Advertisement
Journal of Clinical Oncology  
Search for:
Limit by:
  Browse by Subject or Issue
Home Search or Browse JCO My JCO Subscriptions Customer Service Site Map

Journal of Clinical Oncology, Vol 23, No 13 (May 1), 2005: pp. 3038-3042
© 2005 American Society of Clinical Oncology.
DOI: 10.1200/JCO.2005.00.885

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wu, S.
Right arrow Articles by Seeger, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wu, S.
Right arrow Articles by Seeger, K.

Expression of Interleukin-10 Splicing Variants Is a Positive Prognostic Feature in Relapsed Childhood Acute Lymphoblastic Leukemia

Shuling Wu, Reinhard Geßner, Tillmann Taube, Arend von Stackelberg, Günter Henze, Karl Seeger

From the Department of Pediatric Oncology/Hematology, and Institute of Laboratory Medicine and Biochemistry, Charité Medical Center, Humboldt University at Berlin, Berlin, Germany

Address reprint requests to Shuling Wu, MD, Institute of Laboratory Medicine and Pathobiochemistry, Charité Medical Center, Humboldt University Berlin, Augustenburger Platz 1, 13353 Berlin, Germany; e-mail: shuling.wu{at}charite.de


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 REFERENCES
 
PURPOSE: Biologic features of hematologic malignancies have prognostic implications and are essential elements in the design of current therapeutic trials. This study aimed to determine the expression of a splicing-derived variant of interleukin (IL) -10 in leukemic cells and its clinical relevance in children with acute lymphoblastic leukemia (ALL) at first relapse.

PATIENTS AND METHODS: Between January 1997 and December 2001, bone marrow (BM) samples were collected from 98 children with first relapse of ALL at diagnosis. These patients were enrolled in the relapse trial ALL-REZ BFM (ALL-Relapse Berlin-Frankfurt-Münster) 95 and 96. The detection of IL-10 isoforms in leukemic cells of BM samples were performed by conventional reverse transcriptase polymerase chain reaction and by immunoblotting.

RESULTS: IL-10 was detected in 93.9% BM samples. In addition to expressing full-length IL-10, a new splicing-derived IL-10 variant (termed IL-10{delta}3) that lacked the entire exon 3 was identified in leukemic cells. The IL-10{delta}3 variant was found in 80.4% of BM samples. Most importantly, expression of IL-10{delta}3 was associated with a significantly better response to chemotherapy (P = .001) and probability of event-free survival (P = .01) at 5 years.

CONCLUSION: These results indicate that splicing-derived IL-10 isoforms may modulate IL-10–mediated biologic effects and therapeutic efficacy in lymphatic disease, and expression of IL-10{delta}3 is a positive prognostic feature in relapsed childhood ALL.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 REFERENCES
 
In childhood acute lymphoblastic leukemia (ALL), cure rates of 70% to 80% are achieved by contemporary polychemotherapy regimens.1 However, despite intensified and more toxic treatment, only 40% are cured at relapse.2 Factors implicated in the control of response to therapy and resistance of leukemic cells include cytokines and cytokine receptors.3 Among these, interleukin-10 (IL-10) displays a broad spectrum of biologic activities, not only in mature immune cells, including immunosuppressive, anti-inflammatory and B-cell–stimulating properties,4 but also in the differentiation of immature hematopoietic cells. In addition to these physiological features in normal hematopoiesis, IL-10, like other cytokines or their receptors, has been proposed to promote pathogenesis of leukemic cells.5-7

Prevention of cell death by IL-10 is transmitted via the induction of the antiapoptotic protein bcl-2, and by stimulating cell proliferation via an autocrine loop.5,6 Both effects in addition to the suppression of T-cell immune responses have recently been suggested to confer a selective growth advantage to neoplastic cells promoting the pathogenesis of B-chronic lymphocytic leukemia (B-CLL) and lymphoma.7 Concerning the clinical relevance of IL-10 in B-CLL and Hodgkin's lymphoma, elevated IL-10 levels were associated with shorter failure-free survival and with poor prognostic features.8,9 In addition, genetic variations (eg, polymorphisms) within the IL-10 gene have been shown to affect initial response to therapy.10

Genetic variants of cytokines and cytokine receptors have been demonstrated frequently in a variety of cell types, including leukemic cells.11-13 Although most splicing-derived isoforms have not been functionally defined, some have been shown to possess antagonistic activities and to act competitively with the native cytokines and receptors.14-16 To date, alternative splice variants of IL-10 have not been described. In this study, we report on the detection of a new variant of IL-10 (termed IL-10{delta}3) and its clinical relevance in the outcome of children with ALL at first relapse.


