|
Advertisement |
|
|
||
 |
|
|||||
|
|||||
|
 |
||||||
|
||||||
|
||||||
|
Originally published as JCO Early Release 10.1200/JCO.2004.07.170 on May 24 2004 © 2004 American Society of Clinical Oncology. Fludarabine Plus Mitoxantrone With and Without Rituximab Versus CHOP With and Without Rituximab As Front-Line Treatment for Patients With Follicular LymphomaFrom the Institute of Hematology and Medical Oncology L. e A. Seràgnoli, University of Bologna, Bologna; Departments of Cellular Biotechnology and Hematology, University La Sapienza of Rome; Department of Hematology, La Cattolica University of Rome; Department of Hematology, Tor Vergata University of Rome, Rome; Department of Hematology, University of Udine, Udine; Department of Hematology, University of Napoli, Napoli; Department of Internal Medicine, University of Bari, Bari; Cesena Hospital, Cesena; Division of Oncology, Forlì Hospital, Forlì; Division of Hematology, Brescia Hospital, Brescia; Division of Hematology, Ravenna Hospital, Ravenna; Chair of Hematology, University of Genova, Genova; Department of Hematology, University of Perugia, Perugia; Division of Oncology, Rimini Hospital, Rimini; Division of Hematology, Latina Hospital, Latina, Italy Address reprint requests to Pier Luigi Zinzani, MD, Istituto di Ematologia e Oncologia Medica L. e A. Seràgnoli, Policlinico S. Orsola, Via Massarenti 9, 40138 Bologna, Italy; e-mail: plzinzo{at}med.unibo.it
PURPOSE: Promising new therapeutic options for follicular lymphoma (FL) include fludarabine plus mitoxantrone (FM) and the mouse/human anti-CD20 antibody, rituximab. We performed a randomized comparative trial of FM with cyclophosphamide, doxorubicin, vincristine, and prednisone (CHOP) front-line chemotherapy with and without sequential rituximab. PATIENTS AND METHODS: All previously untreated CD20+ FL patients presenting in 15 Italian cooperative institutions from October 1999 were randomly allocated to FM or CHOP. Following clinical or molecular restaging, patients in complete remission (CR) with bcl-2/IgH negativity (CR–) received no further treatment; those in CR with bcl-2/IgH positivity (CR+) received rituximab, as did those in partial remission (PR) with bcl-2/IgH negativity (PR–) or positivity (PR+); nonresponders (NR subgroup) were off study. RESULTS: After chemotherapy, the FM arm achieved higher rates of CR (68% [49 of 72 patients] v 42% [29 of 68 patients]; P = .003) and CR– (39% [28 of 72 patients] v 13 of 68 patients [19%]; P = .001). Rituximab elicited CR– in 55 of 95 treated patients (58%). The final CR– rate was higher in the FM arm (71% [51 of 72 patients] v 51% [35 of 68 patients]; P = .01). However, with a median follow-up of 19 months (range, 9 to 37 months), no statistically significant difference was found among the various study arms in terms of both progression-free (PFS) and overall survival (OS). CONCLUSION: These results indicate that FM is superior to CHOP for front-line treatment of FL and that rituximab is an effective sequential treatment option. However, they also confirm that this superiority is unlikely to translate into either better PFS or OS.
