Advertisement
Journal of Clinical Oncology  
Search for:
Limit by:
  Browse by Subject or Issue
Home Search or Browse JCO My JCO Subscriptions Customer Service Site Map

Journal of Clinical Oncology, Vol 23, No 22 (August 1), 2005: pp. 5061-5066
© 2005 American Society of Clinical Oncology.
DOI: 10.1200/JCO.2005.05.660

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lévy, M.
Right arrow Articles by Delchier, J.-C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lévy, M.
Right arrow Articles by Delchier, J.-C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Prognostic Value of Translocation t(11;18) in Tumoral Response of Low-Grade Gastric Lymphoma of Mucosa-Associated Lymphoid Tissue Type to Oral Chemotherapy

Michaël Lévy, Christiane Copie-Bergman, Christine Gameiro, Marie-Thérèse Chaumette, Marie-Hélène Delfau-Larue, Corinne Haioun, Antoine Charachon, François Hemery, Philippe Gaulard, Karen Leroy, Jean-Charles Delchier

From the Service d'Hépatologie et de Gastroentérologie, Département de pathologie et Institut National de la Santé et de la Recherche Médicale Unité 617, Service d'Immunologie biologique, Service d'Hématologie, and Service de Biostatistiques et d'Informatique, Hôpital Henri Mondor, Créteil, France

Address reprint requests to Michaël Levy, MD, Service d'Hépatologie et de Gastroentérologie, Hôpital Henri Mondor, 51 avenue du Maréchal de Lattre de Tassigny, 94000 Créteil, France; e-mail: michalevy{at}free.fr


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 REFERENCES
 
PURPOSE: To determine the impact of translocation t(11;18) on response to oral alkylating agents in gastric mucosa-associated lymphoid tissue lymphoma (GML).

PATIENTS AND METHODS: Fifty-three patients with a GML were studied. Helicobacter pylori--positive patients (n = 34) received anti–H pylori treatment and H pylori–negative patients (n = 19) or patients who failed to respond to anti–H pylori treatment received oral alkylating agents. t(11;18) was detected by reverse transcription polymerase chain reaction from frozen gastric biopsies.

RESULTS: t(11;18) was detected in 32% of patients. It was more prevalent in H pylori--negative as compared with H pylori--positive patients (12 of 19 v five of 34 patients; P = .0005). Among 31 H pylori–eradicated patients, t(11;18) was detected in three patients, all of whom experienced treatment failure, and it was absent in 28 patients: 21 patients (75%) were in remission and seven patients (25%) experienced treatment failure (P = .03). Among 21 patients who received an alkylating agent, t(11;18) was detected in 12 patients: five patients (42%) were in remission and seven patients (58%) experienced treatment failure. t(11;18) was absent in nine patients: eight patients (89%) were in remission and one patient (11%) experienced treatment failure by the end of treatment. Four patients in remission relapsed during follow-up (median, 7 years): they all had t(11;18). Durable remission was obtained in eight (89%) of the nine patients without t(11;18) versus one of the 12 patients (8%) with t(11;18) (P = .0003).

CONCLUSION: Presence of t(11;18) in GML is predictive of resistance to oral alkylating agents, with less than 10% of durable remission at long-term follow-up.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 REFERENCES
 
Primary gastric mucosa-associated lymphoid tissue (MALT) B-cell lymphoma (GML) is an extranodal lymphoma characterized by an infiltration of the mucosa by centrocyte-like B cells with formation of lymphoepithelial lesions.1 The association between Helicobacter pylori infection and the development of the disease is now well established.2,3 Eradication of H pylori is effective for the treatment of GML, with a 60% to 80% remission rate.4-8 Oral monochemotherapy with alkylating agents is an alternative therapy in nonresponders to H pylori eradication or in H pylori–negative patients.9,10 Presence of perigastric lymph nodes on endoscopic ultrasonography is a negative predictive factor of a response to anti–H pylori treatment and alkylating agents.11

Translocation t(11;18) (q21;q21) is specific of MALT-type lymphoma and is detected in 18% to 24% of patients with GML.12-14 The genes involved in this translocation are the API2 gene, localized on chromosome 11, and the MALT1 gene, localized on chromosome 18. The translocation generates a chimeric fusion transcript (API2-MALT1) that induces a strong enhancement of NF-{kappa}B activity and several cell apoptosis inhibitors.15 Presence of t(11;18) (q21;q21) in GML is associated with limited response to H pylori eradication.16

The aim of our study was to determine whether t(11;18) is a predictive factor of response to oral monochemotherapy with alkylating agents. We also intended to confirm the prevalence of t(11;18) in GML according to H pylori status and stage of the disease, and its association with resistance to anti–H pylori treatment in our patients.


