Originally published as JCO Early Release 10.1200/JCO.2005.01.388 on February 14 2005
Journal of Clinical Oncology, Vol 23, No 11 (April 10), 2005: pp. 2493-2501
© 2005 American Society of Clinical Oncology.
Predictive and Prognostic Impact of Epidermal Growth Factor Receptor Mutation in NonSmall-Cell Lung Cancer Patients Treated With Gefitinib
Sae-Won Han,
Tae-You Kim,
Pil Gyu Hwang,
Soohyun Jeong,
Jeongmi Kim,
In Sil Choi,
Do-Youn Oh,
Jee Hyun Kim,
Dong-Wan Kim,
Doo Hyun Chung,
Seock-Ah Im,
Young Tae Kim,
Jong Seok Lee,
Dae Seog Heo,
Yung-Jue Bang,
Noe Kyeong Kim
From the Department of Internal Medicine, Department of Pathology, and Department of Thoracic and Cardiovascular Surgery, Seoul National University Hospital; Department of Internal Medicine, Seoul Municipal Boramae Hospital; Department of Internal Medicine, Seoul National University Bundang Hospital; Cancer Research Institute, Seoul National University College of Medicine; Petagen Inc, Seoul, Korea
Address reprint requests to Tae-You Kim, MD, Department of Internal Medicine, Seoul National University College of Medicine, 28 Yongon-Dong, Chongno-Gu Seoul, 110-744 Korea; e-mail: kimty{at}snu.ac.kr.
 |
ABSTRACT
|
|---|
PURPOSE: This study was undertaken to investigate the effects of epidermal growth factor receptor (EGFR) mutation and its downstream signaling on response and survival in nonsmall-cell lung cancer (NSCLC) patients treated with gefitinib.
PATIENTS AND METHODS: For 90 consecutive NSCLC patients who had received gefitinib, EGFR mutation was analyzed by DNA sequencing of exons 18, 19, 21, and 23 in the EGFR tyrosine kinase domain. Expressions of phosphorylated (p) -Akt and p-Erk were determined via immunohistochemistry. Response rate, time to progression (TTP), and overall survival were compared between each group according to EGFR mutation, as well as p-Akt and p-Erk expression.
RESULTS: Seventeen patients (18.9%; 95% CI, 10.8 to 27.0) harbored EGFR mutations. These mutations include deletions in exon 19 in seven patients, L858R in six patients, G719A in three patients, and a novel A859T in one patient. Response rate in patients with EGFR mutation was 64.7% (11 of 17 patients; 95% CI, 42.0 to 87.4), in contrast to 13.7% (10 of 73 patients; 95% CI, 5.8 to 21.6) in patients without mutation (P < .001). Moreover, these 17 patients with EGFR mutation had significantly prolonged TTP (21.7 v 1.8 months; P < .001) and overall survival (30.5 v 6.6 months; P < .001) compared with the remaining 73 patients without mutation. Although no significant correlation was detected between EGFR mutation and expressions of p-Akt or p-Erk, p-Akt overexpression was associated with prolonged TTP in patients with EGFR mutation.
CONCLUSION: Our data further support the importance of EGFR mutation with regard to gefitinib sensitivity. In addition to its predictive role, EGFR mutation confers significant survival benefits on NSCLC patients treated with gefitinib.
 |
INTRODUCTION
|
|---|
Gefitinib (ZD1839, Iressa; AstraZeneca, Wilmington, DE) is a specific inhibitor of epidermal growth factor receptor (EGFR) tyrosine kinase. It has shown favorable efficacy especially in nonsmall-cell lung cancer (NSCLC).1 After two phase II trials, Iressa Dose Evaluation in Advanced Lung Cancer (IDEAL) 1 and 2, and the compassionate Expanded Access Program, gefitinib monotherapy is rising as a treatment option for chemotherapy-refractory NSCLC.2-4 It is also being evaluated as a first-line treatment in selected patients.5
As only a limited number of patients benefited from gefitinib monotherapy, and because gefitinib is a specifically targetedagent, researchers have sought predictive markers of response in order to optimize patient selection for treatment. Female sex, adenocarcinoma histology, and being a never-smoker have been reported to be associated with response, but the reasons for these associations have remained obscure.2,3,6 Molecular predictive markers have also been investigated. EGFR, the specific target of gefitinib, was the first marker to be investigated, but the results were disappointing, as its expression failed to show any correlation with response.7,8 Since EGFR activity, after autophosphorylation, is mediated by downstream signal transduction cascades including the PI3K/Akt, Ras/Raf/Erk, and Jak/STAT pathways, EGFR downstream molecules had also been investigated as a predictive marker for response to gefitinib.8-11 The results of these investigations were controversial. While some have reported the possible roles of phosphorylated (p) -Akt or p-Erk as predictive markers, others have failed to find any association.
Recently, activating mutations of EGFR were found to have a significant association with response to gefitinib, suggesting its promising role as a predictive marker of response.12-14 Higher rates of mutation were seen in females, adenocarcinomas, the Japanese population, and never-smokers, which may explain the clinical response predictive factors. Furthermore, in vitro experiments with EGFR mutant cell lines revealed preferential phosphorylation of selected tyrosine residues in the carboxy-terminal of EGFR and resulting activations of PI3K/Akt and STAT pathways.15 This may explain, in part, previous reports of correlations between EGFR downstream molecules and efficacy of gefitinib.8,9
However, EGFR mutation has not been examined in unselected patients treated with gefitinib. Moreover, the effect of EGFR mutation on survival has not been reported. Thus, in order to confirm and enrich our knowledge of EGFR mutation in gefitinib-treated patients, we have investigated EGFR mutational status in a set of consecutive NSCLC patients who had received gefitinib at our institutions, regardless of their response. Correlations between EGFR mutation and response to gefitinib and survival were analyzed. In addition, its correlation with expression of p-Akt and p-Erk were investigated.
 |
PATIENTS AND METHODS
|
|---|
Patients and Treatment
From December 2001 to July 2004, 219 advanced NSCLC patients received gefitinib monotherapy at the two participating institutions (Seoul National University Hospital or Seoul Municipal Boramae Hospital, Seoul, Korea), including 88 patients who participated in the Expanded Access Program. Among them, 90 patients were assessable for response, and had paraffin-embedded tissue adequate for mutational analysis. All patients had pathologically proven locally advanced or metastatic NSCLC. All patients included in the study also had normal baseline CBCs, and renal and hepatic functions. The treatment consisted of 250 mg of gefitinib daily, which was continued until disease progression, intolerable toxicity, or patient refusal.
Patients were re-evaluated every 4 weeks by chest x-ray or computed tomography (CT) and adequate blood tests for tumor response and toxicity. Tumor response was evaluated according to the WHO criteria, and all responses were confirmed at least 4 weeks after initial assessment.16 Smoking histories were obtained by thorough reviews of medical records. In those patients who had been recorded as a never-smoker, smoking history was once again confirmed by the patient or a close family member in case the patient had died. Formalin-fixed, paraffin-embedded tissue blocks obtained before any systemic chemotherapy or radiotherapy were retrieved from the archives of the Departments of Pathology at the two institutions: 79 from primary tumor, five from lymph node, and six from metastatic sites (three bone, two liver, and one brain). All histology was once again reviewed by the two pathologists (P.G.H. and D.H.C) blinded to any clinical information. Adenocarcinomas with bronchioloalveolar features were classified as bronchioloalveolar carcinoma (BAC). The study protocol was reviewed and approved by the institutional review board at the Seoul National University Hospital. Recommendations of the Declaration of Helsinki for biomedical research involving human subjects were also followed.
