Advertisement
Journal of Clinical Oncology  
Search for:
Limit by:
  Browse by Subject or Issue
Home Search or Browse JCO My JCO Subscriptions Customer Service Site Map

Originally published as JCO Early Release 10.1200/JCO.2004.06.032 on February 17 2004

Journal of Clinical Oncology, Vol 22, No 6 (March 15), 2004: pp. 984-993
© 2004 American Society of Clinical Oncology.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gajjar, A.
Right arrow Articles by Gilbertson, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gajjar, A.
Right arrow Articles by Gilbertson, R. J.
Related Articles
Right arrowRelated Article
Right arrowRelated Editorial
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Clinical, Histopathologic, and Molecular Markers of Prognosis: Toward a New Disease Risk Stratification System for Medulloblastoma

Amar Gajjar, Roberto Hernan, Mehmet Kocak, Christine Fuller, Youngsoo Lee, Peter J. McKinnon, Dana Wallace, Ching Lau, Murali Chintagumpala, David M. Ashley, Stewart J. Kellie, Larry Kun, Richard J. Gilbertson

From the St Jude Children's Research Hospital, Memphis TN; Texas Children's Hospital, Houston TX; Royal Children's Hospital, Melbourne; and The Children's Hospital at Westmead and University of Sydney, Sydney, Australia

Address reprint requests to Richard J. Gilbertson, MD, PhD, Department of Developmental Neurobiology, St Jude Children's Research Hospital, 332 N Lauderdale St, Memphis, TN 38105; e-mail: richard.gilbertson{at}stjude.org


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 REFERENCES
 
PURPOSE: To assess the feasibility of performing central molecular analyses of fresh medulloblastomas obtained from multiple institutions and using these data to identify prognostic markers for contemporaneously treated patients.

MATERIALS AND METHODS: Ninety-seven samples of medulloblastoma were collected. Tumor content in samples was judged by frozen section review. Tumor ERBB2 protein and MYCC, MYCN, and TRKC mRNA levels were measured blind to clinical details using Western blotting and real-time polymerase chain reaction, respectively. Histopathologic and clinical review of each case was also performed. All data were subjected to independent statistical analysis.

RESULTS: Sample acquisition and analysis times ranged from 3 to 6 days. Eighty-six samples contained sufficient tumor for analysis, including 38 classic, 30 nodular desmoplastic, and 18 large-cell anaplastic (LCA) medulloblastomas. Protein and mRNA were extracted from 81 and 49 tumors, respectively. ERBB2 was detected in 40% (n = 32 of 81) of tumors, most frequently in LCA disease (P = .005), and was independently associated with a poor prognosis (P = .031). A combination of clinical characteristics and ERBB2 expression provided a highly accurate means of discriminating disease risk. One hundred percent (n = 26) of children with clinical average-risk, ERBB2-negative disease were alive at 5 years, with a median follow-up of 5.6 years, compared with only 54% for children with average-risk, ERBB2-positive tumors (n = 13; P = .0001). TRKC, MYCC, and MYCN expression and histopathologic subtype were not associated with prognosis in this study.

CONCLUSION: Central and rapid molecular analysis of frozen medulloblastomas collected from multiple institutions is feasible. ERBB2 expression and clinical risk factors together constitute a highly accurate disease risk stratification tool.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 REFERENCES
 
Medulloblastoma is a highly invasive pediatric brain tumor with a tendency to metastasize. Current therapy for this disease includes maximum surgical resection, whole-neuraxis radiation, and chemotherapy. Despite this aggressive treatment, only 60% of children with medulloblastoma will be cured, and most of these will suffer long-term side effects [1-7]. Consequently, efforts are being made to identify patients who can be cured with less intensive therapy and also to develop more effective treatments for children with resistant disease [8].

At present, children with medulloblastoma are divided into two disease risk groups [8]: Average-risk (AR) patients are those diagnosed when they are older than the age of 3 years with nonmetastatic and totally or near-totally resected (<= 1.5 cm2 on postoperative magnetic resonance imaging [MRI] scan) disease; patients not fulfilling these criteria are regarded as high-risk (HR). This clinical stratification has only proven useful as a broad guide for predicting prognosis; in particular, it does not identify the 20% to 30% of AR patients with resistant disease or the unknown number of AR patients who might be over-treated with current protocols.

In a variety of childhood malignancies, for example, neuroblastoma and leukemia, risk-adapted therapy according to both disease status and molecular profile is now considered routine [9,10]. Accurate disease risk assignment for children with medulloblastoma could also be possible using a combination of clinical and molecular prognostic markers. However, although a number of molecular prognostic markers have been proposed for medulloblastoma, none have been validated for routine clinical use [11,12]. Therefore, studies to be conducted by the Children's Oncology Group (COG) and the International Society of Pediatric Oncology (SIOP) over the next several years will prospectively evaluate the survival significance of molecular prognostic markers among children with medulloblastoma. The success of these studies will depend on their ability to collect and process high-quality fresh tumor material from patients; however, the feasibility of undertaking such a study has never been demonstrated.

Here, we report the results of a pilot study that was designed to assess the feasibility of collecting a large cohort of high-quality, snap-frozen medulloblastomas from patients treated in multiple institutions, rapidly conducting central molecular and pathologic analyses of these tumors, and using these data to identify valuable molecular markers for medulloblastoma patients treated in the modern era.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 REFERENCES
 
Tumor Tissue Collection, Shipment, and Processing
With institutional review board approval and after obtaining signed informed consent, we obtained 97 samples of fresh-frozen primary childhood (<= 19 years) medulloblastoma, from children diagnosed between 1984 and 2002 at St Jude Children's Research Hospital (SJCRH), Memphis, TN; Texas Children's Hospital, Houston, TX; Royal Children's Hospital, Melbourne, Australia; and The Children's Hospital at Westmead, Sydney, Australia. Forty-one percent of samples (n = 40) were collected prospectively within the context of a multi-institutional trial (SJMB96 [13]). The remaining samples were obtained from the SJCRH tumor bank. Samples were snap-frozen at the time of primary surgical resection and stored at -80°C until shipment on dry ice to the study reference laboratory at SJCRH. All samples were de-identified by assignment of a study number. Laboratory staff and the study neuropathologist (C.F.) were masked to all patient clinical details.