    PATIENTS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 REFERENCES
 
Patients
Fifty-three patients (31 men, 22 women; median age, 54.2 years [range, 29 to 73.8 years]) with GML treated and followed up in our institution were studied. Clinical features are summarized in Table 1. Diagnosis of MALT-type lymphoma was made on upper endoscopic examination and then ascertained on histologic examination of gastric biopsy samples. Histologic diagnosis of GML was made according to the criteria defined by Isaacson and Wright1: presence of a diffuse infiltrate of CD20+ CD5– centrocyte-like B cells in the lamina propria (LP) with prominent lymphoepithelial lesions and reactive lymphoid follicles. Immunohistochemistry was performed in all cases on paraffin sections. Presence of H pylori was assessed on modified Giemsa-stained sections and by culture. After treatment, new biopsy samples were examined. To assess the tumoral response, we used the Groupe d'Etude des Lymphomes de l'Adulte histologic grading system17: complete histologic remission (CR) was defined as the absence of lymphoid infiltrate or scattered plasma cells and small lymphoid cells in the LP without lymphoepithelial lesions (LEL) with normal or empty LP and/or fibrosis; probable minimal residual disease (pMRD) was defined as aggregates of lymphoid cells or lymphoid nodules in the LP/muscularis mucosa and/or submucosa without LEL with empty LP and/or fibrosis; responding residual disease (rRD) was defined as a dense, diffuse, or nodular lymphoid infiltrate extending around glands in the LP without LEL or with focal LEL, with focal empty LP and/or fibrosis; no change (NC) was defined as a dense, diffuse, or nodular lymphoid infiltrate with LEL and no stromal changes. The CR score and the pMRD score were considered histologic remission, the rRD score was considered partial remission. Patients in CR, pMRD, and rRD were pooled in the remission group; the NC score was considered treatment failure.


View this table:
[in this window]
[in a new window]
 
Table 1. Clinical and Molecular Features of the 53 Patients With Primary Gastric Low-Grade Mucosa-Associated Lymphoid Tissue–Type Lymphoma

 
Tumors were staged according to the Ann Arbor system as modified by Musshoff.18 The initial evaluation included blood tests for lactate dehydrogenase (LDH) and beta 2-microglobulinemia, chest x-ray, thoracic and abdominal computed tomography scans, colonoscopy, small bowel barium x-ray, and bone marrow biopsy. In addition, endoscopic ultrasonography (EUS) was performed according to the method described in a previous study.19 Presence or absence of perigastric lymph nodes was recorded.

Molecular Biology
For immunoglobulin gene rearrangement studies, DNA was extracted from frozen gastric biopsies when available or formalin-fixed, paraffin-embedded material by standard proteinase K digestion and a phenol/chloroform extraction procedure. Polymerase chain reaction (PCR) was performed as previously described.20