    PATIENTS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 REFERENCES
 
Patients
Bone marrow (BM) samples were collected from children with first relapse of ALL at diagnosis after prior consent was obtained from their parents or guardians. Inclusion criteria in this retrospective study were a high degree of BM involvement (> 80% leukemic blasts) as well as availability and quality of mRNA. A total of 98 of 391 children enrolled in the relapse trials ALL-REZ BFM 95 and 96 (Berlin-Frankfurt-Münster) between January 1997 and December 2001 matched these inclusion criteria. Analyzed patients were representative of the overall population with the exception of peripheral blast cell count and time point of relapse. These differences are interrelated with the inclusion criterion of high proportion of leukemic cells in the bone marrow. Relapse trials were approved by the Institutional Medical Board. The median age of the patients was 9.3 years (range, 1.29 years to 17.64 years) and the male:female ratio was 1.65:1. Median follow-up time was 217 days (range, 1 day to 1,595 days).

Isolation of Leukemic Cells of BM Samples From Patients With ALL
Mononuclear cells were collected by centrifugation on a Ficoll density gradient (Biochrom, Berlin, Germany), and cryopreserved in liquid nitrogen. All analyzed BM samples contained more than 90% blasts after Ficoll density gradient centrifugation.

Immunodetection of IL-10 Isoforms
For the detection of IL-10 isoforms, the total protein extracts from leukemic cells of BM samples were lysed in ice-cold lysis buffer (20 mmol/L Tris, 120 mmol/L NaCl, 5 mmol/L KCl, and 10 mmol/L glucose at pH 7.4, plus a protease inhibitor cocktail) and homogenized with a douncer (IKA Labortechnik, Staufen, Germany). For immunoblotting, 50 µg of protein extract was separated on 15% sodium dodecyl sulfate (SDS) -polyacrylamide gel electrophoresis (PAGE; Amersham Biosciences, Freiburg, Germany) and transferred to polyvinylidene difluoride (PVDF) membrane (Amersham Biosciences). Polyclonal antibody against human IL-10 was purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Recombined hIL-10 (R&D Systems, Wiesbaden, Germany) and polyclonal antibody against ß-actin (Sigma-Aldrich, Munich, Germany) were used as positive and loading control, respectively.

RNA Extraction, Reverse Transcriptase Polymerase Chain Reaction, and Sequencing
Total RNA was isolated by RNAeasy Kit (Qiagen, Hilden, Germany). Reverse transcription (RT) was performed on 2 µg of total RNA. For the detection of IL-10 splice variants, the entire coding region of IL-10 was amplified by polymerase chain reaction (PCR; sense primers: ATGCACAGCTCAGCACTGCT; antisense primers: TCAGTTTCGTATCTTCATTGTCAT; TIB-Molbiol, Berlin Germany). The PCR reaction mixture (30 µL) containing 1 mmol/L dNTP mix (Life Technologies, Karlruhe, Germany), 0.3 µmol/L of each oligonucleotide primer, 1 U of AmpliTaqGold DNA Polymerase (Roche, Branchburg, NJ), and 100 ng of sample cDNA in PCR buffer was amplified in a PTC-200 Thermal Cycler (Biozym Diagnosik GmbH, Oldendorf, Germany). Cycle conditions were as follows: initial denaturation at 94°C for 10 minutes, followed by 35 cycles at 94°C for 45 seconds, 62°C for 30 seconds, 72°C for 1.25 minutes, and a final elongation at 72°C for 10 minutes. The amplification products were separated by agarose gel electrophoresis (Life Technologies) and visualized by ethidium bromide staining. All assays were done in duplicate. BM samples of negative IL-10{delta}3 expression were confirmed by nested PCR. For sequencing of IL-10 and its alternative splice variant, the corresponding bands were excised, and the DNA purified by centrifugation at 6,000 rpm for 15 minutes using an Ultra-DNA-column (Amicon-Millipore Corporation, Bedford MA), and directly sequenced using an ABI Sequence Detector (model 377, Applied Biosystems, Foster City, CA).