Follicular lymphoma (FL) accounts for approximately 30% of newly diagnosed non-Hodgkin's lymphomas and is the most common form of lymphoma in the United States and Europe.1 It most often occurs in middle-aged patients, the average age at presentation being approximately 50 years. Most cases of FL bear the t(14;18) translocation, in which the bcl-2 proto-oncogene on chromosome 18 is translocated to the immunoglobulin-heavy–chain region on chromosome 14. The creation of a hybrid bcl-2/IgH gene translates into a marked overexpression of the bcl-2 protein, with all pathogenetic consequences2 FL has a long natural history, accompanied by multiple responses and relapses. Despite the current availability of at least partially effective therapeutic options, the course of FL is still usually slowly progressive. The therapeutic approach to FL is particularly controversial.3–4 Treatment options range from palliative monochemotherapy5 to front-line high-dose therapy followed by autologous hematopoietic rescue.6–8 Evidence exists that the combination of cyclophosphamide, doxorubicin, vincristine, and prednisone (CHOP), or other anthracycline-containing chemotherapy regimens,9–12 can induce molecular responses (in terms of elimination of the bcl-2/IgH polymerase chain reaction [PCR] signal from the peripheral blood and bone marrow), leading to prolonged clinical complete remission (CR). However, more effective strategies are needed to overcome current therapeutic limitations. These could spring from deeper insights into the pathogenesis of FL and/or the search for new cytostatic agents. The purine analogs, including fludarabine, constitute a novel group of antimetabolite compounds that are highly active in lymphoid malignancies. Early trials using single-agent fludarabine produced response rates of 30% to 50% in previously treated FL patients.13 More recent phase II trials focusing on the use in untreated patients of fludarabine-containing combination regimens, including agents such as mitoxantrone,14–18 cyclophosphamide19–20 or idarubicin,21 have reproducibly yielded overall response rates of 70% to 100%, with CR rates of 60% to 90%. In addition, encouraging data have been reported on the ability of front-line treatment with fludarabine plus mitoxantrone (FM) to induce molecular response: in pretreated patients with bcl-2 gene rearrangement, the FM regimen led to PCR negativity in over 50% cases.22,23 Another promising therapeutic option is the chimeric mouse/human anti-CD20 antibody, rituximab. Single-agent treatment with rituximab is capable of inducing CR and molecular responses (a detectable gene rearrangement converted to PCR-negativity in the peripheral blood or bone marrow following rituximab) in pretreated and previously untreated FL.24–27 Moreover, rituximab appears to exert synergistic activity with cytotoxic chemotherapy, leading to improved CR and molecular response rates.28–33 We performed a multicenter randomized trial to compare the front-line efficacy—in terms of both CR and molecular response—and toxicity of the FM and CHOP chemotherapy regimens with and without sequential immunotherapy with rituximab (elected on the basis of clinical or molecular restaging).
Eligibility Criteria and Setting All previously untreated patients presenting with FL in 15 Italian cooperative institutions (listed in the affiliations) from October 1999 until April 2002 were candidates for this open-label, randomized comparative trial. Eligibility criteria were age between 18 and 70 years; a confirmed histologic diagnosis according to the Revised European American classification34 of FL grade 1 and 2 CD20 positive; a positive PCR analysis on bone marrow (BM) and peripheral blood (PB); stage II to IV according to the Ann Arbor staging system;35 an Eastern Cooperative Oncology Group36 performance status of 0, 1, or 2; HIV negativity as tested at diagnosis; and normal renal, pulmonary and hepatic functions. All patients provided written informed consent before enrollment. The institutional review board approved the trial, which was conducted in accordance with the Declaration of Helsinki.
Treatment
FM/CHOP chemotherapy was administered in open-label fashion. The FM regimen was intravenous (IV) fludarabine 25 mg/m2 on days 1 to 3 and IV mitoxantrone 10 mg/m2 on day 1. The CHOP regimen consisted of IV doxorubicin 50 mg/m2 on day 1, IV cyclophosphamide 750 mg/m2 on day 1, IV vincristine 1.4 mg/m2 on day 1, and oral prednisone 100 mg/d on days 1 to 5. Both regimens were repeated every 21 days as dictated by peripheral blood counts and clinical circumstances, for a total of six cycles. In particular, a course of chemotherapy was postponed for 1 week in the presence of WBC < 3,000/µL and/or platelet count less than 80,000/µL.3 No dose reduction was allowed throughout the study. No patient was allowed to receive more than six cycles of chemotherapy, and patients with disease progression during treatment received fewer than six cycles. In accordance with our standard procedures for previously untreated patients, neither granulocyte colony-stimulating factor nor Pneumocystis Carinii prophylaxis was given. IV rituximab was administered at 375 mg/m2 weekly for 4 weeks; oral premedication with diphenhydramine hydrochloride and paracetamol was administered before immunotherapy.