DNA Sequencing
DNA was extracted from five paraffin sections of 10-µm thickness containing a representative portion of each tumor block, using the QIAamp DNA Mini kit (Qiagen, Hilden, Germany). One hundred nanograms of DNA were amplified in a 20-µL reaction solution containing 2 µL of 10x buffer (Roche, Mannheim, Germany), 1.7 to 2.5 mmol/L of MgCl2, 0.3 µM of each primer pairs (exon 18, F: 5'-tccaaatgagctggcaagtg, R: 5'-tcccaaacactcagtgaaacaaa; exon 19, F: 5'- atgtggcaccatctcacaattgcc, R: 5'-ccacacagcaaagcagaaactcac; exon 21, F: 5'-gctcagagcctggcatgaa, R: 5'-catcctcccctgcatgtgt; exon 23, F: 5'-tgaagcaaattgcccaagac, R: 5'-tgacatttctccagggatgc), 250 µM of deoxynucleoside triphosphate, and 2.5 units of DNA polymerase (Roche). Amplifications were performed using a 5-minute initial denaturation at 94°C; followed by 30 cycles of 1 minute at 94°C, 1 minute at 55°C, and 1 minute at 72°C, and a 10-minute final extension at 72°C. Polymerase chain reaction (PCR) products were then 2% gel-purified with a QIAgen gel extraction kit (Qiagen). DNA templates were processed for the DNA sequencing reaction using the ABI-PRISM BigDye Terminator version 3.1 (Applied Biosystems, Foster, CA) with both forward and reverse sequence-specific primers. Twenty nanograms of purified PCR products were used in a 20-µL sequencing reaction solution containing 8 µL of BigDye Terminator v3.1 and 0.1 µM of the same PCR primer. Sequencing reactions were performed using a 2-minute initial denaturation at 96°C, followed by 25 cycles of 10 seconds at 94°C, 15 seconds at 50°C, and 3 minutes at 60°C. Sequence data were generated with the ABI PRISM 3100 DNA Analyzer (Applied Biosystems). Sequences were analyzed by Sequencer 3.1.1. software (Applied Biosystems) to compare variations.
Immunohistochemistry
Immunohistochemistry was performed and scored as previously described.8 In brief, antigen retrieval was performed by microwaving in 0.01 M citrate buffer adjusted to pH 6.0 for 15 minutes at 650 W. Endogenous peroxidase activity was quenched with 3% hydrogen peroxide in methanol for 15 minutes. After incubation with blocking solution for 10 minutes, sections were incubated with primary antibodies (1/50 dilution) at 4°C for 12 hours, followed by 10 minutes of incubation with biotinylated secondary antibody and then with streptavidin horseradish peroxidase for an additional 10 minutes. Staining was carried out with diaminobenzidine chromogen, and counter-staining with Mayer's hematoxylin. Primary antibodies used were rabbit polyclonal p-Akt (Ser473) antibody (immunohistochemistry specific) and rabbit polyclonal p-p44/42 MAPK (Thr202/Tyr204) antibody, both of which were purchased from Cell Signaling Technology (Beverly, MA). Blocking solution, secondary antibody, streptavidin horseradish peroxidase, and diaminobenzidine chromogen were all from the Cap-Plus Kit (Zymed Laboratories, San Francisco, CA). Each slide was scored as 1+ if more than 5% of cells exhibited cytoplasmic or weak nuclear staining, and as 2+ if they exhibited strong nuclear staining (ie, more intense nuclear staining as compared with the cytoplasm) in more than 5% of cells.8
Statistical Analysis
The statistical analyses of categoric variables were performed using the Pearson's 2 test or the Fisher's exact test where appropriate. Multivariate analysis was performed using a logistic regression model. The median durations of overall survival (OS) and time to progression (TTP) were calculated using the Kaplan-Meier method. Comparisons between different groups were made using the log-rank tests. Multivariate analysis was carried out using the stepwise Cox regression model. Two-sided P values of less than .05 were considered significant. All analyses were performed using SPSS for Windows, version 12.0 (SPSS Inc, Chicago, IL).
 |
RESULTS
|
|---|
Patient Characteristics and Efficacy of Gefitinib
Baseline characteristics of the 90 patients are as described in Table 1. The majority of the patients were male (54 patients, 60.0%) and adenocarcinoma was the major histologic type (65 patients including 10 BAC, 72.2%). The 10 BACs consisted of three pure BACs and seven adenocarcinomas with BAC features. Never-smokers made up 47.8% (43 patients) of patients. There was no treatment withdrawal as a result of toxicity, and only one patient was withdrawn due to her refusal of treatment. With regard to best overall response, 21 patients exhibited partial responses (PR; 23.3%; 95% CI, 14.6 to 32.0), 27 patients maintained stable disease (SD; 30.0%; 95% CI, 20.5 to 39.5), and 42 patients had progressive disease (PD; 46.7%; 95% CI, 36.4 to 57.0; Table 2). Females (response rate [RR], 36.1% v 14.8% [male]; P = .019), never-smokers (RR, 32.6% v 14.9% [smokers]; P = .048), and patients with adenocarcinoma (RR, 29.2% v 8.0% [nonadenocarcinoma]; P = .033) exhibited better responses. No response was detected in 19 male smokers with histologies other than adenocarcinoma. In the multivariate analysis, female sex was the only factor significantly associated with response (odds ratio [OR], 3.25; 95% CI, 1.18 to 8.95). Median TTP was 2.7 months (95% CI, 1.9 to 3.6) and OS was 7.4 months (95% CI, 4.6 to 10.2). Median OS in patients with PR, SD, and PD were 22.1 (95% CI, 11.5 to 32.8), 12.3 (95% CI, 7.8 to 16.9), and 4.8 (95% CI, 4.0 to 5.7) months, respectively (P < .001).
EGFR Mutation Analysis
Deletion in exon 19 was the most common mutation, found in seven patients (Table 3; Fig 1). L858R (2573T>G) in exon 21 was found in six patients and G719A (2156G>C) in three patients. Other mutations found were E709K (2125G>A) in exon 18 and A859T (2575G>A) in exon 21, in one patient each. One patient was found to harbor two mutations in the tested exons (E709K and G719A). All mutations were heterozygous. In addition, synonymous single nucleotide polymorphism in exon 23 (2709C>T, T903) was seen in four patients. Excluding this polymorphism, the overall mutation rate was 18.9% (17 of 90 patients; 95% CI, 10.8 to 27.0). Mutation rates were higher in females (33.3% v 9.3% [male]; P = .004), never-smokers (25.6% v 12.8% [smokers]; P = .12), and patients with adenocarcinoma (21.5% v 12.0% [nonadenocarcinoma]; P = .38). No mutations were observed in 19 male smokers with histologies other than adenocarcinoma.

View larger version (7K):
[in this window]
[in a new window]
|
Fig 1. Mutations of epidermal growth factor receptor in the current study. Numbers in parentheses indicate the number of patients with the mutation. Exons 18, 19, 21, and 23 were analyzed in the current study. (*) Novel mutations found in the current study. a.a., amino acid.
|
|
EGFR Mutation and Response to Gefitinib
Of 17 patients harboring EGFR mutations, 11 patients (64.7%) exhibited PR, whereas 10 (13.7%) of 73 patients without mutation had PR after treatment with gefitinib (P < .001; Table 4). Multivariate analysis with clinical variables of sex, histology, and smoking history yielded mutational status as the sole predictive factor of response to gefitinib (OR, 10.9; 95% CI, 2.97 to 40.2). Moreover, among six patients with mutation not exhibiting a PR, three patients had minor responses (decrease in tumor size but not reaching the criteria for a PR), one patient showed a dramatic decrease in serum carcinoembryogenic antigen level and symptomatic improvement, and two patients experienced PD. Collectively, all but two patients harboring EGFR mutations (15 of 17 patients, 88.2%) experienced substantial clinical benefits from the treatment. At the time of data analysis, 10 of 17 patients with mutation had experienced PD. Six patients showed progression in their lung lesions, two had aggravation of pre-existing bone metastases, one developed multiple new metastases in bone, and one had aggravation of pre-existing brain metastasis.
From previous reports and this study, most of the EGFR mutations were found in three hot-spots: G719, L747 A750, and L858.12-14 Among 16 patients with these mutations, 15 (93.8%) benefited from gefitinib treatment. Therefore, EGFR mutation in these three hot-spots appears to be more sensitive in determining gefitinib responsiveness.
EGFR Mutation and Impact on Survival
Median TTP was 21.7 months in patients with EGFR mutation and 1.8 months in patients without mutation (P < .001; Fig 2). Median OS was 30.5 months in patients with EGFR mutation and 6.6 months in patients without mutation (P < .001). EGFR mutation was independently predictive of prolonged TTP (hazard ratio [HR], 0.23; 95% CI, 0.093 to 0.57) and OS (HR, 0.16; 95% CI, 0.046 to 0.52) in multivariate analyses with response to gefitinib as a covariate. Interestingly, when considering only those 21 patients who exhibited PRs, TTP and OS also varied according to mutational status. Median TTP was 8.4 months in responders without mutation, and 22.0 months in responders with mutation (P = .11; Fig 3). Median OS was 13.7 months for nonmutant responders and 30.5 months for mutant responders (P = .047). TTP and OS among responders were not affected by sex or smoking history (data not shown). These results suggest that EGFR mutation behaves not only as a predictor of responsiveness, but also as an important prognostic factor for survival in patients treated with gefitinib.

