosine kinase inhibitor ZD1839 is generally well-tolerated and has activity in non-small-cell lung cancer and other solid tumors: Results of a phase I trial. J Clin Oncol 20:38153825, 2002[Abstract/Free Full Text]
11. Ranson M, Hammond LA, Ferry D, et al: ZD1839, a selective oral epidermal growth factor receptor-tyrosine kinase inhibitor, is well tolerated and active in patients with solid, malignant tumors: Results of a phase I trial. J Clin Oncol 20:22402250, 2002[Abstract/Free Full Text]
12. Cohen EE, Rosen F, Stadler WM, et al: Phase II trial of ZD1839 in recurrent or metastatic squamous cell carcinoma of the head and neck. J Clin Oncol 21:19801987, 2003[Abstract/Free Full Text]
13. Fukuoka M, Yano S, Giaccone G, et al: Multi-institutional randomized phase II trial of gefitinib for previously treated patients with advanced non-small-cell lung cancer. J Clin Oncol 21:22372246, 2003[Abstract/Free Full Text]
14. Swaisland H, Smith RP, Farebrother J, et al: The effects of the induction and inhibition of CYP3A4 on the pharmacokinetics of single oral doses of ZD1839 ("Iressa"), a selective epidermal growth factor receptor tyrosine kinase inhibitor (EGFR-TKI), in healthy male volunteers. Proc Am Soc Clin Oncol 21:83, 2002 (abstr 328)
15. Libermann TA, Nusbaum HR, Razon N, et al: Amplification, enhanced expression and possible rearrangement of EGF receptor gene in primary human brain tumours of glial origin. Nature 313:144147, 1985[CrossRef][Medline]
16. Nishikawa R, Ji XD, Harmon RC, et al: A mutant epidermal growth factor receptor common in human glioma confers enhanced tumorigenicity. Proc Natl Acad Sci USA 91:77277731, 1994[Abstract/Free Full Text]
17. Batra SK, Castellino-Prabhu S, Wikstrand CJ, et al: Epidermal growth factor ligand-independent, unregulated, cell-transforming potential of a naturally occurring human mutant EGFRvIII gene. Cell Growth Differ 6:12511259, 1995[Abstract]
18. Ekstrand AJ, Longo N, Hamid ML, et al: Functional characterization of an EGF receptor with a truncated extracellular domain expressed in glioblastoma with EGFR gene amplification. Oncogene 9:23132330, 1994[Medline]
19. Ekstrand AJ, Sugawa N, James CD, et al: Amplified and rearranged epidermal growth factor receptor genes in human glioblastomas reveal deletions of sequences encoding portions of the N- and/or C-terminal tails. Proc Natl Acad Sci USA 89:43094313, 1992[Abstract/Free Full Text]
20. Kleihues P, Cavenee WK: WHO Classification: Pathology and Genetics of Tumours of the Nervous System. Lyon, France, IARC Press, 2000, pp 954
21. Therasse P, Arbuck SG, Eisenhauer EA, et al: New guidelines to evaluate the response to treatment in solid tumors: European Organization for Research and Treatment of Cancer, National Cancer Institute of the United States, National Cancer Institute of Canada. J Natl Cancer Inst 92:205216, 2000[Abstract/Free Full Text]
22. Wikstrand CJ, Bourdon MA, Pegram CN, et al: Human fetal brain antigen expression common to tumors of neuroectodermal tissue origin. J Neuroimmunol 3:4362, 1982[CrossRef][Medline]
23. Wikstrand CJ, McLendon RE, Friedman AH, et al: Cell surface localization and density of the tumor-associated variant of the epidermal growth factor receptor, EGFRvIII. Cancer Res 57:41304140, 1997[Abstract/Free Full Text]
24. Waha A, Rollbrocker B, Wiestler OD, et al: A polymerase chain reaction-based assay for the rapid detection of gene amplification in human tumors. Diagn Mol Pathol 5:147150, 1996[CrossRef][Medline]
25. Yung WK, Albright RE, Olson J, et al: A phase II study of temozolomide vs. procarbazine in patients with glioblastoma multiforme at first relapse. Br J Cancer 83:588593, 2000[CrossRef][Medline]
26. Albanell J, Rojo F, Averbuch S, et al: Pharmacodynamic studies of the epidermal growth factor receptor inhibitor ZD1839 in skin from cancer patients: Histopathologic and molecular consequences of receptor inhibition. J Clin Oncol 20:110124, 2002[Abstract/Free Full Text]
