|
Advertisement |
|
|
||
 |
|
|||||
|
|||||
|
 |
||||||
|
||||||
|
||||||
|
Journal of Clinical Oncology, Vol 22, No 8 (April 15), 2004: pp. 1389-1397 © 2004 American Society of Clinical Oncology. DOI: 10.1200/JCO.2004.04.059 Phase I Trial of Intratumoral Injection of an Adenovirus Encoding Interleukin-12 for Advanced Digestive TumorsFrom the Liver Unit; Division of Gene Therapy; and Departments of Radiology, Gastroenterology, Pathology, Pharmacology, and Pharmacy, Clínica Universitaria and Medical School, University of Navarra, Pamplona, Spain Address reprint requests to Bruno Sangro, MD, Liver Unit, Department of Internal Medicine, Clinica Universitaria, University of Navarra, Ap. 4209 Pamplona 31080, Spain; e-mail: bsangro{at}unav.es
PURPOSE: To evaluate the feasibility and safety of intratumoral injection of an adenoviral vector encoding human interleukin-12 genes (Ad.IL-12) and secondarily, its biologic effect for the treatment of advanced digestive tumors. PATIENTS AND METHODS: Ad.IL-12 was administered in doses ranging from 2.5 x 1010 to 3 x 1012 viral particles, to seven cohorts of patients with advanced pancreatic, colorectal, or primary liver malignancies. Patients were thoroughly assessed for toxicity, and antitumor response was evaluated by imaging techniques, tumor biopsy, and hypersensitivity skin tests. Patients with stable disease and no serious adverse reactions were allowed to receive up to 3 monthly doses of Ad.IL-12. RESULTS: Twenty-one patients (nine with primary liver, five with colorectal, and seven with pancreatic cancers) received a total of 44 injections. Ad.IL-12 was well tolerated, and dose-limiting toxicity was not reached. Frequent but transient adverse reactions, including fever, malaise, sweating, and lymphopenia, seemed to be related to vector injection rather than to transgene expression. No cumulative toxicity was observed. In four of 10 assessable patients, a significant increase in tumor infiltration by effector immune cells was apparent. A partial objective remission of the injected tumor mass was observed in a patient with hepatocellular carcinoma. Stable disease was observed in 29% of patients, mainly those with primary liver cancer. CONCLUSION: Intratumoral injection of up to 3 x 1012 viral particles of Ad.IL-12 to patients with advanced digestive malignancies is a feasible and well-tolerated procedure that exerts only mild antitumor effects.
Primary and secondary liver tumors are poorly immunogenic, but different strategies involving immune stimulation have shown occasional activity against colorectal cancer or hepatocellular carcinoma (HCC).1 These strategies include the administration of autologous activated lymphocytes, tumor-pulsed dendritic cells, and nonspecific immunostimulating products such as levamisole or cytokines such as interferon-alfa or interleukin-2. Interleukin-12 (IL-12) is a heterodimeric soluble cytokine mainly produced by antigen presenting cells, that has shown remarkable properties as an anticancer agent in experimental tumors.2 In recent years, gene therapy has emerged as a promising approach to treat cancer by restoring the function of tumor suppressor genes, selectively activating prodrugs inside tumor cells, or stimulating immune response against neoplastic tissue.3 We and others have reported that intratumoral administration of an adenoviral vector carrying the IL-12 genes generates a strong systemic therapeutic effect in several models of metastatic digestive tumors, including HCC and colorectal cancer.4-6 This antitumor activity involves an immune response mediated by T and natural killer cells, as well as an antiangiogenic effect.7 We have also shown that there is a wide heterogeneity in the toxicity to systemic adenoviral gene transfer of IL-12.8 We report the results of the first clinical trial evaluating this strategy for the treatment of advanced digestive malignancies in humans.