The presence of a t(11;18) translocation was determined by amplification and sequencing of the API2-MALT1 fusion transcript. Total RNAs were extracted from frozen tumor samples using the TRIzol reagent (Life Technologies, Cergy-Pontoise, France). Two-microgram total RNAs were reverse transcribed with Superscript II (Life Technologies) in a final volume of 20 µL containing 300 ng of random hexamers, according to the manufacturer's instructions. After enzyme heat inactivation, cDNAs were diluted 1:5 in water and stored at –20°C. Two and a half microliters of cDNA was amplified with beta-actin (ACTB) primers to verify RNA quality and reverse transcription efficiency and with different API2 MALT1 primer sets, in parallel with known positive and negative controls. The presence of a t(11;18) translocation was detected by amplification of 5 µL of cDNA with 0.2 µmol/L of API2 1700 sense primer (5' AAAGGACAGGAGTTCATCCGT 3') and 0.2 µmol/L of MALT1 1181 antisense primer (5' CAAAGGCTGGTCAGTTGTTT 3'), 0.625 U of AmpliTaq Gold DNA polymerase (Applied Biosystems, Foster City, CA) in GeneAmp 1X PCR Buffer (50 mmol/L of KCl, 10 mmol/L of Tris-HCl pH 8.3) containing 1.5 mmol/L of MgCl2 and 0.2 mmol/L of dNTP in a 25-µL reaction volume. The PCR program comprised an initial 10-minute denaturation and Taq polymerase activation step at 95°C, 10 touchdown cycles of denaturation (95°C for 1 minute), annealing (63°C for 1 minute, minus 0.5°C each cycle), and elongation (72°C for 1.5 minutes), 25 cycles of denaturation (95°C for 1 minute), annealing (58°C for 1 minute), and elongation (72°C for 1.5 minutes), and a final 7-minute elongation step at 72°C. Amplified PCR products were analyzed by electrophoresis in 1% agarose gels stained with ethidium bromide. Specific amplification of API2-MALT1 fusion transcript was further assessed by PCR amplification with different primer pairs (API 897 5' CTGGTGTGAATGACAAGGTC 3'/MALT1 1181 and API 1700/MALT1 1469 5' CCTATATGGATTTGGAGC 3') and direct sequencing of the purified PCR product on both strands using BigDye Terminator cycle sequencing kits (Applied Biosystems) and an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems).

Treatment
H pylori–positive patients received anti–H pylori treatment. Anti–H pylori treatment was a combination of omeprazole 20 mg bid plus amoxicillin 1 g bid and clarithromycin 500 mg bid or metronidazole 500 mg bid for 7 days.

Eradication of H pylori infection was evaluated 2 months after treatment by a new upper endoscopy with biopsy samples. If the infection was still present, a new anti–H pylori treatment was given. The tumoral response was assessed 6 months after treatment by upper endoscopy with biopsy samples on residual lesions or on the previous location of the lesions and by EUS. When EUS showed thickening of gastric wall, biopsy samples were taken on the location of the thickening, guided by EUS features.

H pylori–negative patients or patients who experienced treatment failure after anti-H pylori treatment despite H pylori eradication received an oral alkylating agent: either cyclophosphamide 100 mg/d for 12 to 18 months for the first patients (n = 3) or chlorambucil 6 mg/m2/d, 14 days per month for 12 months for all the others and more recent patients.

Statistical Analysis
Proportions were compared by the Fisher's exact test. Kaplan-Meier curves were constructed for event-free survival and the curves were compared by the log-rank test. P values less than .05 were considered statistically significant. All calculations were done with SAS software (version 8.02).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 REFERENCES
 
Translocation t(11;18) was detected in 17 (32%) of the 53 patients. Results of t(11;18) according to H pylori status and to the stage of the disease are shown in Table 2: t(11;18) was present in 63% of H pylori–negative patients, whereas it was present in 15% of H pylori–positive patients. Sixty-two percent of the stage IIE patients with perigastric lymph nodes expressed t(11;18), whereas 20% of the stage IE patients were t(11;18) positive.


View this table:
[in this window]
[in a new window]
 
Table 2. Results of the Translocation t(11;18) According to H pylori Status and to the Stage of Disease

 
H pylori eradication was achieved in all patients but one (97%), despite five different associations of antibiotics. Follow-up was available in 31 of the 33 patients in whom H pylori was eradicated. The tumor response to H pylori eradication at 6 months according to the t(11;18) status is shown in Table 3: remission was obtained in 75% of the t(11;18)-negative patients, whereas all t(11;18)-positive patients failed to respond.