27. Grunwald V, Hidalgo M: Developing inhibitors of the epidermal growth factor receptor for cancer treatment. J Natl Cancer Inst 95:851867, 2003[Abstract/Free Full Text]
28. Magne N, Fischel JL, Dubreuil A, et al: Influence of epidermal growth factor receptor (EGFR), p53 and intrinsic MAP kinase pathway status of tumour cells on the antiproliferative effect of ZD1839 ("Iressa"). Br J Cancer 86:15181523, 2002[CrossRef][Medline]
29. Kris MG, Natale RB, Herbst RS, et al: A phase II trial of ZD1839 ("Iressa") in advanced non-small-cell lung cancer (NSCLC) patients who had failed platinum- and docetaxel-based regimens (IDEAL 2). Proc Am Soc Clin Oncol 21:292, 2002 (abstr 1166)
30. Lieberman FS, Cloughesy T, Malkin M, et al: Phase I-II study of ZD-1839 for recurrent malignant gliomas and meningiomas progressing after radiation therapy. Proc Am Soc Clin Oncol 22:105, 2003 (abstr 421)
31. Prados M, Chang S, Burton E, et al: Phase I study of OSI-774 alone or with temozolomide in patients with malignant glioma. Proc Am Soc Clin Oncol 22:99, 2003 (abstr 394)
32. Parise RA, McCully CM, Balis FM, et al: Plasma and cerebrospinal fluid (CSF) pharmacokinetics of imatinib (STI571, Gleevec) in non-human primates (NHP). Proc Am Assoc Cancer Res 44:1079, 2003 (abstr 4705)
33. Wolff NC, Richardson JA, Egorin M, et al: The CNS is a sanctuary for leukemic cells in mice receiving imatinib mesylate for Bcr/Abl-induced leukemia. Blood 101:50105013, 2003[Abstract/Free Full Text]
Submitted August 14, 2003;
accepted October 27, 2003.

CiteULike Complore Connotea Del.icio.us Digg Facebook Reddit Technorati Twitter What's this?
Related Correspondence
- Gefitinib in Recurrent Glioblastoma
M. Raphael Pfeffer, Mark L. Levitt, and Dan Aderka
JCO 2004 22: 2755
[Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
L. M. Moore, K. M. Holmes, S. M. Smith, Y. Wu, E. Tchougounova, L. Uhrbom, R. Sawaya, J. M. Bruner, G. N. Fuller, and W. Zhang
IGFBP2 is a candidate biomarker for Ink4a-Arf status and a therapeutic target for high-grade gliomas
PNAS,
September 29, 2009;
106(39):
16675 - 16679.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Neyns, J. Sadones, E. Joosens, F. Bouttens, L. Verbeke, J.-F. Baurain, L. D'Hondt, T. Strauven, C. Chaskis, P. In't Veld, et al.
Stratified phase II trial of cetuximab in patients with recurrent high-grade glioma
Ann. Onc.,
September 1, 2009;
20(9):
1596 - 1603.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. J. Lau, Z. Koty, and J. Nalbantoglu
Differential Response of Glioma Cells to FOXO1-Directed Therapy
Cancer Res.,
July 1, 2009;
69(13):
5433 - 5440.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Karpel-Massler, U. Schmidt, A. Unterberg, and M.-E. Halatsch
Therapeutic Inhibition of the Epidermal Growth Factor Receptor in High-Grade Gliomas: Where Do We Stand?
Mol. Cancer Res.,
July 1, 2009;
7(7):
1000 - 1012.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-S. Guillamo, S. de Bouard, S. Valable, L. Marteau, P. Leuraud, Y. Marie, M.-F. Poupon, J.-J. Parienti, E. Raymond, and M. Peschanski
Molecular Mechanisms Underlying Effects of Epidermal Growth Factor Receptor Inhibition on Invasion, Proliferation, and Angiogenesis in Experimental Glioma
Clin. Cancer Res.,
June 1, 2009;
15(11):
3697 - 3704.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V Martin, L Mazzucchelli, and M Frattini
An overview of the epidermal growth factor receptor fluorescence in situ hybridisation challenge in tumour pathology
J. Clin. Pathol.,
April 1, 2009;
62(4):
314 - 324.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. van den Bent, A. A. Brandes, R. Rampling, M. C.M. Kouwenhoven, J. M. Kros, A. F. Carpentier, P. M. Clement, M. Frenay, M. Campone, J.-F. Baurain, et al.