Statistical analysis
The statistical analysis entailed the Mann-Whitney U test, the Wilcoxon rank sum tests, Fisher's exact test, and the Kaplan-Meier method for the analysis of the probabilities of event-free survival (pEFS). Differences between IL-10 expression with or without alternative splice variants were analyzed by the SPSS Software for Windows (version 11; SPSS Inc, Chicago, IL). The statistical level of significance was set to P < .05.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 REFERENCES
 
In this study, we assessed the expression of IL-10 in leukemic cells from children with relapsed ALL and additionally found an unknown splicing-derived IL-10 variant (termed IL-10{delta}3), as well as its protein isoform in leukemic cells. Full-length IL-10 consists of five exons (537 base pairs [bp]) encoding a 178-amino acid (AA) –long, 18.5 kDa nonglycosylated protein. As demonstrated in panels A and B of Figure 1, leukemic cells of BM samples expressed a shorter molecule in addition to full-length IL-10 by immunoblotting and by RT-PCR. Sequencing revealed the existence of an in-frame IL-10 splice variant lacking the entire exon 3 (IL-10{delta}3; 153 bp [nucleotides, 226 to378, corresponding to amino acids 72 to 126]). The in-frame splice variant resulting from exon skipping of exon 3 (GT-AG common splicing consensus sequences) does not cause alteration of the translational reading frame. This discovery prompted us to further investigate its expression frequency in BM samples and its clinical relevance in children with relapsed ALL.



View larger version (23K):
[in this window]
[in a new window]
 
Fig 1. Expression of IL10 protein isoforms and transcripts in leukemic cells ([A] representative immunoblot; [B] polymerase chain reaction) as well as probabilities of event-free survival (EFS; C) depending on the expression of IL10{delta}3 in children with first relapse of acute lymphoblastic leukemia. Ctr, positive control of IL10; LC, lymphoblastic cells; M, DNA marker; bp, base pairs.

 
Using conventional RT-PCR, we analyzed the gene expression of IL-10 and IL-10{delta}3 in leukemic cells of BM samples obtained from 98 children with first relapse of ALL. Full-length IL-10 transcript was expressed in 93.9% BM samples and was the sole variant in 18.4% BM samples. Besides expressing full-length IL-10, 80.4% of BM samples additionally expressed the IL-10{delta}3 variant. The frequencies of IL-10{delta}3 in B-cell precursor (BCP)-ALL and pre-T/T-ALL were 83.5% and 42.9%, respectively. No sample expressed IL-10{delta}3 exclusively. In 6 BM samples (5 BCP-ALL, 1 T-ALL), IL-10 expression was below detection limit.

Analysis of clinical relevance revealed a strong correlation between IL-10{delta}3 expression and response to therapy as well as clinical outcome. Response to therapy has been shown to be the most significant predictor of outcome for children with ALL at first presentation17 and at relapse.18 As summarized in Table 1, nonresponse to therapy (reinduction failure) was observed in only 12% of patients displaying IL-10{delta}3 expression in leukemic cells compared with 39% and 17% with exclusive or no expression of IL-10, respectively (P = .001). Most importantly, in the analyses of pEFS, patients with IL-10{delta}3 expression in leukemic cells had a significantly better pEFS (0.43 v 0.00; P = .01) at five years compared with patients expressing only the normal IL-10 transcript (Fig 1C).


View this table:
[in this window]
[in a new window]
 
Table 1. Characteristics of Children With First Relapse of ALL by IL-10{delta}3 Expression

 
At relapse, the duration of first complete remission, the site of relapse, and the immune phenotype of leukemic cells constitute the most significant independent prognostic determinants for children with first relapse of ALL.2 However, no statistically significant differences in expression of IL-10{delta}3 were found regarding these prognostic risk factors.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 REFERENCES
 
ALL relapse is suggested to result from treatment failure due to leukemic cells being resistant to chemotherapy and/or escaping immune surveillance. Due to the association of IL-10 expression with disease progression reported in previous studies,5 it is conceivable that IL-10 may play an active role in relapse of ALL by supporting chemoresistance and inhibition of immunocompetent cells. Here, we could demonstrate that IL-10{delta}3 expression correlated with a significantly better response to chemotherapy and clinical outcome of children with relapsed ALL, indicating that this IL-10 isoform may have an important function in modulating the biologic activity of normal IL-10. This may account for the less aggressive biologic behavior of IL-10{delta}3–expressing leukemic cells.