View this table:
[in this window]
[in a new window]
 
Table 3. Tumor response to H pylori Eradication at 6 Months According to t(11;18) in 31 H pylori-Positive Patients With an Available Follow-Up

 
The follow-up of 21 patients who received an alkylating agent was available (Table 4). In 14 cases, the alkylating agent was given as first-line therapy, and in seven cases, the alkylating agent was given because of failure to respond to H pylori eradication. At the end of the treatment (1 year), 13 patients were in remission and eight patients experienced treatment failure; remission was obtained in 42% of t(11;18)-positive patients and in 89% of t(11;18)-negative patients, and the failure rates were 58% and 11%, respectively, with no significant difference. At long-term follow-up (median, 7 years; range, 1 to 25.2 years), four of the five t(11;18)-positive patients in remission at 1 year, all classified as pMRD according to the Groupe d'Etude des Lymphomes de l'Adulte histologic grading system, experienced relapse. Conversely, all t(11;18)-negative patients who were in remission at 1 year (n = 8) remained stable without relapse. Among them, three patients in pMRD evolved to CR, and one patient in rRD evolved to pMRD. Figure 1 shows the Kaplan-Meier curve constructed for event-free survival. The difference between t(11;18)-negative patients and t(11;18)-positive patients is highly significant (P = .0014).


View this table:
[in this window]
[in a new window]
 
Table 4. Tumor Response to Alkylating Agents After 1 Year of Treatment (Short Term) and After Long-Term Follow-Up in 21 Available Patients According to Translocation t(11;18)

 


View larger version (13K):
[in this window]
[in a new window]
 
Fig 1. Kaplan-Meier curve for event-free survival comparing t(11;18)-negative patients with t(11;18)-positive patients after 1 year of treatment with chlorambucil and after long-term follow-up.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 REFERENCES
 
Since the 1980s, patients with gastric MALT lymphomas referred to our institution were treated conservatively9,10: until 1995, they received an oral single alkylating agent as first-line therapy, either cyclophosphamide or chlorambucil, for at least 1 year. Since 1995, H pylori was systematically eradicated in infected patients, and nonresponding patients or initially H pylori–negative patients were given oral chemotherapy. H pylori was eradicated when present in previously treated patients with chemotherapy. As frozen gastric biopsies were available, we had the opportunity to assess the impact of t(11;18) on long-term outcome of a relatively large series of patients treated with alkylating agents.

Translocation t(11;18)(q21;q21) is the most frequent genetic alteration associated with gastric MALT lymphoma, especially in advanced disease with regional lymph nodes, pulmonary, and/or medullar involvement. It was found in a single case of transformed low-grade MALT lymphoma in diffuse large B-cell lymphoma but is usually not detected in diffuse large B-cell lymphoma.21-23

We observed a 32% prevalence of t(11;18)-positive tumors in our patients. This is in accordance with a previous report.24 However, the prevalence differed according to H pylori infection and disease extension. Our study is the first dealing with a relatively high number of H pylori-negative patients. The high rate of H pylori-negative patients (36%) in our cohort is related to the type of patients who are referred to our institution.

Sixty-three percent of H pylori-negative patients versus 15% of H pylori-positive patients harbored the t(11;18) translocation in the present series. These results are in accordance with previous reports.16,25 Ye et al found a 53% incidence of t(11;18) in 12 H pylori–negative patients and five nonresponding patients to H pylori eradication. A high proportion of our patients presented with advanced disease, with eight stage IIE and 10 stage IV patients: we confirmed that t(11;18) is more frequent in stage II than in stage I disease.21 However, neither medullar nor pulmonary involvement was associated with a higher rate of t(11;18)-positive tumors (five patients in each group) in contrast with previously published series.21

This study confirms that patients with t(11;18)-positive GML do not respond to anti–H pylori treatment, whereas remission is obtained in 75% of t(11;18)-negative GML. The resistance of t(11;18)-positive tumors to anti–H pylori treatment has been reported in previous studies.26,27 Resistance to anti–H pylori treatment has also been related to the presence of perigastric lymph nodes visualized on EUS in univariate and multivariate analysis, with remission rates of 0% to 33%.11,28 However, some patients with stage IE disease do not respond despite apparently mild and superficial disease. Thus other factors might be involved in the resistance to anti–H pylori treatment.

The main result of our study is that patients with t(11;18)-positive GML are poor responders to oral alkylating agents. At the end of the treatment (1 year), remission was obtained in 42% of the t(11;18)-positive patients and in 89% of t(11;18)-negative patients, a difference of borderline significance (P = .07). After a long-term follow-up (median, 7 years), four of five t(11;18)-positive patients who were in remission experienced relapse. Thus 92% of t(11;18)-positive patients experienced treatment failure, whereas remission was persistent in 89% of t(11;18)-negative patients with a high significative difference (P = .0003).