Randomized Phase II Trial of Erlotinib Versus Temozolomide or Carmustine in Recurrent Glioblastoma: EORTC Brain Tumor Group Study 26034
J. Clin. Oncol.,
March 10, 2009;
27(8):
1268 - 1274.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. A. Reardon, K. L. Fink, T. Mikkelsen, T. F. Cloughesy, A. O'Neill, S. Plotkin, M. Glantz, P. Ravin, J. J. Raizer, K. M. Rich, et al.
Randomized Phase II Study of Cilengitide, an Integrin-Targeting Arginine-Glycine-Aspartic Acid Peptide, in Recurrent Glioblastoma Multiforme
J. Clin. Oncol.,
December 1, 2008;
26(34):
5610 - 5617.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Martens, Y. Laabs, H. S. Gunther, D. Kemming, Z. Zhu, L. Witte, C. Hagel, M. Westphal, and K. Lamszus
Inhibition of Glioblastoma Growth in a Highly Invasive Nude Mouse Model Can Be Achieved by Targeting Epidermal Growth Factor Receptor but not Vascular Endothelial Growth Factor Receptor-2
Clin. Cancer Res.,
September 1, 2008;
14(17):
5447 - 5458.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Idbaih, F. Ducray, M. Sierra Del Rio, K. Hoang-Xuan, and J.-Y. Delattre
Therapeutic Application of Noncytotoxic Molecular Targeted Therapy in Gliomas: Growth Factor Receptors and Angiogenesis Inhibitors
Oncologist,
September 1, 2008;
13(9):
978 - 992.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Y. Wen and S. Kesari
Malignant Gliomas in Adults
N. Engl. J. Med.,
July 31, 2008;
359(5):
492 - 507.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. N. Contessa, M. S. Bhojani, H. H. Freeze, A. Rehemtulla, and T. S. Lawrence
Inhibition of N-Linked Glycosylation Disrupts Receptor Tyrosine Kinase Signaling in Tumor Cells
Cancer Res.,
May 15, 2008;
68(10):
3803 - 3809.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. A. Brandes, E. Franceschi, A. Tosoni, M. E. Hegi, and R. Stupp
Epidermal Growth Factor Receptor Inhibitors in Neuro-oncology: Hopes and Disappointments
Clin. Cancer Res.,
February 15, 2008;
14(4):
957 - 960.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. N. Contessa and D. A. Hamstra
Revoking the Privilege: Targeting HER2 in the Central Nervous System
Mol. Pharmacol.,
February 1, 2008;
73(2):
271 - 273.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. S. Ziegler, A. L. Kung, and M. W. Kieran
Anti-Apoptosis Mechanisms in Malignant Gliomas
J. Clin. Oncol.,
January 20, 2008;
26(3):
493 - 500.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. B. Hoelzinger, T. Demuth, and M. E. Berens
Autocrine Factors That Sustain Glioma Invasion and Paracrine Biology in the Brain Microenvironment
J Natl Cancer Inst,
November 7, 2007;
99(21):
1583 - 1593.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. B. Furnari, T. Fenton, R. M. Bachoo, A. Mukasa, J. M. Stommel, A. Stegh, W. C. Hahn, K. L. Ligon, D. N. Louis, C. Brennan, et al.
Malignant astrocytic glioma: genetics, biology, and paths to treatment
Genes & Dev.,
November 1, 2007;
21(21):
2683 - 2710.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Stommel, A. C. Kimmelman, H. Ying, R. Nabioullin, A. H. Ponugoti, R. Wiedemeyer, A. H. Stegh, J. E. Bradner, K. L. Ligon, C. Brennan, et al.