Clinical Monitoring and Restaging Procedures Restaging evaluations were performed after both the chemotherapy and immunotherapy phases of the study. Clinical restaging was based on histologic and immunohistochemical analysis of bone marrow biopsy, hematologic, and chemical survey, chest radiograms, abdominal ultrasonography, and computed tomography of the chest and abdomen, performed in all patients. CR and PR were defined according to International Working Group Recommendations.37 Standard Eastern Cooperative Oncology Group criteria36 were used for evaluation of toxicity. Molecular staging/restaging was based on PCR analysis of the bcl-2/IgH rearrangement (described further herein), performed in all instances on both BM and PB at diagnosis. Molecular evaluations were performed at diagnosis; at 4 and 6 weeks after the final cycle of chemotherapy; at 4 weeks from completion of immunotherapy; and every 4 months during follow-up. Molecular evaluation of bcl-2/IgH rearrangement was based on qualitative PCR.38 In particular, mononuclear cells from BM and PB samples were obtained by Ficoll-Hypaque density gradient centrifugation. Genomic DNA was isolated from mononuclear cells using the QIAamp DNA mini kit (Qiagen, Hilden, Germany). DNA integrity was assessed by amplifying a 510 bp fragment of the ß-globin gene. Samples positive for ß-globin were then investigated for the bcl-2/IgH rearrangement using a nested PCR specific for major breakpoints region (MBR) and minor cluster region (mcr) breakpoints. The first round of amplification was done using 1 µg of genomic DNA and the following primers: 5'–CAGCCTTGAAACATTGATGG–3'(forward, for MBR), 5'–CGTGCTGGTACCACTCCTG–3' (forward, for mcr) and 5'–ACCTGAGGAGACGGTGACC–3' (reverse, for the J heavy consensus region). An initial denaturation step of 5 minutes at 95°C was followed by amplification for 30 cycles (denaturation: 40 seconds at 95°C; annealing: 40 seconds at 55°C (MBR) or 58°C (mcr); extension: 50 seconds at 72°C) and final extension for 7 minutes at 72°C. Reamplification of a 1 µL aliquot from a 1:50 dilution of the first PCR product was then performed using the internal primers: 5'–ATGGTGGTTTGACCTTTAG–3' (forward, for MBR), 5'–GGACCTTCCTTGGTGTGTTG–3' (forward, for mcr), 5'–ACCAGGGTCCCTTGGCCCCA–3' (reverse, for the JH consensus region), and the following PCR conditions: initial denaturation step of 5 minutes at 95°C; amplification for 35 cycles (denaturation: 40 seconds at 95°C); annealing: 40 seconds at 56°C (MBR) or 59°C (mcr); extension: 50 seconds at 72°C; final extension for 7 minutes at 72°C. All PCR experiments were performed in 50 µL final volume containing 1U of Taq Gold DNA Polymerase (PE Applied Biosystems, San Francisco, CA), 10 x PCR buffer, 100 mmol/L each dNTP, 2.5 mmol/L MgCl2, and µmol/L of each primer. All single-tube samples were tested in two independent experiments. In case of discordant results, a third independent, single-tube PCR assay was performed. A sample was scored as positive when at least two of three independent PCR assays yielded a positive result and as negative when at least two of three independent PCR assays yielded a negative result. Positive and negative controls were included in all the PCR experiments to detect contamination and to standardize PCR variations, thus avoiding false negativity due to suboptimal PCR efficiency. A patient-specific positive control was also included in every follow-up experiment to compare the bcl-2/IgH fragment length with the PCR product obtained at the time of diagnosis. Amplified products were visualized on a 2% agarose gel stained with ethidium bromide. The sensitivity of the assay for the detection of bcl-2/IgH rearrangement was routinely = 10–5.
Outcome Measures and Statistical Analysis
Of the 151 eligible patients enrolled onto the study, 140 were included in analysis (11 patients were excluded from analysis because of incorrect diagnosis [n = 3], loss to follow-up [n = 3] or protocol violations [n = 5]); of these, 72 patients were randomly allocated to FM and 68 to CHOP. These two groups were comparable in terms of stage, extranodal site involvement, B symptoms, bulky disease, age, sex distribution, and serum lactate dehydrogenase levels (Table 1). Figure 2 illustrates the flow of the patients through the study.
Response After Chemotherapy Phase Table 2 reports the clinical and molecular responses after chemotherapy with FM or CHOP. The overall clinical response rate (CR plus PR) was similar in the FM and CHOP arms (96% [69 of 72 patients] v 98% [67 of 68 patients]; P = not significant). However, the CR rate was higher in the FM arm (68% [49 of 72 patients] v 42% [29 of 68 patients]; P = .003). The rate of bcl-2/IgH negativity (at qualitative PCR) was also higher in the FM arm (47% [34 of 72 patients] v 29% [20 of 68 patients]; P = .030). A higher rate of CR with bcl-2/IgH negativity (ie, CR–) was also found in the FM arm (39% [28 of 72 patients] v 13 of 68 patients [19%]; P = .001).