View larger version (14K):
[in this window]
[in a new window]
|
Fig 2. Kaplan-Meier plots of (A) time to progression and (B) overall survival according to epidermal growth factor receptor mutational status. (*) Log-rank test.
|
|

View larger version (13K):
[in this window]
[in a new window]
|
Fig 3. Kaplan-Meier plots of (A) time to progression and (B) overall survival in responders according to epidermal growth factor receptor mutational status. (*) Log-rank test.
|
|
EGFR Mutation and Association With p-Akt/p-Erk Expression
Immunohistochemical data were assessable in 87 patients. When expression of p-Akt or p-Erk was compared with sex, histology, smoking history, and EGFR mutation, only p-Erk positivity (1+/2+) was significantly associated with nonadenocarcinoma histology (adenocarcinoma 54.0% v nonadenocarcinoma 79.2%; P = .031). p-Erk expression was also inversely associated with response (RR, 32.4% in negative v 17.0% in 1+/2+; P = .096), and TTP (6.1 months in negative v 2.3 months in 1+/2+; P = .029; Table 5). Negative p-Erk expression (negative v 1+/2+) independently showed a significant association with response (OR, 3.71; 95% CI, 1.05 to 13.1) and was significantly predictive of prolonged TTP (HR, 0.54; 95% CI, 0.32 to 0.93) in multivariate analyses considering EGFR mutational status as a covariate. OS was not associated with p-Erk expression (data not shown). On the other hand, p-Akt expression was not associated with response, TTP, or OS. However, in patients harboring EGFR mutations, overexpression of p-Akt (2+) was associated with prolonged TTP (26.9 v 5.1 months [negative/1+]; P = .010; Fig 4). In contrast, in patients without EGFR mutation, no responders exhibited p-Akt overexpression (P = .053; Table 6), and we observed a tendency toward shorter TTP in patients exhibiting p-Akt overexpression (1.2 v 2.1 months [negative/1+]; P = .056; Fig 4). OS was not affected by p-Akt expression in either group (data not shown).

View larger version (13K):
[in this window]
[in a new window]
|
Fig 4. Kaplan-Meier plots of time to progression in (A) patients with epidermal growth factor receptor mutation and (B) in patients without mutation according to phosphorylated-Akt (p-Akt) expression (negative/1+ v 2+). *Log-rank test.
|
|
Prediction of Response in Patients Without EGFR Mutation
Among 21 responders, 10 (47.6%) exhibited no EGFR mutations. The response rate in the 73 patients without mutation was 13.7% (95% CI, 5.8 to 21.6). All responses were detected in patients with non-BAC adenocarcinoma (10 of 44 patients; RR, 22.7%; 95% CI, 13.1 to 32.3; P = .005). Response rates were higher in females (20.8%) and never-smokers (21.9%; Table 6). Never-smokers with non-BAC adenocarcinoma had a RR of 25.9% (seven of 27 patients), whereas the other patients had a 6.5% RR (three of 46 patients; P = .032). Median TTP of each group was 1.7 and 1.9 months, respectively (P = .25), and median OS was 5.7 and 6.6 months, respectively (P = .48). Incorporation of immunohistochemical data into clinical factors, which were not significantly associated with one another, resulted in a response rate of 40% (four of 10 patients) in never-smokers with non-BAC adenocarcinoma exhibiting negative or weak (-/1+) p-Akt and negative p-Erk expression. The other patients showed an 8.3% response rate (five of 60 patients; P = .020). The median TTP of the former patients was 7.3 months, compared with 1.6 months in the latter (P = .030). Median OS in the two groups were 10.1 months and 6.5 months, respectively (P = .14). In summary, patients with no history of smoking, non-BAC adenocarcinoma, and low expressions of p-Akt and p-Erk are most likely to benefit from gefitinib, despite not harboring EGFR mutations.
 |
DISCUSSION
|
|---|
In the search for predictive markers of response to gefitinib, recent studies have demonstrated a significant association of EGFR mutation with response to gefitinib in NSCLC.12-14 Collectively, 20 of 24 gefitinib-sensitive tumors harbored EGFR mutation, in contrast to none in the 19 tumors with no response. All mutations in the responders were found in exons 18, 19, and 21. In this study, we have confirmed and extended the above reports, and investigated the roles of p-Akt and p-Erk expressions within the context of EGFR mutational status.
Mutations found in this study were similar to those found in previous ones. In-frame deletions in exon 19 were most frequently observed, appearing in seven patients. All deletions were found between E746 and P753, and all included amino acids L747-A750. L858R mutation was found in six patients. All patients with these two mutations reaped substantial benefits from treatment with gefitinib. Three patients harbored missense mutation in exon 18 (G719A, 2156G>C), which differs from the previous report of 2155G>T (G719C), and two of these patients had a partial response.12 It may be speculated that mutations in G719 are also associated with gefitinib sensitivity. Functional analyses of G719A and G719C mutation are warranted in future studies. E709K and A859T were novel mutations found in this study. Since E709K was found in a patient with G719A who had a temporary response to gefitinib, its association with response or resistance needs to be determined in future investigations.
Two mutations, G719A and A859T, were seen in patients with progressive disease. These two patients exhibited unfavorable immunohistochemical profiles (ie, weak [1+] p-Akt and positive [1+/2+] p-Erk). The gefitinib-resistant patient with G719A may have a resistance mechanism obviating the gefitinib-sensitizing mutation. With regard to A859T, as it is adjacent to the gefitinib-sensitivity determining L858, A859 might also have some role in interaction with gefitinib or a adenosine triphosphate. Further investigation of the consequent alterations caused by substitution of threonine for arginine is warranted.
In our patient population, EGFR mutation was found in only 52.4% (11 of 21 patients) of responders, which is lower than the 83.3% (20 of 24 patients) of previous reports.12-14 As tumor specimens analyzed were those obtained at initial diagnosis or surgery, the 10 responders without mutations might have acquired EGFR mutations in the course of their disease progression, thereby rendering them sensitive to gefitinib. In addition, DNA sequencing had not been performed in a duplicate manner, partly due to the small amount of DNA extractable from small biopsy specimens. This may also have potentially underestimated the mutation rate. However, we believe it to be quite unlikely that mutations outside the exons tested herein would explain the 10 nonmutant responders, as previous reports failed to find any mutations outside these exons, except in one of 300 patients (0.3%) in exon 20 (R776C), in 60 specimens from gefitinib- or erlotinib-treated patients, and 240 specimens with no exposure to these drugs.12-14
Our analyses of TTP and OS reveal significant differences, according to EGFR mutational status. It is expected that patients with EGFR mutation would exhibit longer TTP and OS, as EGFR mutation is significantly associated with gefitinib responsiveness. However, an unexpected finding was that TTP and OS were also distinguishable among responders, according to EGFR mutational status; responders with EGFR mutations having more favorable TTP and OS. This suggests that there may be two distinct groups of responders, namely, EGFR mutants and nonmutants. The current EGFR nonmutants may have other mechanisms of gefitinib sensitivity, which confer lower levels of sensitivity than those associated with EGFR mutation, or these non-mutants may acquire EGFR mutation in the course of their disease progression, with merely an adjunctive role compared with the primary role in patients with EGFR mutation from the outset. Analysis of tumor specimens obtained just before treatment, and investigation of other possible gefitinib-sensitizing mechanisms such as EGFR gene amplification, may provide answers to these questions.
We have also analyzed which baseline characteristics may be predictive for response in patients without EGFR mutation. All responses were observed in patients with non-BAC adenocarcinomas. Previous studies have reported that BAC is associated with gefitinib responsiveness, and EGFR mutation is frequently found in BACs.6,14 In our observations, the frequency of EGFR mutation in BACs (three of 10 patients, 30%) was similar to that seen in non-BAC adenocarcinomas (11 of 55 patients, 20%; P = .44), and no patient with BAC, but rather without EGFR mutation, was observed to respond to gefitinib. Among patients without EGFR mutation, never-smokers with non-BAC adenocarcinoma histology had a RR of 25.9%, whereas those who had smoked or had histologies other than non-BAC adenocarcinoma had the worst RR of 6.5%. We believe that this latter group of patients should leave gefitinib as the last treatment option, as they are least likely to respond.