We showed in a recent study that the depth of tumoral infiltration of the gastric wall and the presence of perigastric lymph nodes (stage IIE patients) seen on EUS were negative predictive factors of the tumor response to oral alkylating agents.11 Translocation t(11;18)-positive status may now be considered as a new prognostic marker that predicts the failure of oral alkylating agents or the long-term relapse if remission is obtained initially.

According to our findings, we would not advocate the use of alkylating agents alone in patients with t(11;18)-positive GML who failed to respond to H pylori eradication or who were H pylori–negative. Alternative treatments such as radiotherapy alone or anti-CD20 antibodies (rituximab) could be proposed.29-31 The association of alkylating agents and rituximab is currently under investigation. The nucleoside analog cladribine (2CdA) has also been tested, and remission was obtained regardless of the t(11;18) status.32 Fludarabine has also been tested, but in nongastrointestinal lymphomas, in one study of 31 patients.33 Further experiences in gastric MALT lymphoma, in correlation with t(11;18), are recommended.

In conclusion, t(11;18) is more frequent in H pylori–negative and in stage IIE patients. Presence of t(11;18) in GML is a negative predictive factor of tumor response to anti–H pylori treatment and to oral alkylating agents. In this case, alternative treatment may be justified if resistance to H pylori eradication is experienced or as first-line therapy for H pylori–negative patients.


    Authors' Disclosures of Potential Conflicts of Interest
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 REFERENCES
 
The authors indicated no potential conflicts of interest.


    NOTES
 
Presented in part at the 12th United European Gastroenterology Week, September 25-29, 2004, Prague, Czech Republic, September 27, 2004, as an oral communication.

Authors' disclosures of potential conflicts of interest are found at the end of this article.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 REFERENCES
 
1. Isaacson PG, Wright DH: Malignant lymphoma of mucosa-associated lymphoid tissue. A distinctive type of B-cell lymphoma. Cancer 52: 1410-1416, 1983[CrossRef][Medline]

2. Wotherspoon AC, Ortiz-Hidalgo C, Falzon MR, et al: Helicobacter pylori-associated gastritis and primary B-cell gastric lymphoma. Lancet 338: 1175-1176, 1991[CrossRef][Medline]

3. Parsonnet J, Hansen S, Rodriguez L, et al: Helicobacter pylori infection and gastric lymphoma. N Engl J Med 330: 1267-1271, 1994[Abstract/Free Full Text]

4. Wotherspoon AC, Doglioni C, Diss TC, et al: Regression of primary low-grade B-cell gastric lymphoma of mucosa-associated lymphoid tissue type after eradication of Helicobacter pylori. Lancet 342: 575-577, 1993[CrossRef][Medline]

5. Roggero E, Zucca E, Pinotti G, et al: Eradication of Helicobacter pylori infection in primary low-grade gastric lymphoma of mucosa-associated lymphoid tissue. Ann Intern Med 122: 767-769, 1995[Abstract/Free Full Text]

6. Bayerdorffer E, Neubauer A, Rudolph B, et al: Regression of primary gastric lymphoma of mucosa-associated lymphoid tissue type after cure of Helicobacter pylori infection. MALT Lymphoma Study Group. Lancet 345: 1591-1594, 1995[CrossRef][Medline]

7. Montalban C, Manzanal A, Boixeda D, et al: Helicobacter pylori eradication for the treatment of low-grade gastric MALT lymphoma: Follow-up together with sequential molecular studies. Ann Oncol 8: 37-39, 1997 (suppl 2)[Abstract/Free Full Text]

8. Thiede C, Wundisch T, Neubauer B, et al: Eradication of Helicobacter pylori and stability of remissions in low-grade gastric B-cell lymphomas of the mucosa-associated lymphoid tissue: Results of an ongoing multicenter trial. Recent Results Cancer Res 156: 125-133, 2000[Medline]

9. Blazquez M, Haioun C, Chaumette MT, et al: Low grade B cell mucosa associated lymphoid tissue lymphoma of the stomach: Clinical and endoscopic features, treatment, and outcome. Gut 33: 1621-1625, 1992[Abstract/Free Full Text]