Coactivation of Receptor Tyrosine Kinases Affects the Response of Tumor Cells to Targeted Therapies
Science,
October 12, 2007;
318(5848):
287 - 290.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Stupp, M. E. Hegi, M. R. Gilbert, and A. Chakravarti
Chemoradiotherapy in Malignant Glioma: Standard of Care and Future Directions
J. Clin. Oncol.,
September 10, 2007;
25(26):
4127 - 4136.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Xu and H.-K. G. Shu
EGFR Activation Results in Enhanced Cyclooxygenase-2 Expression through p38 Mitogen-Activated Protein Kinase-Dependent Activation of the Sp1/Sp3 Transcription Factors in Human Gliomas
Cancer Res.,
July 1, 2007;
67(13):
6121 - 6129.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. M.P. Omuro, S. Faivre, and E. Raymond
Lessons learned in the development of targeted therapy for malignant gliomas
Mol. Cancer Ther.,
July 1, 2007;
6(7):
1909 - 1919.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Huang, J. Hu, X. Bian, K. Chen, W. Gong, N. M. Dunlop, O.M. Z. Howard, and J. M. Wang
Transactivation of the Epidermal Growth Factor Receptor by Formylpeptide Receptor Exacerbates the Malignant Behavior of Human Glioblastoma Cells
Cancer Res.,
June 15, 2007;
67(12):
5906 - 5913.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. D. Kirson, V. Dbaly, F. Tovarys, J. Vymazal, J. F. Soustiel, A. Itzhaki, D. Mordechovich, S. Steinberg-Shapira, Z. Gurvich, R. Schneiderman, et al.
Alternating electric fields arrest cell proliferation in animal tumor models and human brain tumors
PNAS,
June 12, 2007;
104(24):
10152 - 10157.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. E. Pelloski, K. V. Ballman, A. F. Furth, L. Zhang, E. Lin, E. P. Sulman, K. Bhat, J. M. McDonald, W.K. A. Yung, H. Colman, et al.
Epidermal Growth Factor Receptor Variant III Status Defines Clinically Distinct Subtypes of Glioblastoma
J. Clin. Oncol.,
June 1, 2007;
25(16):
2288 - 2294.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Tabernero
The Role of VEGF and EGFR Inhibition: Implications for Combining Anti-VEGF and Anti-EGFR Agents
Mol. Cancer Res.,
March 1, 2007;
5(3):
203 - 220.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Broniscer, J. C. Panetta, M. O'Shaughnessy, C. Fraga, F. Bai, M. J. Krasin, A. Gajjar, and C. F. Stewart
Plasma and Cerebrospinal Fluid Pharmacokinetics of Erlotinib and Its Active Metabolite OSI-420
Clin. Cancer Res.,
March 1, 2007;
13(5):
1511 - 1515.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. J. Vredenburgh, A. Desjardins, J. E. Herndon II, J. M. Dowell, D. A. Reardon, J. A. Quinn, J. N. Rich, S. Sathornsumetee, S. Gururangan, M. Wagner, et al.
Phase II Trial of Bevacizumab and Irinotecan in Recurrent Malignant Glioma
Clin. Cancer Res.,
February 15, 2007;
13(4):
1253 - 1259.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Failly, S. Korur, V. Egler, J.-L. Boulay, M. M. Lino, R. Imber, and A. Merlo
Combination of sublethal concentrations of epidermal growth factor receptor inhibitor and microtubule stabilizer induces apoptosis of glioblastoma cells
Mol. Cancer Ther.,
February 1, 2007;
6(2):
773 - 781.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. K. Nicholas, R. V. Lukas, N. F. Jafri, L. Faoro, and R. Salgia
Epidermal Growth Factor Receptor-Mediated Signal Transduction in the Development and Therapy of Gliomas
Clin. Cancer Res.,
December 15, 2006;
12(24):
7261 - 7270.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Puputti, O. Tynninen, H. Sihto, T. Blom, H. Maenpaa, J. Isola, A. Paetau, H. Joensuu, and N. N. Nupponen
Amplification of KIT, PDGFRA, VEGFR2, and EGFR in Gliomas
Mol. Cancer Res.,
December 1, 2006;
4(12):
927 - 934.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Yan, Y. Lu, M. Wang, H. Vikis, R. Yao, Y. Wang, R. A. Lubet, and M. You
Effect of an Epidermal Growth Factor Receptor Inhibitor in Mouse Models of Lung Cancer
Mol. Cancer Res.,
December 1, 2006;
4(12):
971 - 981.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. A. Maher, C. Brennan, P. Y. Wen, L. Durso, K. L. Ligon, A. Richardson, D. Khatry, B. Feng, R. Sinha, D. N. Louis, et al.