In the present study, overexpression of p-Akt (2+) was associated with prolonged TTP in patients with EGFR mutation. As EGFR mutation was demonstrated to activate the PI3K/Akt pathway, those with p-Akt overexpression could be regarded as being more EGFR mutation dependent, and thus more sensitive to gefitinib.15 In contrast, in patients without EGFR mutation, patients with p-Akt overexpression had poor prognoses. This might be due to the EGFR independent activation of PI3K/Akt pathway rendering them more resistant to gefitinib.17-20 Thus, it may be natural that different investigators had previously reported conflicting results regarding the association between p-Akt and efficacy of gefitinib, as different study populations may differ in EGFR mutational status or other Akt activating mechanisms, which no study had taken into account.8-11 p-Erk expression was negatively associated with response and TTP, even after EGFR mutational status had been taken into account. This confirms the possibility that EGFR-independent activation of the Ras/Raf/Erk pathway may contribute to gefitinib resistance.19,21
In conclusion, EGFR mutation is significantly associated with response to gefitinib, and is strongly predictive of prolonged survival in NSCLC patients treated with gefitinib. Considering the substantial benefits of treatment with gefitinib in patients with EGFR mutation, we propose that all NSCLC patients, especially those with adenocarcinoma, should be tested for EGFR mutational status, and in patients with EGFR mutation, gefitinib must be considered as the treatment option before any other.
 |
Authors' Disclosures of Potential Conflicts of Interest
|
|---|
The following authors or their immediate family members have indicated a financial interest. No conflict exists for drugs or devices used in a study if they are not being evaluated as part of the investigation. Research Funding: Tae-You Kim, AstraZeneca. For a detailed description of this category, or for more information about ASCO's conflict of interest policy, please refer to the Author Disclosure Declaration and Disclosures of Potential Conflicts of Interest found in Information for Contributors in the front of each issue.
 |
NOTES
|
|---|
Supported in part by a grant from the Korean Health 21 R&D Project, Ministry of Health & Welfare, Republic of Korea (03-PJ10-PG13-GD01-0002); and by AstraZeneca Pharmaceuticals, Seoul, Korea.
Terms in blue are defined in the glossary, found at the end of this issue and online at www.jco.org.
Authors' disclosures of potential conflicts of interest are found at the end of this article.
 |
REFERENCES
|
|---|
1. Mendelsohn J, Baselga J: Status of epidermal growth factor receptor antagonists in the biology and treatment of cancer. J Clin Oncol 21:2787-2799, 2003[Abstract/Free Full Text]
2. Fukuoka M, Yano S, Giaccone G, et al: Multi-institutional randomized phase II trial of gefitinib for previously treated patients with advanced nonsmall-cell lung cancer. J Clin Oncol 21:2237-2246, 2003[Abstract/Free Full Text]
3. Kris MG, Natale RB, Herbst RS, et al: Efficacy of gefitinib, an inhibitor of the epidermal growth factor receptor tyrosine kinase, in symptomatic patients with non-small cell lung cancer: A randomized trial. JAMA 290:2149-2158, 2003[Abstract/Free Full Text]
4. Cortes-Funes H, Soto Parra H: Extensive experience of disease control with gefitinib and the role of prognostic markers. Br J Cancer 89:S3-S8, 2003 (suppl 2)
5. Lee DH, Han JY, Lee HG, et al: Gefitinib as a first-line therapy of advanced or metastatic adenocarcinoma of the lung in never-smokers. Clin Cancer Res: in press
6. Miller VA, Kris MG, Shah N, et al: Bronchioloalveolar pathologic subtype and smoking history predict sensitivity to gefitinib in advanced non-small-cell lung cancer. J Clin Oncol 22:1103-1109, 2004[Abstract/Free Full Text]
7. Bailey LR, Kris M, Wolf M, et al: Tumor EGFR membrane staining is not clinically relevant for predicting response in patients receiving gefitinib (Iressa, ZD1839) monotherapy for pretreated advanced non-small-cell lung cancer: IDEAL 1 and 2. Proc Am Assoc Cancer Res 44:1362, 2003 (abstr LB-170)
8. Han SW, Hwang PG, Chung DH, et al: Epidermal growth factor receptor (EGFR) downstream molecules as response predictive markers for gefitinib (Iressa®, ZD1839) in chemotherapy resistant non-small-cell lung cancer. Int J Cancer 113:109-115, 2005[CrossRef][Medline]
9. Cappuzzo F, Magrini E, Ceresoli GL, et al: Akt phosphorylation and gefitinib efficacy in patients with advanced non-small-cell lung cancer. J Natl Cancer Inst 96:1133-1141, 2004[Abstract/Free Full Text]
10. Pao W, Zakowski M, Cordon-Cardo C, et al: Molecular characteristics of non-small cell lung cancer (NSCLC) patients sensitive to gefitinib. Proc Am Soc Clin Oncol 23:619, 2004 (abstr 7025)
11. Franklin WA, Chansky K, Gumerlock PH, et al: Association between activation of ErbB pathway genes and survival following gefitinib treatment in advanced BAC (SWOG 0126). Proc Am Soc Clin Oncol 23:618, 2004 (abstr 7015)
12. Lynch TJ, Bell DW, Sordella R, et al: Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. N Engl J Med 350:2129-2139, 2004[Abstract/Free Full Text]
13. Paez JG, Janne PA, Lee JC, et al: EGFR mutations in lung cancer: Correlation with clinical response to gefitinib therapy. Science 304:1497-1500, 2004[Abstract/Free Full Text]
14. Pao W, Miller V, Zakowski M, et al: EGF receptor gene mutations are common in lung cancers from "never smokers" and are associated with sensitivity of tumors to gefitinib and erlotinib. Proc Natl Acad Sci U S A 101:13306-13311, 2004[Abstract/Free Full Text]
15. Sordella R, Bell DW, Haber DA, et al: Gefitinib-sensitizing EGFR mutations in lung cancer activate anti-apoptotic pathways. Science 305:1163-1167, 2004[Abstract/Free Full Text]
16. Miller AB, Hoogstraten B, Staquet M, et al: Reporting results of cancer treatment. Cancer 47:207-214, 1981[CrossRef][Medline]
17. Vivanco I, Sawyers CL: The phosphatidylinositol 3-Kinase AKT pathway in human cancer. Nat Rev Cancer 2:489-501, 2002[CrossRef][Medline]
18. Bianco R, Shin I, Ritter CA, et al: Loss of PTEN/MMAC1/TEP in EGF receptor-expressing tumor cells counteracts the antitumor action of EGFR tyrosine kinase inhibitors. Oncogene 22:2812-2822, 2003[CrossRef][Medline]
19. Janmaat ML, Kruyt FA, Rodriguez JA, et al: Response to epidermal growth factor receptor inhibitors in non-small cell lung cancer cells: Limited antiproliferative effects and absence of apoptosis associated with persistent activity of extracellular signal-regulated kinase or Akt kinase pathways. Clin Cancer Res 9:2316-2326, 2003[Abstract/Free Full Text]
20. She QB, Solit D, Basso A, et al: Resistance to gefitinib in PTEN-null HER-overexpressing tumor cells can be overcome through restoration of PTEN function or pharmacologic modulation of constitutive phosphatidylinositol 3'-kinase/Akt pathway signaling. Clin Cancer Res 9:4340-4346, 2003[Abstract/Free Full Text]
21. Magne N, Fischel JL, Dubreuil A, et al: Influence of epidermal growth factor receptor (EGFR), p53 and intrinsic MAP kinase pathway status of tumour cells on the antiproliferative effect of ZD1839 ("Iressa"). Br J Cancer 86:1518-1523, 2002[CrossRef][Medline]
Submitted September 21, 2004;
accepted December 21, 2004.

CiteULike Complore Connotea Del.icio.us Digg Facebook Reddit Technorati Twitter What's this?
This article has been cited by other articles:

|
 |

|
 |
 
C. M. Rudin, E. Avila-Tang, C. C. Harris, J. G. Herman, F. R. Hirsch, W. Pao, A. G. Schwartz, K. H. Vahakangas, and J. M. Samet
Lung Cancer in Never Smokers: Molecular Profiles and Therapeutic Implications
Clin. Cancer Res.,
September 15, 2009;
15(18):
5646 - 5661.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. S. Mok, Y.-L. Wu, S. Thongprasert, C.-H. Yang, D.-T. Chu, N. Saijo, P. Sunpaweravong, B. Han, B. Margono, Y. Ichinose, et al.
Gefitinib or Carboplatin-Paclitaxel in Pulmonary Adenocarcinoma
N. Engl. J. Med.,
September 3, 2009;
361(10):
947 - 957.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Rosell, T. Moran, C. Queralt, R. Porta, F. Cardenal, C. Camps, M. Majem, G. Lopez-Vivanco, D. Isla, M. Provencio, et al.