10. Hammel P, Haioun C, Chaumette MT, et al: Efficacy of single-agent chemotherapy in low-grade B-cell mucosa-associated lymphoid tissue lymphoma with prominent gastric expression. J Clin Oncol 13: 2524-2529, 1995[Abstract]

11. Lévy M, Copie-Bergman C, Traulle C, et al: Conservative treatment of primary gastric low grade B-cell lymphoma of mucosa-associated lymphoid tissue: Predictive factors of response and outcome. Am J Gastroenterol 97: 292-297, 2002[CrossRef][Medline]

12. Ye H, Liu H, Attygalle A, et al: Variable frequencies of t(11;18)(q21;q21) in MALT lymphomas of different sites: Significant association with CagA strains of H pylori in gastric MALT lymphoma. Blood 102: 1012-1018, 2003[Abstract/Free Full Text]

13. Streubel B, Simonitsch-Klupp I, Müllauer L, et al: Variable frequencies of MALT lymphoma-associated genetic aberrations in MALT lymphomas of different sites. Leukemia 18: 1722-1726, 2004[CrossRef][Medline]

14. Inagaki H, Nakamura T, Li C, et al: Gastric MALT lymphomas are divided into three groups based on responsiveness to Helicobacter Pylori eradication and detection of API2-MALT1 fusion. Am J Surg Pathol 28: 1560-1567, 2004[Medline]

15. Dierlamm J, Baens M, Wlodarska I, et al: The apoptosis inhibitor gene API2 and a novel 18q gene, MLT, are recurrently rearranged in the t(11;18)(q21;q21) associated with mucosa- associated lymphoid tissue lymphomas. Blood 93: 3601-3609, 1999[Abstract/Free Full Text]

16. Liu H, Ye H, Ruskone-Fourmestraux A, et al: T(11;18) is a marker for all stage gastric MALT lymphomas that will not respond to H pylori eradication. Gastroenterology 122: 1286-1294, 2002[CrossRef][Medline]

17. Copie-Bergman C, Gaulard P, Lavergne-Slove A, et al: Proposal for a new histological grading system for post-treatment evaluation of gastric MALT lymphoma. Gut 52: 1656, 2003[Free Full Text]

18. Musshoff K: Klinische stadieneinteilung der nicht-Hodgkin lymphome. Strahlentherapie 153: 218-221, 1997

19. Lévy M, Hammel P, Lamarque D, et al: Endoscopic ultrasonography for the initial staging and follow-up in patients with low-grade gastric lymphoma of mucosa-associated lymphoid tissue treated medically. Gastrointest Endosc 46: 328-333, 1997[CrossRef][Medline]

20. Lechapt-Zalcman E, Challine D, Delfau-Larue MH, et al: Association of primary pleural effusion lymphoma of T-cell origin and human herpesvirus-8 in HIV-seronegative male. Arch Pathol Lab Med 125: 1246-1248, 2001[Medline]

21. Liu H, Ye H, Dogan A, et al: T(11;18)(q21;q21) is associated with advanced mucosa-associated lymphoid tissue lymphoma that expresses nuclear BCL10. Blood 98: 1182-1187, 2001[Abstract/Free Full Text]

22. Nakamura S, Matsumoto T, Nakamura S, et al: Chromosomal translocation t(11;18) (q21;q21) in gastrointestinal mucosa associated lymphoid tissue lymphoma. J Clin Pathol 56: 36-42, 2003[Abstract/Free Full Text]

23. Remstein ED, Kurtin PJ, James CD, et al: Mucosa-associated lymphoid tissue lymphomas with t(11;18)(q21;q21) and mucosa-associated lymphoid tissue lymphomas with aneuploidy develop along different pathogenetic pathways. Am J Pathol 161: 63-71, 2002[Abstract/Free Full Text]

24. Baens M, Maes B, Steyls A, et al: The product of the t(11;18), an API2-MLT fusion, marks nearly half of gastric MALT type lymphomas without large cell proliferation. Am J Pathol 156: 1433-1439, 2000[Abstract/Free Full Text]