Marked Genomic Differences Characterize Primary and Secondary Glioblastoma Subtypes and Identify Two Distinct Molecular and Clinical Secondary Glioblastoma Entities
Cancer Res.,
December 1, 2006;
66(23):
11502 - 11513.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Y. Wang, K. V. Lu, S. Zhu, E. Q. Dia, I. Vivanco, G. M. Shackleford, W. K. Cavenee, I. K. Mellinghoff, T. F. Cloughesy, C. L. Sawyers, et al.
Mammalian Target of Rapamycin Inhibition Promotes Response to Epidermal Growth Factor Receptor Kinase Inhibitors in PTEN-Deficient and PTEN-Intact Glioblastoma Cells
Cancer Res.,
August 15, 2006;
66(16):
7864 - 7869.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. T. Zacharia, S. Saini, E. F. Halpern, and J. E. Sumner
CT of Colon Cancer Metastases to the Liver Using Modified RECIST Criteria: Determining the Ideal Number of Target Lesions to Measure.
Am. J. Roentgenol.,
April 1, 2006;
186(4):
1067 - 1070.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. A. Reardon, J. N. Rich, H. S. Friedman, and D. D. Bigner
Recent Advances in the Treatment of Malignant Astrocytoma
J. Clin. Oncol.,
March 10, 2006;
24(8):
1253 - 1265.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. A. Butowski, P. K. Sneed, and S. M. Chang
Diagnosis and Treatment of Recurrent High-Grade Astrocytoma
J. Clin. Oncol.,
March 10, 2006;
24(8):
1273 - 1280.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. R. Burzynski, T. J. Janicki, R. A. Weaver, and B. Burzynski
Targeted Therapy With Antineoplastons A10 and AS2-1 of High-Grade, Recurrent, and Progressive Brainstem Glioma
Integr Cancer Ther,
March 1, 2006;
5(1):
40 - 47.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
D. A. Reardon, J. A. Quinn, J. J. Vredenburgh, S. Gururangan, A. H. Friedman, A. Desjardins, S. Sathornsumetee, J. E. Herndon II, J. M. Dowell, R. E. McLendon, et al.
Phase 1 Trial of Gefitinib Plus Sirolimus in Adults with Recurrent Malignant Glioma
Clin. Cancer Res.,
February 1, 2006;
12(3):
860 - 868.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. A. Reardon and P. Y. Wen
Therapeutic advances in the treatment of glioblastoma: rationale and potential role of targeted agents.
Oncologist,
February 1, 2006;
11(2):
152 - 164.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Stupp, M. E. Hegi, M. J. van den Bent, W. P. Mason, M. Weller, R. O. Mirimanoff, J. G. Cairncross, and on behalf of the European Organisation for Researc
Changing paradigms--an update on the multidisciplinary management of malignant glioma.
Oncologist,
February 1, 2006;
11(2):
165 - 180.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. D. Prados, K. R. Lamborn, S. Chang, E. Burton, N. Butowski, M. Malec, A. Kapadia, J. Rabbitt, M. S. Page, A. Fedoroff, et al.
Phase 1 study of erlotinib HCl alone and combined with temozolomide in patients with stable or recurrent malignant glioma
Neuro-oncol,
January 1, 2006;
8(1):
67 - 78.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. A. Reardon, M. J. Egorin, J. A. Quinn, J. N. Rich Sr, I. Gururangan, J. J. Vredenburgh, A. Desjardins, S. Sathornsumetee, J. M. Provenzale, J. E. Herndon II, et al.
Phase II Study of Imatinib Mesylate Plus Hydroxyurea in Adults With Recurrent Glioblastoma Multiforme
J. Clin. Oncol.,
December 20, 2005;
23(36):
9359 - 9368.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. N. Rich, S. Sathornsumetee, S. T. Keir, M. W. Kieran, A. Laforme, A. Kaipainen, R. E. McLendon, M. W. Graner, B.K. A. Rasheed, L. Wang, et al.