After weighing (performed rapidly to avoid thawing), frozen sections were made from each sample and examined by light microscopy to ensure that >= 80% consisted of tumor. Samples containing sufficient tumor material for further analysis were then divided in two and total protein and RNA extracted by sonication in protein lysis buffer [14] and homogenization in Trizol (Invitrogen, Carlsbad, CA) reagent [15], respectively. The extraction of protein was prioritized in small samples (< 70 mg). The amount and quality of RNA extracted from each sample was assessed spectrophotometrically. The total amount of protein in each tumor lysate was measured using the BCA protein assay kit (Pierce Biotechnology, Rockford, IL). RNA and protein extracts were stored at -80°C before analysis. Formalin-fixed paraffin-embedded samples of each tumor were also collected and subjected to central histopathology review by a single neuropathologist (C.F). Tumors were classified as either classic (C), nodular desmoplastic (ND), or large-cell anaplastic (LCA) [16]. The clinical details of each patient in the study cohort were reviewed by a single neuro-oncologist (A.G.) who was masked to all histopathologic and molecular analyses.

Western Blotting
ERBB2 protein expression in tumor samples was determined by Western blot analysis. One hundred micrograms of each protein lysate was analyzed using standard techniques and the anti-ERBB2 mouse monoclonal antibody NCL-CB11 (NovaCastra, Newcastle-on-Tyne, United Kingdom) as described [17]. The ERBB2-expressing Daoy medulloblastoma cell line [15] was used as a positive control for ERBB2 expression. Membranes were reprobed with an antibody for beta-actin (Sigma Chemicals, St Louis, MS) to control for protein loading and transfer. Tumors were scored as positive or negative for ERBB2 expression.

Real-Time Polymerase Chain Reaction
TRKC, MYCC, and MYCN transcript expression levels were measured in tumor samples by real-time polymerase chain reaction (PCR) analysis. Real-time PCR was conducted using the TaqMan One Step PCR Master Mix Reagents Kit (Applied Biosystems, Foster City, CA) and a 7900HT Sequence Detection System (Applied Biosystems). Oligonucleotide primers and a TaqMan probe for each gene were designed using Primer Express v2.0 software (Applied Biosystems). Primer/TaqMan probe sets were as follows: (1) TRKC (forward, cgtccgcgatggtttca; reverse, tccgatcgctgcttctttg; probe, tttgcatctgatcgctcggcgtt); (2) MYCC (forward, cgtctccacacatcagcacaa; reverse, gacactgtccaacttgaccctctt; probe, cctccactcggaaggactatcctgctg); (3) MYCN (forward, cgggcatgatctgcaagaa; reverse, atcttcgtccgggtagaagca; probe, ccagacctcgagtttgactcgctacagc); all from Applied Biosystems. The expression level of each transcript was normalized to that of 18S rRNA (primers and probe from Applied Biosystems) that was used as an internal standard. Real-time PCR data were analyzed using SDS version 2.0 software (Applied Biosystems). Total adult and fetal human brain RNA (Ambion, Austin, TX) were used to generate standard curves for relative quantitation. The specificity of each primer set for the respective target sequence was confirmed by sequence analysis of cDNA generated from total human RNA and RNA from the Daoy and MHH-MED-1 medulloblastoma cell lines [18].

Statistical Analysis
The results of all molecular and histopathology studies and central clinical review were submitted for analysis to the Department of Biostatistics (SJCRH) via a secure electronic database. Associations among clinical features (patient sex, age at diagnosis, metastatic disease stage, extent of surgical resection, and clinical risk group), tumor histopathology, and molecular characteristics (ERBB2, TRKC, MYCC, and MYCCN expression) were investigated using Fisher's exact tests or {chi}2 tests. Progression-free survival (PFS) was measured from the date of diagnosis to the date of first progression (or death, whichever came first) or last contact. Overall survival (OS) was measured from the date of diagnosis to death or last contact. One patient who died as a result of a second malignancy was censored at the date of death in the estimation of PFS but is considered a failure at this date in the OS estimation. Distributions of PFS and OS were estimated using Kaplan-Meier methods [19]; associated SEs and P values were calculated as described by Peto and Pike [20] and by using the Mantel-Haenszel statistic [21], respectively. We determined the independent prognostic value of each molecular characteristic and histopathology using two separate methods. First, we performed a stratified analysis in which the patients were grouped as follows: strata I (age at diagnosis < 3 years), strata II (age at diagnosis >= 3 years, no metastatic disease, treated on SJMB96), strata III (age at diagnosis >= 3 years, no metastatic disease, treated before SJMB96), strata IV (age at diagnosis >= 3 years, metastatic disease, treated on SJMB96), and strata V (age at diagnosis >= 3 years, metastatic disease, treated before SJMB96). The degree of surgical resection was not a significant prognostic factor among patients in the current study and so was not used as an indicator for stratification. Significance levels for these comparisons were based on stratified exact log-rank tests or Monte Carlo estimates of the exact log-rank test as implemented in StatXact (Cytel Software Corporation, Cambridge, MA). Stratified Cox proportional hazards regression models [22] were also performed to assess the prognostic impact of the continuous form of TRKC, MYCC, and MYCN expression on PFS.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 REFERENCES
 
Tissue Accrual, Quality, and Processing Time
No adverse delays or problems in the shipment of tissues from institutions both within and outside the United States were encountered during the study. The mean frozen weight of the 97 tumor samples was 410 mg (range, 17 to 1,800 mg). Eighty-nine percent (n = 86, designated as the study cohort) of samples were judged by frozen-section review to contain adequate tumor material for further analysis. Protein was successfully extracted for Western blot analysis from 94% of these (n = 81). The total amount of protein extracted ranged from 350 µg to greater than 2 mg, with a mean of 1 mg. Seventy-six samples contained sufficient material to attempt RNA extraction. High-quality RNA was obtained from 64% of these (n = 49); the amount of RNA extracted ranged from 130 µg to 320 µg, with a mean of 180 µg (average 260:280 ratio, 1.9). The total time taken to acquire, ship, and complete all molecular analyses ranged from a minimum of 3 days for samples originating within SJCRH to a maximum of 6 days for samples from Australian institutions.