Response After Immunotherapy Phase In accordance with the study design, the 95 patients (41 from the FM arm and 54 from the CHOP arm) who were CR+, PR–, or PR+ at restaging received sequential immunotherapy with rituximab. Table 3 summarizes the combined clinical and molecular responses obtained by these patients following immunotherapy. Combined clinical and molecular outcomes among the overall study population at the end of the immunotherapy phase of the study (ie, after the entire treatment schedule of FM/CHOP with and without rituximab) are reported in Table 4. On clinical grounds alone, the CR rates were similar in the FM and CHOP arms (90% [65 of 72 patients] for FM with or without rituximab v 81% [55 of 68 patients] for CHOP with and without rituximab; P = not significant). However, the final rate of combined clinical and molecular response (ie, CR–) was significantly higher in the FM arm (71% [51 of 72 patients] v 51% [35 of 68 patients]; P = .01). In the overall study population, the immunotherapy phase led to significant improvements in outcome in terms of both the CR rate (from 57% [78 of 140 patients] after chemotherapy to 86% [120 of 140 patients]; P = .000) and the combined clinical and molecular response rate (from 29% [41 of 140 patients] to 61% [86 of 140 patients]; P = .000).
Survival Analysis At a median follow-up of 19 months (range, 9 to 37 months) from the end of treatment, two patients (one from either therapeutic arm) have died as a result of disease progression, and the estimated global OS at 3 years is 94%, with a global PFS of 63% (Fig 3). The estimated 3-year RFS rate was 71% among the 28 patients who achieved combined clinical and molecular response (ie, CR–) after FM chemotherapy phase with 6 of 28 patients (21%) experiencing disease relapse; 3-year RFS was 58% with four patients (30%) experiencing disease relapse among the 13 who had CR– after CHOP (Fig 4; P = .20). The estimated 3-year RFS rates of patients who obtained CR– or only CR+ after the entire sequential treatment program (ie, FM/CHOP with or without rituximab) were 66% and 44%, respectively (P = .35; Fig 5), with no difference recorded between the two chemotherapeutic arms. Figure 6 shows the PFS curves of patients treated with FM + rituximab (71%) and patients submitted to CHOP + rituximab (54%; P = .20).
Toxicity Concerning hematologic toxicity (Table 5), no difference was observed between the two treatment arms (FM v CHOP). No instance of grade 3 to 4 anemia or thrombocytopenia was recorded. Similar percentages of grade 1 to 2 and of grade 3 to 4 neutropenia were recorded in the two arms. No cases of toxic death or of infection were reported in either treatment arm. Regarding nonhematologic toxicity, there were no instances of renal, cardiac, or hepatic toxicity in either arm. However, CHOP caused significantly higher rates (Table 5) of grade 3 to 4 nausea or vomiting, alopecia, peripheral neurologic toxicity, and constipation with respect to FM. The adverse effects related to rituximab were moderate in most patients. During the first rituximab infusion, 28 of 95 patients (29%) had grade 1 or 2 infusional reactions consisting of chills, fever, and hypotension. Subsequent rituximab infusions were well tolerated without recurrence of adverse reactions.