Ad.IL-12 Construction Ad.IL-12 (an adenovirus encoding interleukin-12) is a first-generation, replication-defective, adenoviral vector that expresses the human IL-12 genes under the control of the strong, nonselective cytomegalovirus promoter. To produce Ad.IL-12, an expression cassette of hIL-12 under the control of cytomegalovirus (CMV) promoter was constructed encompassing IL-12 p35 cDNA, an internal ribosomal entry site (IRES), IL-12 p40 cDNA and a polyadenylation signal. Peripheral blood mononuclear cells were activated with lipopolysaccharide at 10 µg/mL for 21 hours, and total RNA was isolated from lysophosphatidic acid-activated peripheral blood mononuclear cells. RNA was reverse transcribed into cDNA using reverse transcriptase and random primers. The p35 and p40 subunits of human IL-12 gene were obtained by polymerase chain reaction (PCR) amplification of cDNA using two sets of specific primers. The primers for p35 were CTGCAGACCATGGGTCCAGCGCGCAGCCTCCT and CTGCAGTTAGGAAGCATTCAGATAGCTCGTCA, and those for p40 were CCATGGGTCACCAGCAGTTGGTCAT and GATATCTAACTGCAGGGCACAGAT. Fragments of 675 base pairs (bp) of p35 and 994 bp of p40 of the human IL-12 gene were cloned into pCR2.1-TOPO plasmids. The identity of the amplified fragments was confirmed by sequencing. A plasmid containing p35-IRES-p40 was constructed using standard procedures, and p35-IRES-p40 was then cloned in blunt-end into pMV60/CMV-pA to form pMV60/hIL-12. For construction of Ad.IL-12, pJM17 (containing the backbone of adenovirus serotype 5) and pMV60/hIL-12 were cotransfected into 293 cells, and plaques were screened to obtain Ad.IL-12, which was then propagated in 293 cells, purified by CsCl density gradient, dialyzed, and stored at –80°C. A single lot of clinical-grade Ad.IL-12 with a viral particle plaque-forming unit (vp:pfu) ratio of 12:65 was manufactured by BioReliance (Glasgow, Scotland). Biologic activity of human IL-12 secreted by HepG2 cells transduced with Ad.IL-12 was confirmed by an enzyme-linked immunosorbent assay (ELISA).
Study Design Objectives. The primary end point of the study was to assess the feasibility and safety of single and repeated direct intratumoral injections of Ad.IL-12, and to determine the maximum-tolerated dose and the dose-limiting toxicity of Ad.IL-12 when administered as described. Secondary end points were biologic effect and antitumor activity.
Patient selection and enrollment.
To be eligible, patients had to meet all of the following criteria: (1) age between 18 and 80 years; (2) histologic diagnosis of primary liver cancer, CRC, or PC; (3) a Karnofsky Index Permission for this clinical trial was obtained from the institutional ethical committee, the local government’s Ethical Committee for Clinical Investigation, the National Biosafety Commission, and the Spanish Agency for the Evaluation of Medicinal Products. All patients were treated at the Liver Unit, Clínica Universitaria de Navarra. Patients were enrolled consecutively in seven cohorts of three patients, with the following dose-escalation plan: cohort 1, 2.5 x 1010 vp; cohort 2, 1011 vp; cohort 3, 2.5 x 1011 vp; cohort 4, 5 x 1011 vp; cohort 5, 1012 vp; cohort 6, 2 x 1012 vp; cohort 7, 3 x 1012 vp.
Ad.IL-12 Preparation and Injection
Patient Evaluation Table 1 summarizes the evaluation of the patients throughout the trial. Evaluation before Ad.IL-12 treatment also included brain magnetic resonance imaging and bone scintigraphy. Patients were closely observed during the first 10 days by daily evaluation of toxicity and a comprehensive set of laboratory tests (including CBC, serum glucose, triglycerides, cholesterol, calcium, amylase, urea, creatinine, and electrolytes, and liver function tests) performed at days 1, 4, 7, and 10. At day 10, a tissue sample was obtained from the injected lesion. At day 30, toxicity was reevaluated, and response to therapy was assessed using WHO criteria.9 If at that time tumor disease was stable or responding and no serious adverse reactions had been observed, a second dose was administered into the same nodule. The whole procedure was repeated, but no more than three doses of Ad.IL-12 could be administered to the same patient.