This assumption is substantiated by biochemical and molecular studies on IL-10 and its interaction with the respective receptor chain as well as with other receptor chains. The crystal structure of IL-10 reveals a 37 kDa noncovalent homodimer of two intertwined {alpha}-helical peptide chains that contain six {alpha}-helices labeled A through F. The residues forming the receptor-binding interface of IL-10 are located near the N-terminus of helix A, the AB loop, and the C-terminus of helix F.19 Exon 3 encodes Gly58-Cys108, which form the helices C, D as well as the connecting loops BC (3AA) and CD (7AA). Accordingly, the IL-10{delta}3 isoform possesses the sequence necessary for binding to high affinity IL-10R1. Although the IL-10 region encoded by exon 3 contains two Cys62 and Cys108 residues required for intramolecular disulfide linking (Cys12:Cys108; Cys62:Cys114), the presence of the disulfide bonds might not be absolutely necessary for maintaining the IL-10 fold and the absence of the Cys62:Cys114 disulfide bond might be in favor of monomeric IL-10.20 On the other hand, an increasing number of IL-10–elated cytokines has been discovered to transmit signals through heterodimeric cytokine receptor family type II complexes.

For example, the long chain IL-22R is complemented by IL-10R2. The specific tissue expression combined with common subunits determines the function of the respective IL-10 family member. Whether the exclusion of exon 3 by exon skipping leads to altered ligand-receptor interactions with decisive functional consequences, including the change of receptor binding affinity, remains to be determined. The biologic effects could result from different activities of the splicing-derived isoform with respect to IL-10 receptor binding activity and, in some cases, also from competitive interactions between coexpressed isoforms. This could affect, as observed in this study, the course of ALL as well as, in more general terms, the regulation of the immune system. To validate these findings in larger numbers of patients in prospective studies and to reveal the molecular mechanisms leading to these effects will be the goal of future studies.


    Authors' Disclosures of Potential Conflicts of Interest
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 REFERENCES
 
The authors indicated no potential conflicts of interest.


    Acknowledgment
 
We thank Claudia Hanel and Gabriele Körner for the excellent technical assistance.


    NOTES
 
Supported by a grant from the Deutsche Krebshilfe, Bonn, Germany, and by KINDerLEBEN, Kinderkrebsforschungszentrum Berlin, Germany.

Authors' disclosures of potential conflicts of interest are found at the end of this article.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 REFERENCES
 
1. Pui CH: Recent advances in the biology and treatment of childhood acute lymphoblastic leukemia. Curr Opin Hematol 5:292-301, 1998[Medline]

2. Henze G, von Stackelberg A: Treatment of Relapsed Childhood Acute Lymphoblastic Leukemia: Treatment of Acute Leukemias—New Directions for Clinical Research. Totowa, NJ, Human Press, 2002, pp 199-219

3. Lotem J, Sachs L: Cytokine control of developmental programs in normal hematopoiesis and leukemia. Oncogene 21:3284-3294, 2002[CrossRef][Medline]

4. Mocellin S, Panelli MC, Wang E, et al: The dual role of IL-10. Trends Immunol 24:36-43, 2003[CrossRef][Medline]

5. Baiocchi RA, Ross ME, Tan JC, et al: Lymphomagenesis in the SCID-hu mouse involves abundant production of human interleukin-10. Blood 85:1063-1074, 1995[Abstract/Free Full Text]

6. Levy Y, Brouet JC: Interleukin-10 prevents spontaneous death of germinal center B cells by induction of the bcl-2 protein. J Clin Invest 93:424-428, 1994

7. Khatri VP, Caligiuri MA: A review of the association between interleukin-10 and human B-cell malignancies. Cancer Immunol Immunother 46:239-244, 1998[CrossRef][Medline]

8. Fayad L, Keating M, Reuben JM, et al: Interleukin-6 and interleukin-10 levels in chronic lymphocytic leukemia: Correlation with phenotypic characteristics and outcome. Blood 97:256-263, 2001[Abstract/Free Full Text]

9. Vassilakopoulos TP, Nadali G, Angelopoulou MK, et al: Serum interleukin-10 levels are an independent prognostic factor for patients with Hodgkin's lymphoma. Haematologica 86:274-281, 2001[Abstract/Free Full Text]

10. Lauten M, Matthias T, Stanulla M, et al: Association of initial response to prednisone treatment in childhood acute lymphoblastic leukaemia and polymorphisms within the tumour necrosis factor and the interleukin-10 genes. Leukemia 16:1437-1442, 2002[CrossRef][Medline]