To our knowledge, this is the first randomized trial comparing the efficacy of a fludarabine-containing regimen with the conventional CHOP regimen in the treatment of FL. We additionally investigated the role of sequential immunotherapy with rituximab, elected on the basis of clinical and molecular restaging. In this respect, it must be emphasized that when the study was designed, most rituximab-related information was still missing, particularly its now well-known utility even in a number of CR– patients. This fact, together with a then-diffused tendency among the ethical committees in our country not to authorize its use when no means were at hand to physically measure its efficacy, forced us not to administer rituximab to CR– patients. However, this peculiarity of the study design allowed us to determine whether CR– patients not receiving rituximab fared differently from those receiving it either in CR+ or in PR. In this respect, the answer to this question appears to be no. Our results indicate that FM provides significantly better clinical and molecular responses. Furthermore, selective immunotherapy with rituximab enhanced the clinical and molecular response rates achieved after either form of chemotherapy, with the best outcomes in terms of combined clinical and molecular response being achieved in the FM arm. This Italian multicenter randomized trial was primarily designed to compare the efficacy of FM and CHOP in terms of CR and bcl-2/IgH negativity at qualitative PCR. Our results, based on a sample size providing adequate statistical power, indicate that FM regimen presents significantly better clinical CR rates (68% v 42%; P = .003) and bcl-2/IgH negativity rates (38% v 19%; P = .001) than the CHOP regimen. These findings confirm our basic hypothesis regarding the superiority of the FM regimen in terms of response. Reported CR rates after CHOP administration have previously ranged from 18% to 83%,9,10,30–33 with a few data suggesting the possibility of reaching bcl-2/IgH negativity.31,32 However, reports of FM-induced clinical and molecular responses in pretreated and previously untreated patients have been rather promising.14–18,22,23 Our results fully endorse the superiority of FM as a front-line therapy for FL, at least in terms of clinical (and molecular) response. Due to the short follow-up, our preliminary survival data do not allow us to say whether FM can provide improvements in terms of RFS and OS with respect to CHOP. It should be noted, however, that FM appears to be better tolerated than CHOP; although we observed no substantial difference between the two regimens in terms of hematologic toxicity, FM was associated with significantly less nonhematologic toxicity (nausea or vomiting, alopecia, peripheral neurologic toxicity, and constipation). A secondary aim of the study was to explore the potential of sequential immunotherapy with rituximab to improve the response obtained after front-line chemotherapy in clinical and/or molecular terms. Based on clinical/molecular restaging, rituximab was administered to those patients who had already obtained CR but not bcl-2/IgH negativity, or else a PR. The rationale for this strategy was based on a previous report that an improved molecular response can be achieved after sequential rituximab therapy.29 Globally, our data indicate that sequential rituximab is indeed capable of improving response status, both in clinical and molecular terms (ie, from PR to CR and from bcl-2/IgH positivity to negativity, respectively). It is also noteworthy that the final rate of combined clinical/molecular response (ie, CR–) was significantly higher (71% v 51%) in the FM arm. These findings indicate that FM and rituximab are a promising combination. It is currently unclear what the best timing of rituximab is with respect to FM, given that efficacy has been reported before, during, and after chemotherapy.28–30 Our sequential-administration strategy was an obligatory decision, considering that our primary end point was a direct comparison of CR rates after FM and after CHOP alone. Even though our data provide clear-cut evidence of the superiority of FM in terms of clinical response, this properly conducted randomized comparative trial does have limitations regarding its subsidiary end points. Firstly, the current lack of knowledge regarding long-term clinical value of achieving bcl-2/IgH negativity (by qualitative PCR as applied in our study, or for that matter by quantitative PCR) makes it difficult to interpret the real significance of our encouraging molecular data after FM chemotherapy and the improvements in molecular response status following sequential administration of rituximab. Another inherent study limitation regards our chosen primary end point (ie, achievement of CR after chemotherapy): long-term survival is clearly the major consideration in the treatment of FL. In this respect, our preliminary data on PFS and OS seem to considerably attenuate the enthusiasm generated by the FM regimen with or without rituximab in terms of simple response rates. However, our data lead us to propose FM as a more effective front-line chemotherapy strategy with respect to CHOP for routine first-line treatment of FL in terms of clinical (and molecular) response. Furthermore, sequential rituximab can be considered a viable treatment option to improve the quality of remission. Further studies are needed to investigate the optimal time for rituximab administration (concomitant or sequential); the role of rituximab maintenance therapy after front-line combined-treatment (chemotherapy plus rituximab); and the existence of correlations between molecular response and long-term survival.
The authors indicated no potential conflicts of interest.
Supported by a grant from Fondazione del Monte di Bologna e Ravenna. Authors' disclosures of potential conflicts of interest are found at the end of this article.