The maximum-tolerated dose was defined as the one lower than the dose at which two patients experienced a dose-limiting toxicity. Dose-limiting toxicity was defined as grade 4 toxicity of any duration related to Ad.IL-12, or nonreversible grade 3 toxicity related to Ad.IL-12. Toxicity was assessed throughout the study using National Cancer Institute Common Toxicity Criteria.10 Adverse reactions observed were classified as definite, probable, or possible according to Karch and Lasagna criteria.11
Immunologic Monitoring Pathologic studies. Tumor samples were fixed in 10% buffered formalin, sectioned and stained with hematoxylin and eosin for histophatologic analysis. For immunohistochemical studies, formalin-fixed paraffin-embedded tissue sections were incubated with antibodies against CD4 (clone 4B12; dilution 1:40; Master Diagnostica, Grenada, Spain) and CD8 (clone C8/144B, dilution 1:200; Cell Marque Corp, Hot Springs, AR). Staining was performed with an automated immunostainer (TechMate 500; DAKO, Copenhagen, Denmark) with the EnVision+ system (DAKO). Endogenous peroxidase activity was quenched by treatment with 5% hydrogen peroxide in methanol for 30 minutes at room temperature. Antigen retrieval using 10 mL buffer EDTA, pH 8.0, and microwave treatment for 20 minutes in an 800-watt microwave oven was performed. Primary antibody was applied overnight at room temperature, and sections were then rinsed with washing buffer. EnVision+ system reagents were added, and incubation lasted 30 minutes at room temperature. Slides were rinsed with washing buffer, and treated with a solution containing 0.05% diaminobenzidine hydrochloride and 0.1% hydrogen peroxide in 0.05 mol/L TRIS-buffered saline, with pH 7.4, at room temperature for 5 minutes. After rinsing in distilled water for 3 minutes, slides were counterstained with modified Harris hematoxylin, dehydrated, and mounted. Nonimmune goat serum was substituted for the primary antibodies as negative controls. Appropriate positive controls were run concurrently. Membrane staining was evaluated.
Delayed-type hypersensitivity test.
Skin tests were used to assess in vivo immune reaction to autologous tumor antigens. Tumor tissue was placed in phosphate-buffered saline, and cells were dispersed using a pipette to obtain a single-cell suspension. Cells were lised by 3 to 4 freeze and thaw cycles, and debris was removed by centrifugation during 10 minutes at 2,000 rpm. Supernatants were collected and irradiated at 50 Gy, and aliquots were stored at –80°C. Skin tests were performed by injecting intradermally 50 µL of this tumor lysate more than 3 days before Ad.IL-12 injection and at day 30. At day 30, 50 µL of a solution containing Ad.IL-12 inactivated by UV light was injected to assess reactivity against viral antigens. A positive test was defined as a
Patient Characteristics Table 2 summarizes the characteristics of treated patients. Twenty-one patients were enrolled between May 2001 and January 2002. Mean age was 55 years (range, 37 to 70 years). Eight patients had HCC, seven had PC, five had CRC, one had cholangiocarcinoma, and all of them had multiple tumor masses. All the patients were fully ambulatory. Six of the eight patients with HCC had an underlying liver cirrhosis due to hepatitis C virus (four cases) or hepatitis B virus (two cases). All cirrhotic patients had portal hypertension and fairly preserved liver function (four cases were Child-Pugh class A, and two were class B). All of the patients with PC and CRC had had prior standard antineoplastic chemotherapy. Among the nine patients with primary liver tumors, most of them had received multimodal therapy. None of the patients received antineoplastic chemotherapy or immunosuppressant drugs in the month previous to Ad.IL-12 injection.
Treatment Procedure Intratumoral injection of Ad.IL-12 was feasible in 100% of cases. As presented in Table 3, 44 injections were administered to the 21 patients guided by either US (n = 37), endoscopic US (n = 5), or CT scan (n = 2). Ad.IL-12 was injected into a liver tumor nodule in 15 patients, into the primary pancreatic tumor in three patients, into a peritoneal nodule in one patient, and into a conglomerate of retroperitoneal lymph node metastases in one patient.