ZD6474, a Novel Tyrosine Kinase Inhibitor of Vascular Endothelial Growth Factor Receptor and Epidermal Growth Factor Receptor, Inhibits Tumor Growth of Multiple Nervous System Tumors
Clin. Cancer Res.,
November 15, 2005;
11(22):
8145 - 8157.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. S. Friedman and D. D. Bigner
Glioblastoma Multiforme and the Epidermal Growth Factor Receptor.
N. Engl. J. Med.,
November 10, 2005;
353(19):
1997 - 1999.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. K. Mellinghoff, M. Y. Wang, I. Vivanco, D. A. Haas-Kogan, S. Zhu, E. Q. Dia, K. V. Lu, K. Yoshimoto, J. H.Y. Huang, D. J. Chute, et al.
Molecular Determinants of the Response of Glioblastomas to EGFR Kinase Inhibitors.
N. Engl. J. Med.,
November 10, 2005;
353(19):
2012 - 2024.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. W. Bell, T. J. Lynch, S. M. Haserlat, P. L. Harris, R. A. Okimoto, B. W. Brannigan, D. C. Sgroi, B. Muir, M. J. Riemenschneider, R. B. Iacona, et al.
Epidermal Growth Factor Receptor Mutations and Gene Amplification in Non-Small-Cell Lung Cancer: Molecular Analysis of the IDEAL/INTACT Gefitinib Trials
J. Clin. Oncol.,
November 1, 2005;
23(31):
8081 - 8092.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. B. Lassman, M. R. Rossi, J. R. Razier, L. E. Abrey, F. S. Lieberman, C. N. Grefe, K. Lamborn, W. Pao, A. H. Shih, J. G. Kuhn, et al.
Molecular Study of Malignant Gliomas Treated with Epidermal Growth Factor Receptor Inhibitors: Tissue Analysis from North American Brain Tumor Consortium Trials 01-03 and 00-01
Clin. Cancer Res.,
November 1, 2005;
11(21):
7841 - 7850.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Dresemann
Imatinib and hydroxyurea in pretreated progressive glioblastoma multiforme: a patient series
Ann. Onc.,
October 1, 2005;
16(10):
1702 - 1708.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. C. Daw, W. L. Furman, C. F. Stewart, L. C. Iacono, M. Krailo, M. L. Bernstein, J. E. Dancey, R. A. Speights, S. M. Blaney, J. M. Croop, et al.
Phase I and Pharmacokinetic Study of Gefitinib in Children With Refractory Solid Tumors: A Children's Oncology Group Study
J. Clin. Oncol.,
September 1, 2005;
23(25):
6172 - 6180.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Perez-Soler and L. Saltz
Cutaneous Adverse Effects With HER1/EGFR-Targeted Agents: Is There a Silver Lining?
J. Clin. Oncol.,
August 1, 2005;
23(22):
5235 - 5246.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. S. Krause and R. A. Van Etten
Tyrosine Kinases as Targets for Cancer Therapy
N. Engl. J. Med.,
July 14, 2005;
353(2):
172 - 187.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Cappuzzo
Erlotinib in Gliomas: Should Selection Be Based on EGFR and Akt Analyses?
J Natl Cancer Inst,
June 15, 2005;
97(12):
868 - 869.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. C. Paulino, B. S. Teh, M. Sadeh, K. Seiter, L. Ashby, R. LaRocca, T. Ryken, R. D. Aiken, S. Rutkowski, H. Ottensmeier, et al.
Treatment of brain tumors.
N. Engl. J. Med.,
June 2, 2005;
352(22):
2350 - 2353.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Perez-Soler, J. P. Delord, A. Halpern, K. Kelly, J. Krueger, B. M. Sureda, J. von Pawel, J. Temel, S. Siena, D. Soulieres, et al.