Screening for Epidermal Growth Factor Receptor Mutations in Lung Cancer
N. Engl. J. Med.,
September 3, 2009;
361(10):
958 - 967.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Ohashi, N. Takigawa, M. Osawa, E. Ichihara, H. Takeda, T. Kubo, S. Hirano, T. Yoshino, M. Takata, M. Tanimoto, et al.
Chemopreventive Effects of Gefitinib on Nonsmoking-Related Lung Tumorigenesis in Activating Epidermal Growth Factor Receptor Transgenic Mice
Cancer Res.,
September 1, 2009;
69(17):
7088 - 7095.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-K. Yoon, H.-P. Kim, S.-W. Han, H.-S. Hur, D. Y. Oh, S.-A. Im, Y.-J. Bang, and T.-Y. Kim
Combination of EGFR and MEK1/2 inhibitor shows synergistic effects by suppressing EGFR/HER3-dependent AKT activation in human gastric cancer cells
Mol. Cancer Ther.,
September 1, 2009;
8(9):
2526 - 2536.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Pao, M. G. Kris, A. J. Iafrate, M. Ladanyi, P. A. Janne, I. I. Wistuba, R. Miake-Lye, R. S. Herbst, D. P. Carbone, B. E. Johnson, et al.
Integration of Molecular Profiling into the Lung Cancer Clinic
Clin. Cancer Res.,
September 1, 2009;
15(17):
5317 - 5322.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Horn and A. Sandler
Epidermal Growth Factor Receptor Inhibitors and Antiangiogenic Agents for the Treatment of Non-Small Cell Lung Cancer
Clin. Cancer Res.,
August 15, 2009;
15(16):
5040 - 5048.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Morita, I. Okamoto, K. Kobayashi, K. Yamazaki, H. Asahina, A. Inoue, K. Hagiwara, N. Sunaga, N. Yanagitani, T. Hida, et al.
Combined Survival Analysis of Prospective Clinical Trials of Gefitinib for Non-Small Cell Lung Cancer with EGFR Mutations
Clin. Cancer Res.,
July 1, 2009;
15(13):
4493 - 4498.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Tassinari, E. Scarpi, S. Sartori, E. Tamburini, C. Santelmo, P. Tombesi, and L. Lazzari-Agli
Second-Line Treatments in Non-small Cell Lung Cancer: A Systematic Review of Literature and Metaanalysis of Randomized Clinical Trials
Chest,
June 1, 2009;
135(6):
1596 - 1609.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. K.F. Yung, K.C. A. Chan, T. S.K. Mok, J. Tong, K.-F. To, and Y.M. D. Lo
Single-Molecule Detection of Epidermal Growth Factor Receptor Mutations in Plasma by Microfluidics Digital PCR in Non-Small Cell Lung Cancer Patients
Clin. Cancer Res.,
March 15, 2009;
15(6):
2076 - 2084.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Okabe, I. Okamoto, S. Tsukioka, J. Uchida, E. Hatashita, Y. Yamada, T. Yoshida, K. Nishio, M. Fukuoka, P. A. Janne, et al.
Addition of S-1 to the Epidermal Growth Factor Receptor Inhibitor Gefitinib Overcomes Gefitinib Resistance in Non-small cell Lung Cancer Cell Lines with MET Amplification
Clin. Cancer Res.,
February 1, 2009;
15(3):
907 - 913.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Marek, K. E. Ware, A. Fritzsche, P. Hercule, W. R. Helton, J. E. Smith, L. A. McDermott, C. D. Coldren, R. A. Nemenoff, D. T. Merrick, et al.
Fibroblast Growth Factor (FGF) and FGF Receptor-Mediated Autocrine Signaling in Non-Small-Cell Lung Cancer Cells
Mol. Pharmacol.,
January 1, 2009;
75(1):
196 - 207.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Takano, T. Fukui, Y. Ohe, K. Tsuta, S. Yamamoto, H. Nokihara, N. Yamamoto, I. Sekine, H. Kunitoh, K. Furuta, et al.
EGFR Mutations Predict Survival Benefit From Gefitinib in Patients With Advanced Lung Adenocarcinoma: A Historical Comparison of Patients Treated Before and After Gefitinib Approval in Japan
J. Clin. Oncol.,
December 1, 2008;
26(34):
5589 - 5595.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-G. Wu, Y.-L. Chang, Y.-C. Hsu, J.-Y. Wu, C.-H. Yang, C.-J. Yu, M.-F. Tsai, J.-Y. Shih, and P.-C. Yang
Good Response to Gefitinib in Lung Adenocarcinoma of Complex Epidermal Growth Factor Receptor (EGFR) Mutations with the Classical Mutation Pattern
Oncologist,
December 1, 2008;
13(12):
1276 - 1284.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-J. Sohn, Y.-J. Yang, J.-S. Ryu, S. J. Oh, K. C. Im, D. H. Moon, D. H. Lee, C. Suh, J.-S. Lee, and S.-W. Kim
[18F]Fluorothymidine Positron Emission Tomography before and 7 Days after Gefitinib Treatment Predicts Response in Patients with Advanced Adenocarcinoma of the Lung
Clin. Cancer Res.,
November 15, 2008;
14(22):
7423 - 7429.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-Y. Wu, C.-J. Yu, C.-H. Yang, S.-G. Wu, Y.-H. Chiu, C.-H. Gow, Y.-C. Chang, Y.-C. Hsu, P.-F. Wei, J.-Y. Shih, et al.
First- or Second-line Therapy with Gefitinib Produces Equal Survival in Non-Small Cell Lung Cancer
Am. J. Respir. Crit. Care Med.,
October 15, 2008;
178(8):
847 - 853.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Fichtner, J. Rolff, R. Soong, J. Hoffmann, S. Hammer, A. Sommer, M. Becker, and J. Merk
Establishment of Patient-Derived Non-Small Cell Lung Cancer Xenografts as Models for the Identification of Predictive Biomarkers
Clin. Cancer Res.,
October 15, 2008;
14(20):
6456 - 6468.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S-G. Wu, C-H. Gow, C-J. Yu, Y-L. Chang, C-H. Yang, Y-C. Hsu, J-Y. Shih, Y-C. Lee, and P-C. Yang
Frequent epidermal growth factor receptor gene mutations in malignant pleural effusion of lung adenocarcinoma
Eur. Respir. J.,
October 1, 2008;
32(4):
924 - 930.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-Q. Zhu, G. da Cunha Santos, K. Ding, A. Sakurada, J.-C. Cutz, N. Liu, T. Zhang, P. Marrano, M. Whitehead, J. A. Squire, et al.
Role of KRAS and EGFR As Biomarkers of Response to Erlotinib in National Cancer Institute of Canada Clinical Trials Group Study BR.21
J. Clin. Oncol.,
September 10, 2008;
26(26):
4268 - 4275.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Tang, M. Varella-Garcia, A. C. Xavier, E. Massarelli, N. Ozburn, C. Moran, and I. I. Wistuba
Epidermal Growth Factor Receptor Abnormalities in the Pathogenesis and Progression of Lung Adenocarcinomas
Cancer Prevention Research,
August 1, 2008;
1(3):
192 - 200.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Fukui, Y. Ohe, K. Tsuta, K. Furuta, H. Sakamoto, T. Takano, H. Nokihara, N. Yamamoto, I. Sekine, H. Kunitoh, et al.
Prospective Study of the Accuracy of EGFR Mutational Analysis by High-Resolution Melting Analysis in Small Samples Obtained from Patients with Non-Small Cell Lung Cancer
Clin. Cancer Res.,
August 1, 2008;
14(15):
4751 - 4757.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M.-J. Ahn, B.-B. Park, J. S. Ahn, S. W. Kim, H.-T. Kim, J. S. Lee, J. H. Kang, J. Y. Cho, H. S. Song, S. H. Park, et al.
Are There Any Ethnic Differences in Molecular Predictors of Erlotinib Efficacy in Advanced Non-Small Cell Lung Cancer?
Clin. Cancer Res.,
June 15, 2008;
14(12):
3860 - 3866.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Felip, F. Rojo, M. Reck, A. Heller, B. Klughammer, G. Sala, S. Cedres, S. Peralta, H. Maacke, D. Foernzler, et al.
A Phase II Pharmacodynamic Study of Erlotinib in Patients with Advanced Non-Small Cell Lung Cancer Previously Treated with Platinum-Based Chemotherapy
Clin. Cancer Res.,
June 15, 2008;
14(12):
3867 - 3874.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-H. Yang, C.-J. Yu, J.-Y. Shih, Y.-C. Chang, F.-C. Hu, M.-C. Tsai, K.-Y. Chen, Z.-Z. Lin, C.-J. Huang, C.-T. Shun, et al.