Clinical Characteristics of the Study Cohort
Seventy-nine percent (n = 68) of the 86 patients in the study cohort were diagnosed after 1990. Twenty-six percent of patients (n = 22) have died from their disease. The median follow-up time for surviving patients was 3.7 years (range, 0.3 to 16.3 years); 90% of these patients were seen within 12 months of study analysis.

The clinical details of patients from whom study samples were obtained are summarized in Figure 1. Seventeen percent (n = 15), 47% (n = 40), and 36% (n = 31) of patients were younger than 3 years, >= 3 to less than 8 years, and >= 8 years at the time of diagnosis, respectively. Sixty-four percent (n = 55) of patients were male. Eighty-three percent (n = 71) of patients underwent a total resection of their tumor (assessed by postoperative MRI scan). Metastasis stage was assessed in all patients by a combination of brain and spine MRI imaging with gadolinium enhancement and lumbar CSF sampling. Fifty-eight percent (n = 50), 8% (n = 7), 7% (n = 6), and 27% (n = 23) of patients had M0, M1, M2, and M3 stage disease, respectively. Overall, 42% (n = 36) and 58% (n = 50) of patients were classified as average and high-risk, respectively. This selection bias in favor of high-risk patients occurred solely as a consequence of tissue availability. One patient in the study cohort died of disease before receiving radiation therapy, and one patient diagnosed before the age of 3 years remains alive and disease-free after chemotherapy alone. The remaining 84 patients in the study cohort all received standard neuraxis radiation therapy and chemotherapy; 47% of these (n = 40) were treated on a single protocol (SJMB 96 [13]).



View larger version (44K):
[in this window]
[in a new window]
 
Fig 1. Patient clinical characteristics and tumor ERBB2 expression. Study patients are shown grouped according to ERBB2 expression within average- and high-risk categories. Pathology (path; white square, classic; orange square, nodular desmoplastic; red square, large-cell anaplastic); protocol (green square, SJMB96; blue square, other); metastatic (M) stage (white square, M0; yellow square, M1; orange square, M2; red square, M3); and surgery (white square, total resection; red square, partial resection). ERBB2 Western blot of each tumor is shown below. na = ERBB2 not analyzed. M, male; F, female.

 
Tumor Histopathology and Molecular Characteristics
All patients in the study cohort had a histologic diagnosis of medulloblastoma. Forty-four percent (n = 38), 35% (n = 30), and 21% (n = 18) of tumors displayed C, ND, and LCA morphology, respectively (Fig 1). These frequencies are quite similar to those recently reported among a series of 330 pediatric medulloblastomas [23]. We detected ERBB2 protein expression by Western blot analysis in 40% of tumors (n = 32 of 81; Fig 1). The results of TRKC, MYCC, and MYCN expression levels are summarized in Figure 2. The median TRKC, MYCC, and MYCN expression levels among tumor samples were 1.88 (range, 0.03 to 15.9), 3.69 (range, 0.48 to 69.5), and 27.1 (range, 0.0 to 694.0) respectively.



View larger version (38K):
[in this window]
[in a new window]
 
Fig 2. Clinical characteristics and tumor TRKC, MYCC, and MYCN expression. Bar graphs report relative tumor TRKC, MYCC, and MYCN mRNA expression levels. Patient numbers, clinical details, and ERBB2 expression (white square, ERBB2-negative; red square, ERBB2-positive) correspond with those shown in Fig 1.

 
Relationships Among Clinical, Histopathologic, and Molecular Variables
High-risk patients with LCA tumors were significantly more likely to present with M3 stage disease (Fig 1; P = .043). LCA tumors were also more likely to express ERBB2 compared with C or ND disease (ERBB2 expression, LCA = 12 of 32 v C and ND = five of 49; P = .005). No other significant relationships were observed among the clinical, histopathologic, and molecular variables measured in this study.

Univariate Survival Analysis of Clinical, Histopathologic, and Molecular Disease Features
Advanced metastatic disease stage, presentation before 3 years of age, and HR disease were each associated with a reduced PFS (Table 1 and Figs. 3A, 3B, and 3C). Although a trend toward a worse clinical outcome was seen among 15 patients whose tumors were partially resected, this did not reach significance. Patients treated within the SJMB96 trial achieved superior PFS when compared with children treated on other protocols (Fig 3D). SJMB96 excluded patients who were younger than 3 years of age at diagnosis; nevertheless, the survival advantage afforded by SJMB96 was retained even when the analysis was restricted to patients aged >= 3 years at diagnosis (Table 1).


View this table:
[in this window]
[in a new window]
 
Table 1. 5-Year Survival Significance of Clinical and Molecular Markers

 


View larger version (22K):
[in this window]
[in a new window]
 
Fig 3. Progression-free survival analyses of clinical variables and ERBB2 tumor expression. Analyses include (A) patient age, (B) metastatic stage, (C) clinical risk group, (D) treatment protocol, and (E) ERBB2 expression. Patient numbers in each group and the P values for the survival differences between groups are shown. ys, years.

 
Tumor expression of the ERBB2 receptor was associated with a significantly worse OS and PFS (Table 1 and Fig 3E). The 5-year PFS rate of all patients (AR and HR) with ERBB2-negative tumors (n = 49) was 72% (SE 10%), compared with only 42% (SE 12%) for patients with ERBB2-expressing disease (n = 32; P = .019). A trend toward a worse PFS was observed among patients with LCA medulloblastoma; however, this did not reach significance (Table 1). Neither TRKC, MYCC, nor MYCN expression (analyzed in both continuous and categoric form) were associated with PFS or OS in the current study (Table 1).

Toward a New Disease Risk Stratification System for Medulloblastoma
Our data confirm that, when applied in isolation, clinical and molecular markers provide an imprecise prediction of prognosis among patients with medulloblastoma. In this regard, although ERBB2-negative and nonmetastatic disease were each associated with a relatively favorable disease risk, the PFS of patients within these disease groups is only approximately 70% at 5 years (Table 1 and Figs. 3B and 3E). We reasoned that a combination of ERBB2 expression status and clinical factors might allow a more accurate assessment of disease risk. To test this hypothesis, we first used exact stratified log-rank analysis to determine the independent prognostic significance of ERBB2 expression relative to important clinical covariables (age, M stage, and treatment protocol). Patients whose tumors expressed the ERBB2 receptor had a significantly worse OS (stratified exact log-rank P = .042) and PFS (stratified exact log-rank P = .031) independent of patient age, M stage, or treatment protocol.