HER1/EGFR Inhibitor-Associated Rash: Future Directions for Management and Investigation Outcomes from the HER1/EGFR Inhibitor Rash Management Forum
Oncologist,
May 1, 2005;
10(5):
345 - 356.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Marie, A. F. Carpentier, A.M.P. Omuro, M. Sanson, J. Thillet, K. Hoang-Xuan, and J. -Y. Delattre
EGFR tyrosine kinase domain mutations in human gliomas
Neurology,
April 26, 2005;
64(8):
1444 - 1445.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Giannini, J. N. Sarkaria, A. Saito, J. H. Uhm, E. Galanis, B. L. Carlson, M. A. Schroeder, and C. D. James
Patient tumor EGFR and PDGFRA gene amplifications retained in an invasive intracranial xenograft model of glioblastoma multiforme
Neuro-oncol,
April 1, 2005;
7(2):
164 - 176.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
A. J. Mantha, J. E.L. Hanson, G. Goss, A. E. Lagarde, I. A. Lorimer, and J. Dimitroulakos
Targeting the Mevalonate Pathway Inhibits the Function of the Epidermal Growth Factor Receptor
Clin. Cancer Res.,
March 15, 2005;
11(6):
2398 - 2407.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. B. Solit, Y. She, J. Lobo, M. G. Kris, H. I. Scher, N. Rosen, and F. M. Sirotnak
Pulsatile Administration of the Epidermal Growth Factor Receptor Inhibitor Gefitinib Is Significantly More Effective than Continuous Dosing for Sensitizing Tumors to Paclitaxel
Clin. Cancer Res.,
March 1, 2005;
11(5):
1983 - 1989.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. K. Goudar, Q. Shi, M. D. Hjelmeland, S. T. Keir, R. E. McLendon, C. J. Wikstrand, E. D. Reese, C. A. Conrad, P. Traxler, H. A. Lane, et al.
Combination therapy of inhibitors of epidermal growth factor receptor/vascular endothelial growth factor receptor 2 (AEE788) and the mammalian target of rapamycin (RAD001) offers improved glioblastoma tumor growth inhibition
Mol. Cancer Ther.,
January 1, 2005;
4(1):
101 - 112.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. L. Amador, D. Oppenheimer, S. Perea, A. Maitra, G. Cusati, C. Iacobuzio-Donahue, S. D. Baker, R. Ashfaq, C. Takimoto, A. Forastiere, et al.
An Epidermal Growth Factor Receptor Intron 1 Polymorphism Mediates Response to Epidermal Growth Factor Receptor Inhibitors
Cancer Res.,
December 15, 2004;
64(24):
9139 - 9143.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. A. Brandes, A. Tosoni, U. Basso, M. Reni, F. Valduga, S. Monfardini, P. Amista, L. Nicolardi, G. Sotti, and M. Ermani
Second-Line Chemotherapy With Irinotecan Plus Carmustine in Glioblastoma Recurrent or Progressive After First-Line Temozolomide Chemotherapy: A Phase II Study of the Gruppo Italiano Cooperativo di Neuro-Oncologia (GICNO)
J. Clin. Oncol.,
December 1, 2004;
22(23):
4779 - 4786.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. A. Brandes, A. Tosoni, P. Amista, L. Nicolardi, D. Grosso, F. Berti, and M. Ermani
How effective is BCNU in recurrent glioblastoma in the modern era?: A phase II trial
Neurology,
October 12, 2004;
63(7):
1281 - 1284.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. M. Sorscher, J. N. Rich, B.K. A. Rasheed, H. Yan, G. Rossi, A. Marchioni, L. Longo, D. A. Haber, D. W. Bell, and T. J. Lynch
EGFR Mutations and Sensitivity to Gefitinib
N. Engl. J. Med.,
September 16, 2004;
351(12):
1260 - 1261.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. R. Pfeffer, M. L. Levitt, and D. Aderka
Gefitinib in Recurrent Glioblastoma
J. Clin. Oncol.,
July 1, 2004;
22(13):
2755 - 2755.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. N. Rich, H. S. Friedman, J. B. Powell Jr, and J. E. Dancey
In Reply:
J. Clin. Oncol.,
July 1, 2004;
22(13):
2755 - 2756.
[Full Text]
|
 |
|

|
 |

|
 |
 
T. J. Lynch, D. W. Bell, R. Sordella, S. Gurubhagavatula, R. A. Okimoto, B. W. Brannigan, P. L. Harris, S. M. Haserlat, J. G. Supko, F. G. Haluska, et al.
Activating Mutations in the Epidermal Growth Factor Receptor Underlying Responsiveness of Non-Small-Cell Lung Cancer to Gefitinib
N. Engl. J. Med.,
May 20, 2004;
350(21):
2129 - 2139.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Prommer
Gefitinib: A new agent in palliative care
American Journal of Hospice and Palliative Medicine,
May 1, 2004;
21(3):
222 - 227.
[Abstract]
[PDF]
|
 |
|
|