25. Ye H, Liu H, Raderer M, Chott A, et al: High incidence of t(11;18)(q21;q21) in Helicobacter pylori-negative gastric MALT lymphoma. Blood 101: 2547-2550, 2003[Abstract/Free Full Text]

26. Liu H, Ruskoné-Fourmestraux A, Lavergne-Slove A, et al: Resistance of t(11;18) positive gastric mucosa-associated lymphoid tissue lymphoma to Helicobacter pylori eradication therapy. Lancet 357: 39-40, 2001[CrossRef][Medline]

27. Alpen B, Neubauer A, Dierlamm J, et al: Translocation t(11;18) absent in early gastric marginal zone B-cell lymphoma of MALT type responding to eradication of Helicobacter pylori infection. Blood 95: 4014-4015, 2000[Free Full Text]

28. Ruskoné-Fourmestraux A, Lavergne A, Aegerter PH, et al: Predictive factors for regression of gastric MALT lymphoma after anti-Helicobacter pylori treatment. Gut 48: 297-303, 2001[Abstract/Free Full Text]

29. Schechter NR, Portlock CS, Yahalom J: Treatment of mucosa-associated lymphoid tissue lymphoma of the stomach with radiation alone. J Clin Oncol 16: 1916-1921, 1998[Abstract]

30. Tsang RW, Gospodarowicz MK, Pintilie M, et al: Localized mucosa-associated lymphoid tissue lymphoma treated with radiation therapy has excellent clinical outcome. J Clin Oncol 21: 4157-4164, 2003[Abstract/Free Full Text]

31. Conconi A, Martinelli G, Thieblemont C, et al: Clinical activity of rituximab in extranodal marginal zone B-cell lymphoma of MALT type. Blood 102: 2741-2745, 2003[Abstract/Free Full Text]

32. Streubel B, Ye H, Du MQ, et al: Translocation t(11;18)(q21;q21) is not predictive of response to chemotherapy with 2CdA in patients with gastric MALT lymphoma. Oncology 66: 476-480, 2004[CrossRef][Medline]

33. Zinzani PL, Stefoni V, Musuraca G, et al: Fludarabine-containing chemotherapy as frontline treatment of nongastrointestinal mucosa-associated lymphoid tissue lymphoma. Cancer 100: 2190-2194, 2004[CrossRef][Medline]

Submitted November 15, 2004; accepted March 24, 2005.


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Facebook Facebook   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
Ann OncolHome page
A. Psyrri, S. Papageorgiou, and T. Economopoulos
Primary extranodal lymphomas of stomach: clinical presentation, diagnostic pitfalls and management
Ann. Onc., December 1, 2008; 19(12): 1992 - 1999.
[Abstract] [Full Text] [PDF]


Home page
ASH Education BookHome page
B. Kahl and D. Yang
Marginal Zone Lymphomas: Management of Nodal, Splenic, and MALT NHL
Hematology, January 1, 2008; 2008(1): 359 - 364.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Pathol.Home page
C. M Bacon, M.-Q. Du, and A. Dogan
Mucosa-associated lymphoid tissue (MALT) lymphoma: a practical guide for pathologists
J. Clin. Pathol., April 1, 2007; 60(4): 361 - 372.
[Abstract] [Full Text] [PDF]


Home page
The OncologistHome page
S. M. Cohen, M. Petryk, M. Varma, P. S. Kozuch, E. D. Ames, and M. L. Grossbard
Non-Hodgkin's Lymphoma of Mucosa-Associated Lymphoid Tissue
Oncologist, November 1, 2006; 11(10): 1100 - 1117.
[Abstract] [Full Text] [PDF]


Home page
ASH Education BookHome page
C. Thieblemont
Clinical Presentation and Management of Marginal Zone Lymphomas
Hematology, January 1, 2005; 2005(1): 307 - 313.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lévy, M.
Right arrow Articles by Delchier, J.-C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lévy, M.
Right arrow Articles by Delchier, J.-C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

About
JCO
 Editorial
Roster
 Advertising
Information
 Librarians &
Institutions
 Rights &
Permissions
 PDA Services

Copyright © 2005 by the American Society of Clinical Oncology, Online ISSN: 1527-7755. Print ISSN: 0732-183X
Terms and Conditions of Use
  HighWire Press HighWire Press™ assists in the publication of JCO Online