Next, to determine whether a combination of clinical variables and ERBB2 expression might improve disease risk classification for medulloblastoma, we estimated the OS and PFS among patients divided into four groups based on age, M stage, and ERBB2 expression status (Fig 4): group 1 (>= 3 years, M0, ERBB2-negative, n = 26); group 2 (>= 3 years, M0, ERBB2-positive, n = 13); group 3 (>= 3 years, M1 to M3, ERBB2-negative, n = 16); group 4 (>= 3 years, M1 to M3 and ERBB2-positive, n = 11). The difference in OS (P = .001; 95% CI, .0002 to .0018) and PFS (P = .0006; 95% CI, .0000 to .0012) among these four groups was highly significant. Only one patient in group 1 has experienced disease progression so far, and none of these patients have died from their disease, with a median follow-up time of 5.6 years. Of particular note, 46% of patients in group 2 suffered disease progression within 5 years of diagnosis, and four of these patients have died of their disease. This is especially significant because all patients in group 2 underwent total resection of their tumors and would therefore be classified as AR by current criteria.



View larger version (15K):
[in this window]
[in a new window]
 
Fig 4. Overall survival analysis of patients stratified using a combination of clinical variables and ERBB2 tumor expression. Patients were divided into four groups (see Results, under Toward a New Disease Risk Stratification System for Medulloblastoma). Kaplan-Meier survival curves illustrate the difference in overall survival between the four groups. P value describes the level of significance of the survival difference among the groups.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 REFERENCES
 
Previous studies of molecular prognostic markers for medulloblastoma have included insufficient numbers of homogeneously treated patients to allow rigorous survival analysis. Furthermore, the majority of these have used fixed tumor material in which specific protein and RNA transcript levels cannot be accurately quantified. Therefore, the next multi-institutional medulloblastoma clinical trials to be conducted by SIOP and COG will prospectively evaluate the survival significance of a large number of molecular prognostic markers analyzed in fresh tumor material. The current pilot study provides the first evidence that such studies are feasible.

We were able to collect a large number of fresh-frozen medulloblastomas from multiple institutions within the United States and Australia and successfully ship these to a central reference laboratory. In addition, we show that virtually all samples of medulloblastoma collected in this manner yield large quantities (mean, 1 mg) of protein that is suitable for Western blot analysis. Western blotting allows accurate quantitation of specific protein expression levels. The quantity of protein extracted from tumors in the current study would allow analysis of up to forty separate antigens (10 blots each reprobed times four). We further show that RNA can be successfully retrieved from at least 64% of samples in which this is attempted. This may well be an underestimate of RNA yields from medulloblastoma. RNA is a relatively unstable biologic macromolecule. Tumor samples must be rapidly frozen in liquid nitrogen after surgery if RNA is to be preserved. Fifty-nine percent of samples in the current study were collected retrospectively from an existing tumor bank; this material may not have been collected under optimal conditions for RNA analysis. It is likely that larger amounts of RNA might be obtained from samples that are collected as part of prospective clinical trials that are specifically designed to conduct molecular analyses. Nevertheless, the RNA extracted from tumor samples in the current study was suitable for real-time PCR, Northern blot, and Affymetrix (Santa Clara, CA) microarray analysis (latter two techniques not shown here). The data generated using these techniques provide comprehensive information regarding genome-wide expression patterns in primary medulloblastoma samples.

The use of molecular prognostic markers to guide treatment decisions in the future will dictate that they can be analyzed rapidly within a clinically useful timeframe. Our data demonstrate that fresh-frozen medulloblastoma material can be shipped to a central reference laboratory and subjected to comprehensive histopathologic and molecular studies in less than 1 week. Although our study involved the recruitment of both retrospective (banked) and prospective clinical material, the data are encouraging. We hope that this study will increase enthusiasm among pediatric oncology centers to participate in future multi-institutional molecular studies and rapidly refer tumor material to reference laboratories.

A further specific aim of this study was to investigate the feasibility of using centrally collected pathologic and molecular data to identify prognostic markers for medulloblastoma. A recent Pediatric Oncology Group study of 330 childhood medulloblastomas identified tumor anaplasia as a marker of poor prognosis [23]. Twenty-four percent of tumor samples in this Pediatric Oncology Group study displayed significant anaplasia; patients with this histologic variant had a 5-year survival probability of only 42%, compared with 68% for patients with nonanaplastic disease (P < .0001). In agreement with these data, 21% of tumors (n = 18) in our study were classified as LCA, and patients with these tumors had a 5-year PFS rate of 42%, compared with 63% among patients with C or ND disease. Although this comparison did not reach statistical significance, HR patients with LCA tumors in our study were significantly more likely to present with M3 stage disease (P = .043), and ERBB2 expression was more common among LCA tumors (P = .005). Therefore, our data support the hypothesis that the LCA variant represents an especially aggressive form of medulloblastoma. Furthermore, they implicate ERBB2 oncogene in the formation of LCA disease. Histopathologic review of medulloblastomas derived from patients treated within large-scale clinical trials will be required to establish further the molecular basis of LCA and to validate the clinical significance of this medulloblastoma variant.

The prognostic significance of ERBB2 protein was also assessed in this pilot study. ERBB2 is a potent oncogene in cell culture [24-27] and transgenic models of cancer [28,29], and overexpression of this receptor tyrosine kinase is associated with a poor clinical outcome in a number of human malignancies [30]. In three separate immunohistochemical analyses of more than 100 pediatric medulloblastomas, we previously demonstrated ERBB2 protein expression in approximately 80% of tumor samples [14,31,32]. Within each study, a significantly worse prognosis was observed among patients whose tumors exhibited high ERBB2 immunoreactivity (>= 50% immunopositive tumor cells; approximately 40% of all cases). The data in the current study confirm that ERBB2 protein is expressed to high levels in approximately 40% of medulloblastomas and that this expression is significantly associated with a poor clinical outcome.