1. Horning SJ, Rosenberg SA: The natural history of initially untreated low-grade non-Hodgkin's lymphomas. N Engl J Med 311:1471–1475, 1984[Abstract] 2. Nunez G, London L, Hockenbery D, et al: Deregulated bcl-2 gene expression selectively prolongs survival of growth factor-deprived hemopoietic cell lines. J Immunol 144:3602–3610, 1990[Abstract] 3. Horning SJ: Natural history of and therapy for the indolent non-Hodgkin's lymphoma. Semin Oncol 20:75–88, 1993[Medline] 4. Young RC, Longo DL, Glatstein E, et al: The treatment of indolent lymphomas: Watchful waiting versus aggressive combined modality treatment. Semin Hematol 25:11–16, 1988[Medline] 5. McLaughlin P, Fuller LM, Velasquez WS, et al: Stage I-II follicular lymphoma treatment results for 76 patients. Cancer 58:1596–1602, 1986[CrossRef][Medline]
6. Zinzani PL, Magagnoli M, Gherlinzoni F, et al: To what extent can indolent lymphoma be considered? Results of a long term follow-up study from a single center. Haematologica 83:502–507, 1998
7. Freedman AS, Gribben JG, Neuberg D, et al: High-dose therapy and autologous bone marrow transplantation in patients with follicular lymphoma during first remission. Blood 88:2780–2786, 1996
8. Williams CD, Harrison CN, Lister TA, et al: High-dose therapy and autologous stem cell support for chemosensitive transformed low-grade follicular non-Hodgkin's lymphoma: A case-matched study for the European Bone Marrow Transplant Registry. J Clin Oncol 19:727–735, 2001 9. Dana BW, Dahlberg S, Natwani BN, et al: Long-term follow-up of patients with low-grade malignant lymphomas treated with doxorubicin-based chemotherapy or chemoimmunotherapy. J Clin Oncol 11:644–651, 1993[Abstract] 10. Cabanillas FF: Management of patients with low-grade follicular lymphoma. Am J Clin Oncol 12:81–87, 1989[Medline]
11. Redman JR, Cabanillas F, Velasquez WS, et al: Phase II trial of fludarabine phosphate in lymphoma: An effective new agent in low-grade lymphoma. J Clin Oncol 10:790–794, 1992 12. Hochster HS, Kim K, Green MD, et al: Activity of fludarabine in previously treated non-Hodgkin's lymphoma: Results of an Eastern Cooperative Oncology Group study. J Clin Oncol 10:28–32, 1992[Abstract]
13. Zinzani PL, Lauria F, Rondelli D, et al: Fludarabine: An active agent in the treatment of previously-treated and untreated low-grade non-Hodgkin's lymphoma. Ann Oncol 4:575–578, 1993 14. McLaughlin P, Hagemeister FB, Swan F, et al: Phase I study of the combination of fludarabine, mitoxantrone, and dexamethasone in low-grade lymphoma. J Clin Oncol 12:575–579, 1994[Abstract] 15. Zinzani PL, Bendandi M, Tura S: FMP regimen (fludarabine, mitoxantrone, prednisone) as therapy in recurrent low-grade non-Hodgkin's lymphoma. Eur J Haematol 55:262–266, 1995[Medline]
16. McLaughlin P, Hagemeister FB, Ramaguera JE, et al: Fludarabine, mitoxantrone, and dexamethasone: An effective new regimen for indolent lymphoma. J Clin Oncol 14:1262–1268, 1996
17. Zinzani PL, Bendandi M, Magagnoli M, et al: Fludarabine-mitoxantrone combination-containing regimen in recurrent low-grade non-Hodgkin's lymphoma. Ann Oncol 8:379–383, 1997
18. Zinzani PL, Magagnoli M, Bendandi M, et al: Efficacy of fludarabine and mitoxantrone (FN) combination regimen in untreated indolent non-Hodgkin's lymphomas. Ann Oncol 11:363–365, 2000
19. Hochster HS, Oken MM, Winter JN, et al: Phase I study of fludarabine plus cyclophosphamide in patients with previously untreated low-grade lymphoma: Results and long-term follow-up—A report from the Eastern Cooperative Oncology Group. J Clin Oncol 18:987–994, 2000
20. Flinn IW, Byrd JC, Morrison C, et al: Fludarabine and cyclophosphamide with filgrastim support in patients with previously untreated indolent lymphoid malignancies. Blood 96:71–75, 2000
21. Zinzani PL, Magagnoli M, Moretti L, et al: Randomized trial of fludarabine versus fludarabine and idarubicin as frontline treatment in patients with indolent or mantle-cell lymphoma. J Clin Oncol 18:773–779, 2000
22. Tsimberidou AM, McLaughlin P, Younes A, et al: Fludarabine, mitoxantrone, dexamethasone (FND) compared with an alternating triple therapy (ATT) regimen in patients with stage IV indolent lymphoma. Blood 100:4351–4357, 2002