Toxicity A total of 319 adverse events were recorded throughout the follow-up period, mostly related to disease progression (Table 4). Overall, Ad.IL-12 administration was well tolerated, and dose-limiting toxicity was not observed. Mild to moderate fever responsive to common antipyretics was observed 24 to 48 hours after Ad.IL-12 injection in nearly 60% of patients, irrespective of the dose of Ad.IL-12, and was occasionally associated with profuse sweating and malaise. Four patients (19%) experienced pain at the site of injection lasting 1 to 3 days after treatment, and a painless, transient erythema around the site of injection appeared in one patient. On the day of treatment, five patients (24%) had nausea and/or vomiting, which responded to antiemetics. Patient 1 developed a transudative pleural effusion 9 days after Ad.IL-12 injection that required thoracentesis and did not recur. Since there was no obvious explanation for this effusion, a relation with Ad.IL-12 injection cannot be ruled out. One patient with a colostomy experienced an intense edema of the intestinal mucosa that protruded through the colostomy. This event that appeared 3 days after injection of Ad.IL-12 into a liver metastasis lasted for 8 days and recurred after a second injection of Ad.IL-12.
Lymphopenia was the most frequent adverse event, appearing in 85% of patients. Most patients had grade 1 or 2 lymphopenia before treatment, but lymphocyte count almost invariably decreased at day 1 and returned to basal values by day 7.There was an apparent direct relationship between the adenoviral dose and the intensity of lymphopenia. Mild, transient thrombocytopenia also appeared in three patients from the highest dose steps. Regarding liver toxicity, most patients had altered liver function tests of varying degrees before treatment, but relevant changes consistent with a reaction to Ad.IL-12 were not observed. However, four patients had a transient, modest rise in serum bilirubin after treatment. It is noteworthy that none of the six cirrhotic patients with HCC experienced significant liver toxicity, even at the highest dose level. Among patients receiving multiple doses, side effects usually recurred, but cumulative toxicity was not observed. Also, there was no hint of long-term toxicity among patients observed for more than 6 months. Immunologic disturbances and autoimmunity were two major concerns at the beginning of the trial. The number and nature of infectious episodes recorded were those expected in the population studied. Regarding autoimmunity, no clinical manifestations of autoimmune reactions were observed, despite the fact that serum autoantibodies became detectable frequently or showed an increase of their pre-existing titer irrespective of the adenoviral dose given. In particular, Figure 2 shows the titers of antismooth muscle antibodies and antinuclear antibodies before therapy and 1 month after the last injection of Ad.IL-12.
Biologic Response A biologic response to therapy was examined by evaluating transgene expression, tumor infiltration by immune effector cells and delayed cellular response to tumor antigens.
Transgene expression.
Although local transgene expression might not be evident at the systemic level, we measured serum concentrations of IL-12 and IFN-
We have measured by quantitative reverse transcriptase PCR using primers that amplify IRES region the expression of the transgene in 11 patients in tumor samples obtained at day 10 after treatment in which frozen tissue was available from the tumor samples. Transgene expression was not detected in any tumor sample. Pathologic study. A tumor sample was obtained at day 10 in all but two patients in whom the clinical condition at that time contraindicated a percutaneous biopsy. Eight patients received antineoplastic therapy from the time of histological diagnosis to the time of inclusion in the clinical trial. In the remaining 11 patients, a pair of samples from the same tumor mass were obtained shortly before injection of Ad.IL-12 and at day 10. The quality of samples permitted comparison of the two specimens in 10 patients. In four cases, there was a substantial increase in the tumor infiltration by CD4 and CD8 cells, with increases in CD8 cells ranging from 193% to 336%. As an example, Figure 4 shows immunohistochemical staining for CD8 cells on histological tissue sections from patient 9 before treatment and at day 10. Interestingly, two of the four patients had HCC, and one (patient 9) had a partial remission of the injected tumor mass (a conglomerate of metastatic lymph nodes), while the other (patient 10) had a minor response (< 25% reduction in the liver tumor mass and a moderate decrease in tumor marker).
Delayed-type hypersensitivity tests. Skin tests against tumor extracts were negative before treatment and remained negative at day 30 after Ad.IL-12 injection in all patients. In contrast, the reaction against inactivated Ad.IL-12 was positive in every patient after therapy.