Specific EGFR Mutations Predict Treatment Outcome of Stage IIIB/IV Patients With Chemotherapy-Naive Non-Small-Cell Lung Cancer Receiving First-Line Gefitinib Monotherapy
J. Clin. Oncol.,
June 1, 2008;
26(16):
2745 - 2753.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. V. Sequist, R. G. Martins, D. Spigel, S. M. Grunberg, A. Spira, P. A. Janne, V. A. Joshi, D. McCollum, T. L. Evans, A. Muzikansky, et al.
First-Line Gefitinib in Patients With Advanced Non-Small-Cell Lung Cancer Harboring Somatic EGFR Mutations
J. Clin. Oncol.,
May 20, 2008;
26(15):
2442 - 2449.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Peipp, T. Schneider-Merck, M. Dechant, T. Beyer, J. J. Lammerts van Bueren, W. K. Bleeker, P. W. H. I. Parren, J. G. J. van de Winkel, and T. Valerius
Tumor Cell Killing Mechanisms of Epidermal Growth Factor Receptor (EGFR) Antibodies Are Not Affected by Lung Cancer-Associated EGFR Kinase Mutations
J. Immunol.,
March 15, 2008;
180(6):
4338 - 4345.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Okabe, I. Okamoto, S. Tsukioka, J. Uchida, T. Iwasa, T. Yoshida, E. Hatashita, Y. Yamada, T. Satoh, K. Tamura, et al.
Synergistic antitumor effect of S-1 and the epidermal growth factor receptor inhibitor gefitinib in non-small cell lung cancer cell lines: role of gefitinib-induced down-regulation of thymidylate synthase
Mol. Cancer Ther.,
March 1, 2008;
7(3):
599 - 606.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-P. Kim, S.-W. Han, S.-H. Kim, S.-A. Im, D.-Y. Oh, Y.-J. Bang, and T.-Y. Kim
Combined lapatinib and cetuximab enhance cytotoxicity against gefitinib-resistant lung cancer cells
Mol. Cancer Ther.,
March 1, 2008;
7(3):
607 - 615.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Pinter, J. Papay, A. Almasi, Z. Sapi, E. Szabo, M. Kanya, A. Tamasi, B. Jori, E. Varkondi, J. Moldvay, et al.
Epidermal Growth Factor Receptor (EGFR) High Gene Copy Number and Activating Mutations in Lung Adenocarcinomas Are Not Consistently Accompanied by Positivity for EGFR Protein by Standard Immunohistochemistry
J. Mol. Diagn.,
March 1, 2008;
10(2):
160 - 168.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Duffy, J. Kortmansky, G. K. Schwartz, M. Capanu, S. Puleio, B. Minsky, L. Saltz, D. P. Kelsen, and E. M. O'Reilly
A phase I study of erlotinib in combination with gemcitabine and radiation in locally advanced, non-operable pancreatic adenocarcinoma
Ann. Onc.,
January 1, 2008;
19(1):
86 - 91.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Engelman, K. Zejnullahu, C.-M. Gale, E. Lifshits, A. J. Gonzales, T. Shimamura, F. Zhao, P. W. Vincent, G. N. Naumov, J. E. Bradner, et al.
PF00299804, an Irreversible Pan-ERBB Inhibitor, Is Effective in Lung Cancer Models with EGFR and ERBB2 Mutations that Are Resistant to Gefitinib
Cancer Res.,
December 15, 2007;
67(24):
11924 - 11932.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. S. Herbst, A. M. Davies, R. B. Natale, T. P. Dang, J. H. Schiller, L. L. Garland, V. A. Miller, D. Mendelson, A. D. Van den Abbeele, Y. Melenevsky, et al.
Efficacy and Safety of Single-Agent Pertuzumab, a Human Epidermal Receptor Dimerization Inhibitor, in Patients with Non Small Cell Lung Cancer
Clin. Cancer Res.,
October 15, 2007;
13(20):
6175 - 6181.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. H. Kim and C. H. Kang
Changing Pattern of Thoracic Diseases in Korea Over the Last 25 Years
Asian Cardiovasc Thorac Ann,
October 1, 2007;
15(5):
365 - 366.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Wu, M. S. O'Reilly, R. R. Langley, R. Z. Tsan, C. H. Baker, N. Bekele, X. M. Tang, A. Onn, I. J. Fidler, and R. S. Herbst
Expression of epidermal growth factor (EGF)/transforming growth factor-{alpha} by human lung cancer cells determines their response to EGF receptor tyrosine kinase inhibition in the lungs of mice
Mol. Cancer Ther.,
October 1, 2007;
6(10):
2652 - 2663.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Takano, Y. Ohe, K. Tsuta, T. Fukui, H. Sakamoto, T. Yoshida, U. Tateishi, H. Nokihara, N. Yamamoto, I. Sekine, et al.
Epidermal Growth Factor Receptor Mutation Detection Using High-Resolution Melting Analysis Predicts Outcomes in Patients with Advanced Non Small Cell Lung Cancer Treated with Gefitinib
Clin. Cancer Res.,
September 15, 2007;
13(18):
5385 - 5390.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. D. Bonomi, L. Buckingham, and J. Coon
Selecting Patients for Treatment with Epidermal Growth Factor Tyrosine Kinase Inhibitors
Clin. Cancer Res.,
August 1, 2007;
13(15):
4606s - 4612s.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. V. Karamouzis, J. R. Grandis, and A. Argiris
Therapies Directed Against Epidermal Growth Factor Receptor in Aerodigestive Carcinomas
JAMA,
July 4, 2007;
298(1):
70 - 82.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. E. Finberg, L. V. Sequist, V. A. Joshi, A. Muzikansky, J. M. Miller, M. Han, J. Beheshti, L. R. Chirieac, E. J. Mark, and A. J. Iafrate
Mucinous Differentiation Correlates with Absence of EGFR Mutation and Presence of KRAS Mutation in Lung Adenocarcinomas with Bronchioloalveolar Features
J. Mol. Diagn.,
July 1, 2007;
9(3):
320 - 326.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. C. Cho, C.-K. Im, M.-S. Park, S. K. Kim, J. Chang, J. P. Park, H. J. Choi, Y. J. Kim, S.-J. Shin, J. H. Sohn, et al.
Phase II Study of Erlotinib in Advanced Non-Small-Cell Lung Cancer After Failure of Gefitinib
J. Clin. Oncol.,
June 20, 2007;
25(18):
2528 - 2533.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Taguchi, B. Solomon, V. Gregorc, H. Roder, R. Gray, K. Kasahara, M. Nishio, J. Brahmer, A. Spreafico, V. Ludovini, et al.
Mass Spectrometry to Classify Non-Small-Cell Lung Cancer Patients for Clinical Outcome After Treatment With Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors: A Multicohort Cross-Institutional Study
J Natl Cancer Inst,
June 6, 2007;
99(11):
838 - 846.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Horiike, H. Kimura, K. Nishio, F. Ohyanagi, Y. Satoh, S. Okumura, Y. Ishikawa, K. Nakagawa, T. Horai, and M. Nishio
Detection of Epidermal Growth Factor Receptor Mutation in Transbronchial Needle Aspirates of Non-Small Cell Lung Cancer
Chest,
June 1, 2007;
131(6):
1628 - 1634.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Massarelli, M. Varella-Garcia, X. Tang, A. C. Xavier, N. C. Ozburn, D. D. Liu, B. N. Bekele, R. S. Herbst, and I. I. Wistuba
KRAS Mutation Is an Important Predictor of Resistance to Therapy with Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors in Non-Small-Cell Lung Cancer
Clin. Cancer Res.,
May 15, 2007;
13(10):
2890 - 2896.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. J. Tebbutt, A. James, and P. D. Pare
Single-Nucleotide Polymorphisms and Lung Disease: Clinical Implications
Chest,
April 1, 2007;
131(4):
1216 - 1223.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Hirsch, M Varella-Garcia, F Cappuzzo, J McCoy, L Bemis, A. Xavier, R Dziadziuszko, P Gumerlock, K Chansky, H West, et al.
Combination of EGFR gene copy number and protein expression predicts outcome for advanced non-small-cell lung cancer patients treated with gefitinib
Ann. Onc.,
April 1, 2007;
18(4):
752 - 760.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Braiteh and R. Kurzrock
Uncommon tumors and exceptional therapies: paradox or paradigm?