23. Velasquez WS, Lew D, Grogan TM, et al: Combination of fludarabine and mitoxantrone in untreated stages III and IV low-grade lymhoma. J Clin Oncol 21:1996–2003, 2003 24. McLaughlin P, Grillo-Lopez AJ, Link BK, et al: Rituximab chimeric anti-CD20 monoclonal antibody therapy for relapsed indolent lymphoma: Half of patients respond to a four-dose treatment program. J Clin Oncol 16:2825–2833, 1998[Abstract] 25. Foran JM, Gupta RK, Cunningham D, et al: A UK multicentre phase II study of rituximab (chimaeric anti-CD20 monoclonal antibody) in patients with follicular lymphoma, with PCR monitoring of molecular response. Br J Haematol 109:81–88, 2000[CrossRef][Medline]
26. Hainsworth JD, Burrism HA, Morrissey LH, et al: Rituximab monoclonal antibody as initial systemic therapy for patients with low-grade non-Hodgkin's lymphoma. Blood 95:3052–3056, 2000
27. Colombat P, Salles G, Brousse N, et al: Rituximab (anti-CD20 monoclonal antibody) as single first-line therapy for patients with follicular lymphoma with a low tumor burden: Clinical and molecular evaluation. Blood 97:101–106, 2001
28. Czuczman MS, Grillo-Lopez AJ, White CA, et al: Treatment of patients with low-grade B-cell lymphoma with the combination of chimeric anti-CD20 monoclonal antibody and CHOP chemotherapy. J Clin Oncol 17:268–276, 1999 29. Czuczman MS, Fallon A, Mohr A, et al: Rituximab in combination with CHOP or fludarabine in low-grade lymphoma. Semin Oncol 29:36–40, 2002
30. Rambaldi A, Lazzari M, Manzoni C, et al: Monitoring of minimal residual disease after CHOP and rituximab in previously untreated patients with follicular lymphoma. Blood 99:856–862, 2002
31. Czuczman MS, Grillo-Lopez AJ, McLaughlin P, et al: Clearing of cells bearing the bcl-2 [t(14;18)] translocation from blood and marrow of patients treated with rituximab alone or in combination with CHOP chemotherapy. Ann Oncol 12:109–114, 2001
32. Lopez-Guillermo A, Cabanillas F, McDonnel TI, et al: Correlation of bcl-2 rearrangement with clinical characteristics and outcome in indolent follicular lymphoma. Blood 93:3081–3087, 1999
33. Lopez-Guillermo A, Cabanillas F, McLaughlin P, et al: The clinical significance of molecular response in indolent follicular lymphomas. Blood 91:2955–2960, 1998
34. Harris NL, Jaffe ES, Stein H, et al: A proposal for an international consensus on the classification of lymphoid neoplasms. Blood 84:1361–1392, 1994
35. Carbone PP, Kaplan HS, Musshoff K, et al: Report of the Committee on Hodgkin's Disease Staging Classification. Cancer Res 31:1860–1861, 1971 36. Oken M, Creech R, Tormey D: Toxicity and response criteria of the Eastern Cooperative Oncology Group. Am J Clin Oncol 5:649–655, 1982[Medline]
37. Cheson BD, Horning SJ, Coiffier B, et al: Report of an International Workshop to Standardize Response Criteria for Non-Hodgkin's Lymphomas. J Clin Oncol 17:1244–1253, 1999 38. Horsman DE, Gascoyne RD, Coupland RW, et al: Comparison of cytogenetic analysis, southern analysis and polymerase chain reaction for the detection of t(14;18) in follicular lymphoma. Am J Clin Pathol 103:472–477, 1995[Medline] 39. Freedman LS: Tables of the number of patients required in clinical trials using the log-rank test. Stat Med 1:121–129, 1982[Medline] 40. Kaplan EL, Meier P: Non-parametric estimation from incomplete observations. J Am Stat Assoc 53:457–481, 1958[CrossRef] 41. Peto R, Pike MC, Armitage P, et al: Design and analysis of randomized clinical trials requiring prolonged observation of each patient: II. Analysis and examples. Br J Cancer 35:1–39, 1977[Medline] 42. Mantel N, Haenszel W: Statistical aspects of the analysis of data from retrospective studies of diseases. J Natl Cancer Inst 22:209–222, 1959 Submitted July 24, 2003; accepted April 8, 2004.
This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|
|||||||||||
|
|||||||||||
|
|
Copyright © 2004 by the American Society of Clinical Oncology, Online ISSN: 1527-7755. Print ISSN: 0732-183X
|
TOP
ABSTRACT
INTRODUCTION
2 test was used according to the Mantel and Haenszel method.