Antitumor Activity
Three patients with primary liver cancer showed a significant decrease in serum levels of tumor markers. Alpha-fetoprotein slightly and temporarily declined in two patients with HCC who showed radiologically stable disease (from 81 to 57 U/mL in patient 10; and from 280 to 25 IU/mL in patient 19). Patient 20, bearing a cholangiocarcinoma with peritoneal metastases, experienced an intense decrease in the levels of CA 125 (from 481 to 191 IU/mL), CEA (from 287 to 70 IU/mL) and CA 19.9 (from 1,216 to 658 IU/mL). Liver function tests improved in parallel, but he died during early follow-up due to progressive peritoneal disease. On the contrary, Ad.IL-12 was followed by an increase in the rate of progression of tumor markers in patient 14 with liver metastases from CRC and patient 15 with HCC.
Clinical development of recombinant IL-12 as an anticancer agent was hindered by lethal toxicity observed in a phase II trial as result of the ability of IL-12 to trigger endogenous IFN-  production.12,13 Theoretically, IL-12 gene transfer to the tumor may result in high local production and low blood levels that would in turn facilitate the induction of antitumor effects while minimizing systemic toxicity. We and others have shown that intratumoral injection of an adenoviral vector encoding IL-12 efficiently eradicates experimental liver cancer.4-6 Here, we present the results from the first clinical trial investigating adenoviral-mediated transfer of IL-12 genes into patients with advanced digestive tumors. We have found that intratumoral injection of Ad.IL-12 is a feasible and safe procedure that can be carried out in an outpatient setting. First-generation adenoviral vectors have been safely administered to patients with cancer by different routes in doses up to 7.5 x 1013 vp, with most common adverse reactions being moderate fever and flulike symptoms.14-22 However, toxicity of adenoviral vectors depends on several factors, including viral dose, pfu:vp ratio, and transgene expression.23 Although fever, sweating, and malaise occurring shortly after Ad.IL-12 injection were likely to be due to proinflammatory cytokine release induced by adenovirus, severe adverse reactions did not appear. Thus, although the transgene ferried by the adenoviral particle is a potent immunostimulatory cytokine, it did not result in an enhancement of the toxic reaction against the vector. Transient though intense lymphopenia did not result in opportunistic infections and was probably related to injection of adenoviral particles since it can appear after wild-type adenovirus infection and has been observed in nonhuman primates after intravascular administration of adenoviral vectors (personal observation and previously reported data24). Mild liver toxicity had been observed after intratumoral and hepatic artery injection of adenoviral vectors encoding for p53 and tk genes,14,16,20 and increase in liver enzymes was a component of the dose-limiting toxicity of recombinant IL-12.25 Thus, a special concern in our trial was the possibility of inducing liver injury to patients with chronic liver disease, particularly those with viral cirrhosis. Interestingly, none of our patients with compensated cirrhosis experienced liver toxicity. Because transferring IL-12 genes to tumor and nontumor cells might result in the effective presentation of self-antigens to the immune system, another concern in this trial was the induction of autoimmune reactions. Despite the frequent emergence of antismooth muscle antibodies, clinical evidence of autoimmunity was not observed after Ad.IL-12 administration. It seems, therefore, that the non-species-specific autoantibodies induced by Ad.IL-12 are devoid of pathogenic activity. In this trial, a clear, specific antitumor immune response could not be demonstrated by hypersensitivity skin tests. Yet, this could be partly due to the limited amount of tumor extract available from percutaneous tumor biopsies. It should be mentioned, however, that a substantial increase in tumor infiltration by both CD4-positive and CD8-positive T cells was observed in four of 10 patients after a single injection of Ad.IL-12. As mentioned before, this biologic response might be associated with antitumor effects since two of these patients experienced reduction in their tumor mass. Inasmuch as the most prominent response was observed after injection of the vector into metastatic lymph nodes, it is also possible that an adequate cellular milieu may indeed facilitate the induction of an effective antitumoral immune reaction. Disease progression was indeed more frequent among patients with CRC or PC than in those with HCC. Although this could be due to the comparative low growth rate of HCC, an antitumor effect of Ad.IL-12 cannot be ruled out. Also, the most evident instance of tumor response was observed after injecting Ad.IL-12 into node metastases of an HCC. Yet, a systemic antitumor effect could not be observed in any patient. This low antitumor effect might to be due to poor transduction efficiency or to short duration of transgene expression. The latter is supported by the absence of transgene expression 10 days after adenoviral injection in 11 of 11 examined tumor samples. Tumor and nontumoral liver tissue obtained from necropsies performed at days 30 and 45 after adenoviral treatment (data not shown from patients 4 and 20) harbor a significant amount of adenoviral DNA as measured by quantitative PCR. This suggests that short-lived transgene expression is probably due to silencing of CMV promoter rather than to immune-mediated elimination of infected cells. In the future, gene therapy clinical trials could benefit from imaging studies to allow visualization of gene expression in the neoplastic tissue to assess the transduction efficacy of a particular vector for a specific tumor type.3 Now, the efficacy of Ad.IL-12 should be tested in homogenous series of patients with a small tumor burden in which immune stimulation is more likely to be effective.