Molecular prognostic markers will only be useful if they provide survival information in addition to that already afforded by existing clinical predictors. Importantly, the current study demonstrates that a combination of molecular and clinical variables affords a more accurate means of predicting disease risk than either of these alone. In this regard, we show tumor ERBB2 expression has prognostic significance independent of patient clinical characteristics. Specifically, we have observed no deaths among children with clinical AR, ERBB2-negative medulloblastoma at a median follow-up of time of 5.6 years. This is in contrast with a 5-year OS rate of only 54% among children with clinical AR, ERBB2-positive tumors. Confirmation of these data in a large prospective clinical trial would provide a precise tool for rapidly and accurately assigning treatment intensity.

Finally, we also measured the tumor expression levels and prognostic significance of MYCC, MYCN, and TRKC that have also been proposed as prognostic markers for medulloblastoma [8,11,12]. MYCC operates within the MYCC/MAD/MAX network to modulate cell cycle progression, differentiation, and apoptosis [33]. Oncogenic activation of MYCC occurs through a variety of mechanisms that include gene amplification, transcript stabilization, and enhanced translation [33]. MYCC and the related gene MYCN are amplified in less than 10% of medulloblastomas, the majority of which are LCA tumors [34,35]. However, MYCC mRNA is overexpressed in a much greater proportion of medulloblastomas independent of gene amplification and has been associated with a poor prognosis [36,37]. TRKC is one of three high-affinity neurotrophin receptors that promote neuron growth, differentiation, and survival [38]. Elevated tumor TRKC mRNA levels have been associated with a favorable prognosis in medulloblastoma [39,40]. Although our data confirm that MYCC, MYCN, and TRKC transcripts are readily detectable in medulloblastoma, none of these were correlated with clinical outcome. Interstudy variability in the significance of molecular prognostic markers may result for a variety of reasons, including the use of different experimental methodologies and small study sample sizes. Indeed, while we used highly quantitative real-time PCR analysis to measure MYCC, MYCN, and TRKC mRNA levels in fresh tumor material, previous studies of medulloblastoma have used semi-quantitative multiplex PCR and in situ hybridization of fixed tissues to measure these transcripts [36,37,39,40]. Further, our analysis of MYCC, MYCN, and TRKC was restricted to 49 cases that yielded sufficient RNA. This small sample size does not possess sufficient power to discount these variables as important prognostic markers for medulloblastoma. Together, these data further emphasize that central analysis of medulloblastomas derived from patients treated within large-scale clinical trials will be required for molecular prognostic markers to be validated.

Children who survive medulloblastoma suffer a loss of normal-appearing white matter [41], an associated decline in intellectual function [42,43], and long-term endocrine deficiencies [44]. These adverse effects, which are particularly severe in young patients [45,46], are largely the result of neuraxis radiation therapy. Adjuvant chemotherapy allows standard neuraxis radiation for medulloblastoma to be reduced from 36 Gy to 23.4 Gy without affecting cure rates [47]. However, a dose of 23.4 Gy is still associated with significant neurotoxicity [2]. Consequently, the COG is planning a phase III trial in which children between the ages of 3 and 8 years with newly diagnosed AR medulloblastoma will be randomly assigned to receive either 18 Gy or 23.4 Gy of neuraxis radiation. These additional reductions in radiation treatment may decrease morbidity among surviving patients; however, it remains unclear whether this will occur at the expense of disease control. An improved method for predicting disease risk among patients with medulloblastoma, including the use of molecular prognostic markers, might provide a more precise tool for selecting patients in whom treatment intensity could be safely reduced. This pilot study provides key data that the central collection and rapid molecular analysis of snap-frozen medulloblastomas from multiple institutions is highly feasible. This study should encourage institutions that participate in forthcoming medulloblastoma clinical trials (eg, SIOP and COG) to submit tissue for central analysis. It is hoped that these studies will ultimately identify a definitive clinical and molecular disease risk stratification system for medulloblastoma.


    Authors' Disclosures of Potential Conflicts of Interest
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 REFERENCES
 
The authors indicated no potential conflicts of interest.


    NOTES
 
Supported by Center of Research Excellence support grant no. CA 21765, American Lebanese Syrian Associated Charities, and V Foundation for Cancer Research, Cary, NC.

Authors' disclosures of potential conflicts of interest are found at the end of this article.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 REFERENCES
 
1. Zeltzer PM, Boyett JM, Finlay JL, et al: Metastasis stage, adjuvant treatment, and residual tumor are prognostic factors for medulloblastoma in children: Conclusions from the Children's Cancer Group 921 randomized phase III study. J Clin Oncol 17:832-845, 1999[Abstract/Free Full Text]

2. Ris MD, Packer R, Goldwein J, et al: Intellectual outcome after reduced-dose radiation therapy plus adjuvant chemotherapy for medulloblastoma: A Children's Cancer Group study. J Clin Oncol 19:3470-3476, 2001[Abstract/Free Full Text]

3. Schwartz CL: Long-term survivors of childhood cancer: The late effects of therapy. Oncologist 4:45-54, 1999[Abstract/Free Full Text]

4. Grill J, Renaux VK, Bulteau C, et al: Long-term intellectual outcome in children with posterior fossa tumors according to radiation doses and volumes. Int J Radiat Oncol Biol Phys 45:137-145, 1999[CrossRef][Medline]

5. Packer RJ: Childhood medulloblastoma: Progress and future challenges. Brain Dev 21:75-81, 1999[CrossRef][Medline]

6. Kortmann RD, Kuhl J, Timmermann B, et al: Postoperative neoadjuvant chemotherapy before radiotherapy as compared to immediate radiotherapy followed by maintenance chemotherapy in the treatment of medulloblastoma in childhood: Results of the German prospective randomized trial HIT '91. Int J Radiat Oncol Biol Phys 46:269-279, 2000[CrossRef][Medline]

7. Taylor RE, Bailey CC, Robinson K, et al: Results of a randomized study of preradiation chemotherapy versus radiotherapy alone for nonmetastatic medulloblastoma: The International Society of Paediatric Oncology/United Kingdom Children's Cancer Study Group PNET-3 Study. J Clin Oncol 21:1581-1591, 2003[Abstract/Free Full Text]