Mol. Cancer Ther.,
April 1, 2007;
6(4):
1175 - 1179.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Okabe, I. Okamoto, K. Tamura, M. Terashima, T. Yoshida, T. Satoh, M. Takada, M. Fukuoka, and K. Nakagawa
Differential Constitutive Activation of the Epidermal Growth Factor Receptor in Non-Small Cell Lung Cancer Cells Bearing EGFR Gene Mutation and Amplification
Cancer Res.,
March 1, 2007;
67(5):
2046 - 2053.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. V. Sequist, D. W. Bell, T. J. Lynch, and D. A. Haber
Molecular Predictors of Response to Epidermal Growth Factor Receptor Antagonists in Non-Small-Cell Lung Cancer
J. Clin. Oncol.,
February 10, 2007;
25(5):
587 - 595.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. K. Rho, Y. J. Choi, B.-Y. Ryoo, I. I. Na, S. H. Yang, C. H. Kim, and J. C. Lee
p53 Enhances Gefitinib-Induced Growth Inhibition and Apoptosis by Regulation of Fas in Non-Small Cell Lung Cancer
Cancer Res.,
February 1, 2007;
67(3):
1163 - 1169.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Toschi and F. Cappuzzo
Understanding the New Genetics of Responsiveness to Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors
Oncologist,
February 1, 2007;
12(2):
211 - 220.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N van Zandwijk, A Mathy, L Boerrigter, H Ruijter, I Tielen, D de Jong, P Baas, S Burgers, and P Nederlof
EGFR and KRAS mutations as criteria for treatment with tyrosine kinase inhibitors: retro- and prospective observations in non-small-cell lung cancer
Ann. Onc.,
January 1, 2007;
18(1):
99 - 103.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Shrader, M. S. Pino, G. Brown, P. Black, L. Adam, M. Bar-Eli, C. P.N. Dinney, and D. J. McConkey
Molecular correlates of gefitinib responsiveness in human bladder cancer cells
Mol. Cancer Ther.,
January 1, 2007;
6(1):
277 - 285.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. M. Chin, D. Anuar, R. Soo, M. Salto-Tellez, W. Q. Li, B. Ahmad, S. C. Lee, B. C. Goh, K. Kawakami, A. Segal, et al.
Detection of Epidermal Growth Factor Receptor Variations by Partially Denaturing HPLC
Clin. Chem.,
January 1, 2007;
53(1):
62 - 70.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. V. Sequist, V. A. Joshi, P. A. Janne, A. Muzikansky, P. Fidias, M. Meyerson, D. A. Haber, R. Kucherlapati, B. E. Johnson, and T. J. Lynch
Response to treatment and survival of patients with non-small cell lung cancer undergoing somatic EGFR mutation testing.
Oncologist,
January 1, 2007;
12(1):
90 - 98.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Rosell, M. Taron, N. Reguart, D. Isla, and T. Moran
Epidermal Growth Factor Receptor Activation: How Exon 19 and 21 Mutations Changed Our Understanding of the Pathway
Clin. Cancer Res.,
December 15, 2006;
12(24):
7222 - 7231.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. J. Riely, K. A. Politi, V. A. Miller, and W. Pao
Update on Epidermal Growth Factor Receptor Mutations in Non-Small Cell Lung Cancer
Clin. Cancer Res.,
December 15, 2006;
12(24):
7232 - 7241.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. R. Hirsch, M. Varella-Garcia, P. A. Bunn Jr, W. A. Franklin, R. Dziadziuszko, N. Thatcher, A. Chang, P. Parikh, J. R. Pereira, T. Ciuleanu, et al.
Molecular Predictors of Outcome With Gefitinib in a Phase III Placebo-Controlled Study in Advanced Non-Small-Cell Lung Cancer
J. Clin. Oncol.,
November 1, 2006;
24(31):
5034 - 5042.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Su, C. Bodenstein, R. A. Dumont, Y. Seimbille, S. Dubinett, M. E. Phelps, H. Herschman, J. Czernin, and W. Weber
Monitoring Tumor Glucose Utilization by Positron Emission Tomography for the Prediction of Treatment Response to Epidermal Growth Factor Receptor Kinase Inhibitors.
Clin. Cancer Res.,
October 1, 2006;
12(19):
5659 - 5667.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. D. Carey, A. J. Garton, M. S. Romero, J. Kahler, S. Thomson, S. Ross, F. Park, J. D. Haley, N. Gibson, and M. X. Sliwkowski
Kinetic Analysis of Epidermal Growth Factor Receptor Somatic Mutant Proteins Shows Increased Sensitivity to the Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitor, Erlotinib
Cancer Res.,
August 15, 2006;
66(16):
8163 - 8171.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W.-C. Chou, S.-F. Huang, K.-Y. Yeh, H.-M. Wang, M.-Y. Liu, J.-J. Hsieh, Y.-C. Cheung, and J. W.-C. Chang
Different Responses to Gefitinib in Lung Adenocarcinoma Coexpressing Mutant- and Wild-Type Epidermal Growth Factor Receptor Genes
Jpn. J. Clin. Oncol.,
August 1, 2006;
36(8):
523 - 526.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Inoue, T. Suzuki, T. Fukuhara, M. Maemondo, Y. Kimura, N. Morikawa, H. Watanabe, Y. Saijo, and T. Nukiwa
Prospective Phase II Study of Gefitinib for Chemotherapy-Naive Patients With Advanced Non-Small-Cell Lung Cancer With Epidermal Growth Factor Receptor Gene Mutations
J. Clin. Oncol.,
July 20, 2006;
24(21):
3340 - 3346.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. A. Janne
Gefitinib for Epidermal Growth Factor Receptor Mutant Lung Cancers: Searching for a Weapon of Mass Destruction
J. Clin. Oncol.,
July 20, 2006;
24(21):
3319 - 3321.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. L. Kwak, J. Jankowski, S. P. Thayer, G. Y. Lauwers, B. W. Brannigan, P. L. Harris, R. A. Okimoto, S. M. Haserlat, D. R. Driscoll, D. Ferry, et al.
Epidermal growth factor receptor kinase domain mutations in esophageal and pancreatic adenocarcinomas.
Clin. Cancer Res.,
July 15, 2006;
12(14):
4283 - 4287.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Engelman and L. C. Cantley
The Role of the ErbB Family Members in Non-Small Cell "Lung Cancers Sensitive to Epidermal Growth Factor Receptor Kinase Inhibitors".
Clin. Cancer Res.,
July 15, 2006;
12(14):
4372s - 4376s.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. V. Sequist, V. A. Joshi, P. A. Janne, D. W. Bell, P. Fidias, N. I. Lindeman, D. N. Louis, J. C. Lee, E. J. Mark, J. Longtine, et al.
Epidermal growth factor receptor mutation testing in the care of lung cancer patients.
Clin. Cancer Res.,
July 15, 2006;
12(14):
4403s - 4408s.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Dziadziuszko, F. R. Hirsch, M. Varella-Garcia, and P. A. Bunn Jr.
Selecting Lung Cancer Patients for Treatment with Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors by Immunohistochemistry and Fluorescence In situ Hybridization--Why, When, and How?
Clin. Cancer Res.,
July 15, 2006;
12(14):
4409s - 4415s.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. A. Janne and B. E. Johnson
Effect of epidermal growth factor receptor tyrosine kinase domain mutations on the outcome of patients with non-small cell lung cancer treated with epidermal growth factor receptor tyrosine kinase inhibitors.
Clin. Cancer Res.,
July 15, 2006;
12(14):
4416s - 4420s.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. H. Johnson
Targeted therapies in combination with chemotherapy in non-small cell lung cancer.
Clin. Cancer Res.,
July 15, 2006;
12(14):
4451s - 4457s.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Yatabe, T. Hida, Y. Horio, T. Kosaka, T. Takahashi, and T. Mitsudomi
A Rapid, Sensitive Assay to Detect EGFR Mutation in Small Biopsy Specimens from Lung Cancer
J. Mol. Diagn.,
July 1, 2006;
8(3):
335 - 341.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Sonobe, T. Manabe, H. Wada, and F. Tanaka
Lung Adenocarcinoma Harboring Mutations in the ERBB2 Kinase Domain
J. Mol. Diagn.,
July 1, 2006;
8(3):
351 - 356.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Hidalgo, M. L. Amador, A. Jimeno, H. Mezzadra, P. Patel, A. Chan, M. E. Nielsen, A. Maitra, and S. Altiok
Assessment of gefitinib- and CI-1040-mediated changes in epidermal growth factor receptor signaling in HuCCT-1 human cholangiocarcinoma by serial fine needle aspiration.
Mol. Cancer Ther.,
July 1, 2006;
5(7):
1895 - 1903.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. W. Bell and D. A. Haber
A Blood-Based Test for Epidermal Growth Factor Receptor Mutations in Lung Cancer.