11. Atamas SP: Alternative splice variants of cytokines: Making a list. Life Sci 61:1105-1112, 1997[CrossRef][Medline]

12. Korte A, Moricke A, Beyermann B, et al: Extensive alternative splicing of interleukin-7 in malignant hematopoietic cells: Implication of distinct isoforms in modulating IL-7 activity. J Interferon Cytokine Res 19:495-503, 1999[CrossRef][Medline]

13. Korte A, Kochling J, Badiali L, et al: Expression analysis and characterization of alternatively spliced transcripts of human IL-7Ralpha chain encoding two truncated receptor proteins in relapsed childhood ALL. Cytokine 12:1597-1608, 2000[CrossRef][Medline]

14. Atamas SP, Choi J, Yurovsky VV, et al: An alternative splice variant of human IL-4, IL-4 delta 2, inhibits IL-4-stimulated T cell proliferation. J Immunol 156:435-441, 1996[Abstract]

15. Tsytsikov VN, Yurovsky VV, Atamas SP, et al: Identification and characterization of two alternative splice variants of human interleukin-2. J Biol Chem 271:23055-23060, 1996[Abstract/Free Full Text]

16. Wagner K, Kafert-Kasting S, Heil G, et al: Inhibition of granulocyte-macrophage colony-stimulating factor receptor function by a splice variant of the common beta-receptor subunit. Blood 98:2689-2696, 2001[Abstract/Free Full Text]

17. van Dongen JJ, Seriu T, Panzer-Grümayer ER, et al: Prognostic value of minimal residual disease in acute lymphoblastic leukaemia in childhood. Lancet 352:1731-1738, 1998[CrossRef][Medline]

18. Eckert C, Biondi A, Seeger K, et al: Prognostic value of minimal residual disease in relapsed childhood acute lymphoblastic leukaemia. Lancet 358:1239-1241, 2001[CrossRef][Medline]

19. Josephson K, Logsdon NJ, Walter MR. Crystal structure of the IL-10/IL-10R1 complex reveals a shared receptor binding site. Immunity 15:35-46, 2001[CrossRef][Medline]

20. Walter MR, Nagabhushan TL: Crystal structure of interleukin 10 reveals an interferon gamma-like fold. Biochemistry 34:12118-12125, 1995[CrossRef][Medline]

Submitted September 6, 2004; accepted January 28, 2005.




This article has been cited by other articles:


Home page
Cancer Res.Home page
A. W. Hsing, L. C. Sakoda, A. Rashid, G. Andreotti, J. Chen, B.-S. Wang, M.-C. Shen, B. E. Chen, P. S. Rosenberg, M. Zhang, et al.
Variants in Inflammation Genes and the Risk of Biliary Tract Cancers and Stones: A Population-Based Study in China
Cancer Res., August 1, 2008; 68(15): 6442 - 6452.
[Abstract] [Full Text] [PDF]


Home page
Annals of Clinical & Laboratory ScienceHome page
H. H. Park, M. Kim, B.-H. Lee, J. Lim, Y. Kim, E. J. Lee, W. S. Min, C. S. Kang, W. I. Kim, S. I. Shim, et al.
Intracellular IL-4, IL-10, and IFN-{gamma} Levels of Leukemic Cells and Bone Marrow T Cells in Acute Leukemia.
Ann. Clin. Lab. Sci., December 1, 2006; 36(1): 7 - 15.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
L. W. Harries, S. Ellard, A. Stride, The European MODY consortium, N. G. Morgan, and A. T. Hattersley
Isomers of the TCF1 gene encoding hepatocyte nuclear factor-1 alpha show differential expression in the pancreas and define the relationship between mutation position and clinical phenotype in monogenic diabetes
Hum. Mol. Genet., July 15, 2006; 15(14): 2216 - 2224.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wu, S.
Right arrow Articles by Seeger, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wu, S.
Right arrow Articles by Seeger, K.

About
JCO
 Editorial
Roster
 Advertising
Information
 Librarians &
Institutions
 Rights &
Permissions
 PDA Services

Copyright © 2005 by the American Society of Clinical Oncology, Online ISSN: 1527-7755. Print ISSN: 0732-183X
Terms and Conditions of Use
  HighWire Press HighWire Press™ assists in the publication of JCO Online