8. Ellison DW, Clifford SC, Gajjar A, et al: What's new in neuro-oncology? Recent advances in medulloblastoma. Eur J Paediatr Neurol 7:53-66, 2003[CrossRef][Medline]

9. Rubnitz JE, Pui CH: Recent advances in the treatment and understanding of childhood acute lymphoblastic leukaemia. Cancer Treat Rev 29:31-44, 2003[CrossRef][Medline]

10. Brodeur GM: Neuroblastoma: Biological insights into a clinical enigma. Nat Rev Cancer 3:203-216, 2003[CrossRef][Medline]

11. Ellison D: Classifying the medulloblastoma: Insights from morphology and molecular genetics. Neuropathol Appl Neurobiol 28:257-282, 2002[CrossRef][Medline]

12. Gilbertson R: Paediatric embryonic brain tumours: Biological and clinical relevance of molecular genetic abnormalities. Eur J Cancer 38:675-685, 2002

13. Strother D, Ashley D, Kellie SJ, et al: Feasibility of four consecutive high-dose chemotherapy cycles with stem-cell rescue for patients with newly diagnosed medulloblastoma or supratentorial primitive neuroectodermal tumor after craniospinal radiotherapy: Results of a collaborative study. J Clin Oncol 19:2696-2704, 2001[Abstract/Free Full Text]

14. Gilbertson RJ, Perry RH, Kelly PJ, et al: Prognostic significance of HER2 and HER4 coexpression in childhood medulloblastoma. Cancer Res 57:3272-3280, 1997[Abstract/Free Full Text]

15. Hernan R, Fasheh R, Calabrese C, et al: ERBB2 up-regulates S100A4 and several other prometastatic genes in medulloblastoma. Cancer Res 63:140-148, 2003[Abstract/Free Full Text]

16. Kleihues P, Louis DN, Scheithauer BW, et al: The WHO classification of tumors of the nervous system. J Neuropathol Exp Neurol 61:215-225, 2002[Medline]

17. Gilbertson RJ, Bentley L, Hernan R, et al: ERBB receptor signaling promotes ependymoma cell proliferation and represents a potential novel therapeutic target for this disease. Clin Cancer Res 8:3054-3064, 2002[Abstract/Free Full Text]

18. Gilbertson R, Hernan R, Pietsch T, et al: Novel ERBB4 juxtamembrane splice variants are frequently expressed in childhood medulloblastoma. Genes Chromosomes Cancer 31:288-294, 2001[CrossRef][Medline]

19. Kaplan EL, Meier P: Nonparametric estimation from incomplete observations. J Am Stat Assoc 53:457-481, 1958[CrossRef]

20. Peto R, Peto J: Asymptotically efficient rank invariant procedures (with discussion). J R Stat Soc A 185-206, 1972

21. Mantel N, Haenszel W: Statistical aspects of the analysis of data from retrospective studies of disease. J Natl Cancer Inst 22:719-748, 1958

22. Cox DR: Regression models and life tables. J R Stat Soc B 34:187-229, 1972

23. Eberhart CG, Kepner JL, Goldthwaite PT, et al: Histopathologic grading of medulloblastomas: A Pediatric Oncology Group study. Cancer 94:552-560, 2002[CrossRef][Medline]

24. Bargmann CI, Weinberg RA: Increased tyrosine kinase activity associated with the protein encoded by the activated neu oncogene. Proc Natl Acad Sci U S A 85:5394-5398, 1988[Abstract/Free Full Text]

25. Di Marco E, Pierce JH, Knicley CL, et al: Transformation of NIH 3T3 cells by overexpression of the normal coding sequence of the rat neu gene. Mol Cell Biol 10:3247-3252, 1990[Abstract/Free Full Text]

26. Di Fiore PP, Pierce JH, Kraus MH, et al: ErbB-2 is a potent oncogene when overexpressed in NIH/3T3 cells. Science 237:178-182, 1987[Abstract/Free Full Text]

27. Zhang K, Sun J, Liu N, et al: Transformation of NIH 3T3 cells by HER3 or HER4 receptors requires the presence of HER1 or HER2. J Biol Chem 271:3884-3890, 1996[Abstract/Free Full Text]

28. Muller WJ, Sinn E, Pattengale PK, et al: Single-step induction of mammary adenocarcinoma in transgenic mice bearing the activated c-neu oncogene. Cell 54:105-115, 1988[CrossRef][Medline]

29. Guy CT, Webster MA, Schaller M, et al: Expression of the neu protooncogene in the mammary epithelium of transgenic mice induces metastatic disease. Proc Natl Acad Sci U S A 89:10578-10582, 1992[Abstract/Free Full Text]

30. Yarden Y, Sliwkowski MX: Untangling the ErbB signaling network. Nat Rev Mol Cell Biol 2:127-137, 2001[CrossRef][Medline]

31. Gilbertson RJ, Jaros EB, Perry RH, et al: Prognostic factors in medulloblastoma. Lancet 340:480, 1992[CrossRef][Medline]

32. Gilbertson R, Wickramasinghe C, Hernan R, et al: Clinical and molecular stratification of disease risk in medulloblastoma. Br J Cancer 85:705-712, 2001[CrossRef][Medline]

33. Pelengaris S, Khan M, Evan G: C-MYC: More than just a matter of life and death. Nat Rev Cancer 2:764-776, 2002[CrossRef][Medline]

34. Brown HG, Kepner JL, Perlman EJ, et al: "Large cell/anaplastic" medulloblastomas: A Pediatric Oncology Group Study. J Neuropathol Exp Neurol 59:857-865, 2000[Medline]

35. Eberhart CG, Kratz JE, Schuster A, et al: Comparative genomic hybridization detects an increased number of chromosomal alterations in large cell/anaplastic medulloblastomas. Brain Pathol 12:36-44, 2002[Medline]

36. Herms J, Neidt I, Luscher B, et al: C-MYC expression in medulloblastoma and its prognostic value. Int J Cancer 89:395-402, 2000[CrossRef][Medline]