The authors indicated no potential conflicts of interest.
We thank Maria Eugenia Cornet, Maria del Mar Municio, Viñas Andrés, and Elena del Corral for their work in trial monitoring, and Blanca Larrea for providing excellent nursing care for patients.
Supported in part by grants from Instituto de Salud Carlos III (C03/02) and Fundación Areces. This study was presented in part at the 5th Annual Meeting of the American Society for Gene Therapy, Boston, MA, June 5-9, 2002. Authors’ disclosures of potential conflicts of interest are found at the end of this article.
1. Morse MA, Lyerly HK: Immunotherapy for liver tumors, in Clavien P-A (ed): Malignant Liver Tumors: Current and Emerging Therapies. Malden, MA, Blackwell Science Inc, 1999, pp 218-228 2. Colombo MP, Trinchieri G: Interleukin-12 in anti-tumor immunity and immunotherapy. Cytokine Growth Factor Rev 13:155-168, 2002[CrossRef][Medline]
3. Sangro B, Qian C, Schmitz V, et al: Gene therapy of hepatocellular carcinoma and gastrointestinal tumors. Ann N Y Acad Sci 963:6-12, 2002 4. Mazzolini G, Qian C, Xie X, et al: Regression of colon cancer and induction of antitumor immunity by intratumoral injection of adenovirus expressing interleukin-12. Cancer Gene Ther 6:514-522, 1999[CrossRef][Medline] 5. Barajas M, Mazzolini G, Genove G, et al: Gene therapy of orthotopic hepatocellular carcinoma in rats using adenovirus coding for interleukin 12. Hepatology 33:52-61, 2001[CrossRef][Medline]
6. Caruso M, Pham Nguyen K, Kwong YL, et al: Adenovirus-mediated interleukin-12 gene therapy for metastatic colon carcinoma. Proc Natl Acad Sci U S A 93:11302-11306, 1996 7. Mazzolini G, Narvaiza I, Bustos M, et al: Alpha(v)beta(3) integrin-mediated adenoviral transfer of interleukin-12 at the periphery of hepatic colon cancer metastases induces VCAM-1 expression and T-cell recruitment. Mol Ther 3:665-672, 2001[CrossRef][Medline] 8. Mazzolini G, Narvaiza I, Perez-Diez A, et al: Genetic heterogeneity in the toxicity to systemic adenoviral gene transfer of interleukin-12. Gene Ther 8:259-267, 2001[CrossRef][Medline] 9. WHO: Handbook of Reporting Results of Cancer Treatment. Publication No 48. Geneva, Switzerland, World Health Organization, 1979 10. National Cancer Institute: Guidelines for the Reporting of Adverse Drug Reactions. Bethesda, MD, Division of Cancer Treatment, National Cancer Institute, 1990, pp 1-80 11. Karch FE, Lasagna L: Adverse drug reactions: A critical review. JAMA 234:1236-1241, 1975[Abstract]
12. Leonard JP, Sherman ML, Fisher GL, et al: Effects of single-dose interleukin-12 exposure on interleukin-12-associated toxicity and interferon-gamma production. Blood 90:2541-2548, 1997
13. Sacco S, Heremans H, Echtenacher B, et al: Protective effect of a single interleukin-12 (IL-12) predose against the toxicity of subsequent chronic IL-12 in mice: Role of cytokines and glucocorticoids. Blood 90:4473-4479, 1997 14. Herman JR, Adler HL, Aguilar-Cordova E, et al: In situ gene therapy for adenocarcinoma of the prostate: A phase I clinical trial. Hum Gene Ther 10:1239-1249, 1999[CrossRef][Medline]