Clin. Cancer Res.,
July 1, 2006;
12(13):
3875 - 3877.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. M. Jackman, B. Y. Yeap, L. V. Sequist, N. Lindeman, A. J. Holmes, V. A. Joshi, D. W. Bell, M. S. Huberman, B. Halmos, M. S. Rabin, et al.
Exon 19 Deletion Mutations of Epidermal Growth Factor Receptor Are Associated with Prolonged Survival in Non-Small Cell Lung Cancer Patients Treated with Gefitinib or Erlotinib.
Clin. Cancer Res.,
July 1, 2006;
12(13):
3908 - 3914.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Kimura, K. Kasahara, M. Kawaishi, H. Kunitoh, T. Tamura, B. Holloway, and K. Nishio
Detection of Epidermal Growth Factor Receptor Mutations in Serum as a Predictor of the Response to Gefitinib in Patients with Non-Small-Cell Lung Cancer.
Clin. Cancer Res.,
July 1, 2006;
12(13):
3915 - 3921.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. A. Bunn Jr., R. Dziadziuszko, M. Varella-Garcia, W. A. Franklin, S. E. Witta, K. Kelly, and F. R. Hirsch
Biological Markers for Non-Small Cell Lung Cancer Patient Selection for Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitor Therapy.
Clin. Cancer Res.,
June 15, 2006;
12(12):
3652 - 3656.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K.-H. Lee, S.-W. Han, P. G. Hwang, D.-Y. Oh, D.-W. Kim, D. H. Chung, S.-A. Im, T.-Y. Kim, D. S. Heo, and Y.-J. Bang
Epidermal Growth Factor Receptor Mutations and Response to Chemotherapy in Patients with Non-Small-Cell Lung Cancer.
Jpn. J. Clin. Oncol.,
June 1, 2006;
36(6):
344 - 350.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Ramalingam and A. B. Sandler
Salvage therapy for advanced non-small cell lung cancer: factors influencing treatment selection.
Oncologist,
June 1, 2006;
11(6):
655 - 665.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Politi, M. F. Zakowski, P.-D. Fan, E. A. Schonfeld, W. Pao, and H. E. Varmus
Lung adenocarcinomas induced in mice by mutant EGF receptors found in human lung cancers respond to a tyrosine kinase inhibitor or to down-regulation of the receptors
Genes & Dev.,
June 1, 2006;
20(11):
1496 - 1510.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-K. Toh, F. Gao, W.-T. Lim, S.-S. Leong, K.-W. Fong, S.-P. Yap, A. A.L. Hsu, P. Eng, H.-N. Koong, A. Thirugnanam, et al.
Never-Smokers With Lung Cancer: Epidemiologic Evidence of a Distinct Disease Entity
J. Clin. Oncol.,
May 20, 2006;
24(15):
2245 - 2251.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Dziadziuszko, S. E. Witta, F. Cappuzzo, S. Park, K. Tanaka, P. V. Danenberg, A. E. Baron, L. Crino, W. A. Franklin, P. A. Bunn Jr., et al.
Epidermal growth factor receptor messenger RNA expression, gene dosage, and gefitinib sensitivity in non-small cell lung cancer.
Clin. Cancer Res.,
May 15, 2006;
12(10):
3078 - 3084.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Calvo and J. Baselga
Ethnic Differences in Response to Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors
J. Clin. Oncol.,
May 10, 2006;
24(14):
2158 - 2163.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-W. Han, T.-Y. Kim, Y. K. Jeon, P. G. Hwang, S.-A. Im, K.-H. Lee, J. H. Kim, D.-W. Kim, D. S. Heo, N. K. Kim, et al.
Optimization of Patient Selection for Gefitinib in Non-Small Cell Lung Cancer by Combined Analysis of Epidermal Growth Factor Receptor Mutation, K-ras Mutation, and Akt Phosphorylation
Clin. Cancer Res.,
April 15, 2006;
12(8):
2538 - 2544.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Pham, M. G. Kris, G. J. Riely, I. S. Sarkaria, T. McDonough, S. Chuai, E. S. Venkatraman, V. A. Miller, M. Ladanyi, W. Pao, et al.
Use of Cigarette-Smoking History to Estimate the Likelihood of Mutations in Epidermal Growth Factor Receptor Gene Exons 19 and 21 in Lung Adenocarcinomas
J. Clin. Oncol.,
April 10, 2006;
24(11):
1700 - 1704.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Takano, Y. Ohe, I. Sekine, H. Kunitoh, T. Yoshida, and T. Tamura
In Reply:
J. Clin. Oncol.,
March 1, 2006;
24(7):
1221 - 1221.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Conde, B. Angulo, M. Tang, M. Morente, J. Torres-Lanzas, A. Lopez-Encuentra, F. Lopez-Rios, and M. Sanchez-Cespedes
Molecular Context of the EGFR Mutations: Evidence for the Activation of mTOR/S6K Signaling
Clin. Cancer Res.,
February 1, 2006;
12(3):
710 - 717.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. J. Riely, W. Pao, D. Pham, A. R. Li, N. Rizvi, E. S. Venkatraman, M. F. Zakowski, M. G. Kris, M. Ladanyi, and V. A. Miller
Clinical Course of Patients with Non-Small Cell Lung Cancer and Epidermal Growth Factor Receptor Exon 19 and Exon 21 Mutations Treated with Gefitinib or Erlotinib
Clin. Cancer Res.,
February 1, 2006;
12(3):
839 - 844.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. K. Bergsland
When Does the Presence of the Target Predict Response to the Targeted Agent?
J. Clin. Oncol.,
January 10, 2006;
24(2):
213 - 216.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. W. Bell, T. J. Lynch, S. M. Haserlat, P. L. Harris, R. A. Okimoto, B. W. Brannigan, D. C. Sgroi, B. Muir, M. J. Riemenschneider, R. B. Iacona, et al.
Epidermal Growth Factor Receptor Mutations and Gene Amplification in Non-Small-Cell Lung Cancer: Molecular Analysis of the IDEAL/INTACT Gefitinib Trials
J. Clin. Oncol.,
November 1, 2005;
23(31):
8081 - 8092.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Schwab, F. Pinter, J. Moldavy, J. Papay, J. Strausz, L. Kopper, G. Keri, A. Pap, I. Petak, K. Oreskovich, et al.
Modern Treatment of Lung Cancer: CASE 1. Amplification and Mutation of the Epidermal Growth Factor Receptor in Metastatic Lung Cancer With Remission From Gefitinib
J. Clin. Oncol.,
October 20, 2005;
23(30):
7736 - 7738.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Nabhan, J. D. Bitran, T. Takano, Y. Ohe, W. Pao, M. Ladanyi, V. A. Miller, the Lung Cancer Oncogenome Group, F. A. Shepherd, L. Seymour, et al.
Erlotinib in lung cancer.
N. Engl. J. Med.,
October 20, 2005;
353(16):
1739 - 1741.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. E. Johnson and P. A. Janne
Selecting Patients for Epidermal Growth Factor Receptor Inhibitor Treatment: A FISH Story or a Tale of Mutations?
J. Clin. Oncol.,
October 1, 2005;
23(28):
6813 - 6816.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. G. Kris
How Today's Developments in the Treatment of Non-Small Cell Lung Cancer Will Change Tomorrow's Standards of Care
Oncologist,
October 1, 2005;
10(suppl_2):
23 - 29.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. E. Johnson and P. A. Janne
Epidermal Growth Factor Receptor Mutations in Patients with Non-Small Cell Lung Cancer
Cancer Res.,
September 1, 2005;
65(17):
7525 - 7529.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. P. Dicker and U. Rodeck
Predicting the Future From Trials of the Past: Epidermal Growth Factor Receptor Expression and Outcome of Fractionated Radiation Therapy Trials
J. Clin. Oncol.,
August 20, 2005;
23(24):
5437 - 5439.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. D. Blanke
Gefitinib in Colorectal Cancer: If Wishes Were Horses
J. Clin. Oncol.,
August 20, 2005;
23(24):
5446 - 5449.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Mukohara, J. A. Engelman, N. H. Hanna, B. Y. Yeap, S. Kobayashi, N. Lindeman, B. Halmos, J. Pearlberg, Z. Tsuchihashi, L. C. Cantley, et al.
Differential Effects of Gefitinib and Cetuximab on Non-small-cell Lung Cancers Bearing Epidermal Growth Factor Receptor Mutations
J Natl Cancer Inst,
August 17, 2005;
97(16):
1185 - 1194.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|