37. Grotzer MA, Hogarty MD, Janss AJ, et al: MYC messenger RNA expression predicts survival outcome in childhood primitive neuroectodermal tumor/medulloblastoma. Clin Cancer Res 7:2425-2433, 2001[Abstract/Free Full Text]

38. Bibel M, Barde YA: Neurotrophins: Key regulators of cell fate and cell shape in the vertebrate nervous system. Genes Dev 14:2919-2937, 2000[Free Full Text]

39. Kim JY, Sutton ME, Lu DJ, et al: Activation of neurotrophin-3 receptor TrkC induces apoptosis in medulloblastomas. Cancer Res 59:711-719, 1999[Abstract/Free Full Text]

40. Grotzer MA, Janss AJ, Fung K, et al: TrkC expression predicts good clinical outcome in primitive neuroectodermal brain tumors. J Clin Oncol 18:1027-1035, 2000[Abstract/Free Full Text]

41. Palmer SL, Reddick WE, Glass JO, et al: Decline in corpus callosum volume among pediatric patients with medulloblastoma: Longitudinal MR imaging study. AJNR Am J Neuroradiol 23:1088-1094, 2002[Abstract/Free Full Text]

42. Palmer SL, Goloubeva O, Reddick WE, et al: Patterns of intellectual development among survivors of pediatric medulloblastoma: A longitudinal analysis. J Clin Oncol 19:2302-2308, 2001[Abstract/Free Full Text]

43. Mulhern RK, Palmer SL, Reddick WE, et al: Risks of young age for selected neurocognitive deficits in medulloblastoma are associated with white matter loss. J Clin Oncol 19:472-479, 2001[Abstract/Free Full Text]

44. Heikens J, Michiels EM, Behrendt H, et al: Long-term neuro-endocrine sequelae after treatment for childhood medulloblastoma. Eur J Cancer 34:1592-1597, 1998

45. Silber JH, Radcliffe J, Peckham V, et al: Whole-brain irradiation and decline in intelligence: The influence of dose and age on IQ score. J Clin Oncol 10:1390-1396, 1992[Abstract/Free Full Text]

46. Walter AW, Mulhern RK, Gajjar A, et al: Survival and neurodevelopmental outcome of young children with medulloblastoma at St Jude Children's Research Hospital. J Clin Oncol 17:3720-3728, 1999[Abstract/Free Full Text]

47. Packer RJ, Goldwein J, Nicholson HS, et al: Treatment of children with medulloblastomas with reduced-dose craniospinal radiation therapy and adjuvant chemotherapy: A Children's Cancer Group Study. J Clin Oncol 17:2127-2136, 1999[Abstract/Free Full Text]

Submitted June 9, 2003; accepted August 25, 2003.


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Facebook Facebook   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?

Related Article

  • Combining Gene Expression Profiles and Clinical Parameters for Risk Stratification in Medulloblastomas
    Ana Fernandez-Teijeiro, Rebecca A. Betensky, Lisa M. Sturla, John Y.H. Kim, Pablo Tamayo, and Scott L. Pomeroy
    JCO 2004 22: 994-998 [Abstract] [Full Text]

Related Editorial

  • Biologic Risk Stratification of Medulloblastoma: The Real Time Is Now
    Paul Graham Fisher, Peter C. Burger, and Charles G. Eberhart
    JCO 2004 22: 971-974 [Full Text]


This article has been cited by other articles:


Home page
JCOHome page
S. Pfister, M. Remke, A. Benner, F. Mendrzyk, G. Toedt, J. Felsberg, A. Wittmann, F. Devens, N. U. Gerber, S. Joos, et al.
Outcome Prediction in Pediatric Medulloblastoma Based on DNA Copy-Number Aberrations of Chromosomes 6q and 17q and the MYC and MYCN Loci
J. Clin. Oncol., April 1, 2009; 27(10): 1627 - 1636.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
T. Klatte, D. B. Seligson, J. LaRochelle, B. Shuch, J. W. Said, S. B. Riggs, N. Zomorodian, F. F. Kabbinavar, A. J. Pantuck, and A. S. Belldegrun
Molecular Signatures of Localized Clear Cell Renal Cell Carcinoma to Predict Disease-Free Survival after Nephrectomy
Cancer Epidemiol. Biomarkers Prev., March 1, 2009; 18(3): 894 - 900.
[Abstract] [Full Text] [PDF]


Home page
Neuro OncolHome page
D. Meco, T. Servidei, A. Riccardi, C. Ferlini, G. Cusano, G. F. Zannoni, F. Giangaspero, and R. Riccardi
Antitumor effect in medulloblastoma cells by gefitinib: Ectopic HER2 overexpression enhances gefitinib effects in vivo
Neuro-oncol, January 1, 2009; 11(3): 250 - 259.
[Abstract] [Full Text] [PDF]


Home page
Arch NeurolHome page
R. J. Packer and G. Vezina
Management of and Prognosis With Medulloblastoma: Therapy at a Crossroads
Arch Neurol, November 1, 2008; 65(11): 1419 - 1424.
[Abstract] [Full Text] [PDF]


Home page
J Child NeurolHome page
N. G. Gottardo and A. Gajjar
Chemotherapy for Malignant Brain Tumors of Childhood
J Child Neurol, October 1, 2008; 23(10): 1149 - 1159.
[Abstract] [PDF]


Home page
J Child NeurolHome page
I. F. Pollack
Diagnostic and Therapeutic Stratification of Childhood Brain Tumors: Implications for Translational Research
J Child Neurol, October 1, 2008; 23(10): 1179 - 1185.
[Abstract] [PDF]


Home page
J Child NeurolHome page
T. J. MacDonald
Aggressive Infantile Embryonal Tumors
J Child Neurol, October 1, 2008; 23(10): 1195 - 1204.
[Abstract] [PDF]