15. Tursz T, Cesne AL, Baldeyrou P, et al: Phase I study of a recombinant adenovirus-mediated gene transfer in lung cancer patients. J Natl Cancer Inst 88:1857-1863, 1996 16. Teh BS, Aguilar-Cordova E, Kernen K, et al: Phase I/II trial evaluating combined radiotherapy and in situ gene therapy with or without hormonal therapy in the treatment of prostate cancer-a preliminary report. Int J Radiat Oncol Biol Phys 51:605-613, 2001[CrossRef][Medline]
17. Alvarez RD, Barnes MN, Gomez Navarro J, et al: A cancer gene therapy approach utilizing an anti-erbB-2 single-chain antibody-encoding adenovirus (AD21): A phase I trial. Clin Cancer Res 6:3081-3087, 2000 18. Schuler M, Rochlitz C, Horowitz JA, et al: A phase I study of adenovirus-mediated wild-type p53 gene transfer in patients with advanced non-small cell lung cancer. Hum Gene Ther 9:2075-2082, 1998[Medline] 19. Buller RE, Runnebaum IB, Karlan BY, et al: A phase I/II trial of rAd/p53 (SCH 58500) gene replacement in recurrent ovarian cancer. Cancer Gene Ther 9:553-566, 2002[CrossRef][Medline]
20. Schuler M, Herrmann R, DeGreve JL, et al: Adenovirus-mediated wild-type p53 gene transfer in patients receiving chemotherapy for advanced non-small-cell lung cancer: Results of a multicenter phase II study. J Clin Oncol 19:1750-1758, 2001 21. Gahery-Segard H, Molinier-Frenkel V, LeBoulaire C, et al: Phase I trial of recombinant adenovirus gene transfer in lung cancer. Longitudinal study of the immune responses to transgene and viral products. J Clin Invest 100:2218-2226, 1997[Medline] 22. Sterman DH, Treat J, Litzky LA, et al: Adenovirus-mediated herpes simplex virus thymidine kinase/ganciclovir gene therapy in patients with localized malignancy: Results of a phase I clinical trial in malignant mesothelioma. Hum Gene Ther 9:1083-1092, 1998[Medline] 23. Assessment of adenoviral vector safety and toxicity: Report of the National Institutes of Health Recombinant DNA Advisory Committee. Hum Gene Ther 13:3-13, 2002[CrossRef][Medline] 24. Schnell MA, Zhang Y, Tazelaar J, et al: Activation of innate immunity in nonhuman primates following intraportal administration of adenoviral vectors. Mol Ther 3:708-722, 2001[CrossRef][Medline]
25. Gollob JA, Mier JW, Veenstra K, et al: Phase I trial of twice-weekly intravenous interleukin 12 in patients with metastatic renal cell cancer or malignant melanoma: Ability to maintain IFN-gamma induction is associated with clinical response. Clin Cancer Res 6:1678-1692, 2000 Submitted April 8, 2003; accepted October 30, 2003. This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|
|||||||||||
|
|||||||||||
|
|
Copyright © 2004 by the American Society of Clinical Oncology, Online ISSN: 1527-7755. Print ISSN: 0732-183X
|
TOP
ABSTRACT
INTRODUCTION
50%; (4) tumor not amenable to standard curative or palliative therapies; (5) an accessible tumor mass; (6) a life expectancy beyond 2 months; and (7) ability to give signed informed consent. Exclusion criteria included: (1) pregnancy or lactation; (2) a neutrophil count 
0.5/pL or a platelet count 
· r3, where r is half the maximal tumor diameter. The solution containing Ad.IL-12 was very slowly injected into the tumor at different sites, so that one injection was performed every 2 cm in diameter when possible. 