Home page
Jpn J Clin OncolHome page
K. Yasuda, H. Taguchi, Y. Sawamura, J. Ikeda, H. Aoyama, K. Fujieda, N. Ishii, M. Kashiwamura, Y. Iwasaki, and H. Shirato
Low-dose Craniospinal Irradiation and Ifosfamide, Cisplatin and Etoposide for Non-metastatic Embryonal Tumors in the Central Nervous System
Jpn. J. Clin. Oncol., July 1, 2008; 38(7): 486 - 492.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
T. de Haas, N. Hasselt, D. Troost, H. Caron, M. Popovic, L. Zadravec-Zaletel, W. Grajkowska, M. Perek, M.-C. Osterheld, D. Ellison, et al.
Molecular Risk Stratification of Medulloblastoma Patients Based on Immunohistochemical Analysis of MYC, LDHB, and CCNB1 Expression
Clin. Cancer Res., July 1, 2008; 14(13): 4154 - 4160.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
M. R. Grimmer and W. A. Weiss
BMPs oppose Math1 in cerebellar development and in medulloblastoma
Genes & Dev., March 15, 2008; 22(6): 693 - 699.
[Full Text] [PDF]


Home page
Neuro OncolHome page
L. Ridley, R. Rahman, M.-A. Brundler, D. Ellison, J. Lowe, K. Robson, E. Prebble, I. Luckett, R. J. Gilbertson, S. Parkes, et al.
Multifactorial analysis of predictors of outcome in pediatric intracranial ependymoma
Neuro-oncol, January 1, 2008; 10(5): 675 - 689.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
M. Fouladi, F. Laningham, J. Wu, M. A. O'Shaughnessy, K. Molina, A. Broniscer, S. L. Spunt, I. Luckett, C. F. Stewart, P. J. Houghton, et al.
Phase I Study of Everolimus in Pediatric Patients With Refractory Solid Tumors
J. Clin. Oncol., October 20, 2007; 25(30): 4806 - 4812.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
N. Ahmed, M. Ratnayake, B. Savoldo, L. Perlaky, G. Dotti, W. S. Wels, M. B. Bhattacharjee, R. J. Gilbertson, H. D. Shine, H. L. Weiss, et al.
Regression of Experimental Medulloblastoma following Transfer of HER2-Specific T Cells
Cancer Res., June 15, 2007; 67(12): 5957 - 5964.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
R. J. Packer, A. Gajjar, G. Vezina, L. Rorke-Adams, P. C. Burger, P. L. Robertson, L. Bayer, D. LaFond, B. R. Donahue, M. H. Marymont, et al.
Phase III Study of Craniospinal Radiation Therapy Followed by Adjuvant Chemotherapy for Newly Diagnosed Average-Risk Medulloblastoma
J. Clin. Oncol., September 1, 2006; 24(25): 4202 - 4208.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
D. Stearns, A. Chaudhry, T. W. Abel, P. C. Burger, C. V. Dang, and C. G. Eberhart
c-Myc Overexpression Causes Anaplasia in Medulloblastoma
Cancer Res., January 15, 2006; 66(2): 673 - 681.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
F. Mendrzyk, B. Radlwimmer, S. Joos, F. Kokocinski, A. Benner, D. E. Stange, K. Neben, H. Fiegler, N. P. Carter, G. Reifenberger, et al.
Genomic and Protein Expression Profiling Identifies CDK6 As Novel Independent Prognostic Marker in Medulloblastoma
J. Clin. Oncol., December 1, 2005; 23(34): 8853 - 8862.
[Abstract] [Full Text] [PDF]


Home page
The OncologistHome page
R. J. Gilbertson
ERBB2 in Pediatric Cancer: Innocent Until Proven Guilty
Oncologist, August 1, 2005; 10(7): 508 - 517.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
V. Oyharcabal-Bourden, C. Kalifa, J.C. Gentet, D. Frappaz, C. Edan, P. Chastagner, E. Sariban, A. Pagnier, A. Babin, F. Pichon, et al.
Standard-Risk Medulloblastoma Treated by Adjuvant Chemotherapy Followed by Reduced-Dose Craniospinal Radiation Therapy: A French Society of Pediatric Oncology Study
J. Clin. Oncol., July 20, 2005; 23(21): 4726 - 4734.
[Abstract] [Full Text] [PDF]


Home page
Integr Cancer TherHome page
S. R. Burzynski, R. A. Weaver, T. Janicki, B. Szymkowski, G. Jurida, M. Khan, and V. Dolgopolov
Long-term Survival of High-Risk Pediatric Patients With Primitive Neuroectodermal Tumors Treated With Antineoplastons A10 and AS2-1
Integr Cancer Ther, June 1, 2005; 4(2): 168 - 177.
[Abstract] [PDF]


Home page
Cancer Res.Home page
C. Di, S. Liao, D. C. Adamson, T. J. Parrett, D. K. Broderick, Q. Shi, C. Lengauer, J. M. Cummins, V. E. Velculescu, D. W. Fults, et al.
Identification of OTX2 as a Medulloblastoma Oncogene Whose Product can be Targeted by All-Trans Retinoic Acid
Cancer Res., February 1, 2005; 65(3): 919 - 924.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A. Ray, M. Ho, J. Ma, R. K. Parkes, T. G. Mainprize, S. Ueda, J. McLaughlin, E. Bouffet, J. T. Rutka, and C. E. Hawkins
A Clinicobiological Model Predicting Survival in Medulloblastoma
Clin. Cancer Res., November 15, 2004; 10(22): 7613 - 7620.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
O. Ozen, B. Krebs, B. Hemmerlein, A. Pekrun, H. Kretzschmar, and J. Herms
Expression of Matrix Metalloproteinases and Their Inhibitors in Medulloblastomas and Their Prognostic Relevance
Clin. Cancer Res., July 15, 2004; 10(14): 4746 - 4753.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
P. G. Fisher, P. C. Burger, and C. G. Eberhart
Biologic Risk Stratification of Medulloblastoma: The Real Time Is Now
J. Clin. Oncol., March 15, 2004; 22(6): 971 - 974.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gajjar, A.
Right arrow Articles by Gilbertson, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gajjar, A.
Right arrow Articles by Gilbertson, R. J.
Related Articles
Right arrowRelated Article
Right arrowRelated Editorial
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

About
JCO
 Editorial
Roster
 Advertising
Information
 Librarians &
Institutions
 Rights &
Permissions
 PDA Services

Copyright © 2004 by the American Society of Clinical Oncology, Online ISSN: 1527-7755. Print ISSN: 0732-183X
Terms and Conditions of Use
  HighWire Press HighWire Press™ assists in the publication of JCO Online