Advertisement
Journal of Clinical Oncology  
Search for:
Limit by:
  Browse by Subject or Issue
Home Search or Browse JCO My JCO Subscriptions Customer Service Site Map

Originally published as JCO Early Release 10.1200/JCO.2005.14.068 on May 31 2005

Journal of Clinical Oncology, Vol 23, No 23 (August 10), 2005: pp. 5357-5364
© 2005 American Society of Clinical Oncology.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Corless, C. L.
Right arrow Articles by Heinrich, M. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Corless, C. L.
Right arrow Articles by Heinrich, M. C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

PDGFRA Mutations in Gastrointestinal Stromal Tumors: Frequency, Spectrum and In Vitro Sensitivity to Imatinib

Christopher L. Corless, Arin Schroeder, Diana Griffith, Ajia Town, Laura McGreevey, Patina Harrell, Sharon Shiraga, Troy Bainbridge, Jason Morich, Michael C. Heinrich

From the Department of Pathology; Division of Hematology and Oncology, Oregon Health & Science University Cancer Institute; and the Portland VA Medical Center, Portland, Oregon

Address reprint requests to Michael Heinrich, MD, R&D-19 3710 SW US Veterans Hospital Road, Portland, OR 97201; e-mail: heinrich{at}ohsu.edu.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 REFERENCES
 
PURPOSE: Gastrointestinal stromal tumors (GISTs) commonly harbor oncogenic mutations of the KIT tyrosine kinase, which is a target for the kinase inhibitor imatinib. A subset of GISTs, however, contains mutations in the homologous kinase platelet derived growth factor receptor alpha (PDGFRA), and the most common of these mutations is resistant to imatinib in vitro. Little is known of the other types of PDGFRA mutations that occur in GISTs.

MATERIALS AND METHODS: We determined the KIT and PDGFRA mutation status of 1,105 unique GISTs using a combination of denaturing high-performance liquid chromatography and direct sequencing.

RESULTS: There were 80 tumors (7.2%) with a PDGFRA mutation: 66 in exon 18, 11 in exon 12, and three in exon 14. Transient expression of representative PDGFRA isoforms in CHO cells revealed imatinib sensitivity of exon 12 mutations (SPDHE566-571R and insertion ER561-562) and an exon 14 substitution (N659K). However, most isoforms with a substitution involving codon D842 in exon 18 (D842V, RD841-842KI, DI842-843IM) were resistant to the drug, with the exception of D842Y. Interestingly, other mutations in exon 18 (D846Y, N848K, Y849K and HDSN845-848P) were all imatinib sensitive. Proliferation studies with BA/F3 cell lines stably expressing selected PDGFRA mutant isoforms supported these findings.

CONCLUSION: Including our cases, there are 289 reported PDGFRA-mutant GISTs, of which 181 (62.6%) had the imatinib-resistant substitution D842V. However, our findings suggest that more than one third of GISTs with PDGFRA mutations may respond to imatinib and that mutation screening may be helpful in the management of these tumors.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 REFERENCES
 
Gastrointestinal stromal tumors (GISTs) are the most common mesenchymal tumor of the GI tract, arising primarily within the muscular wall of the stomach and small intestine. Approximately 95% of GISTs express the receptor tyrosine kinase KIT, which is useful in distinguishing these tumors from other sarcomas that develop in the abdomen. In recent years it has been established that 75% to 80% of GISTs harbor mutations in the KIT gene, and that the resulting mutant isoforms of KIT play an important role in the development of these tumors.1-3 Therapeutic targeting of mutant KIT with the tyrosine kinase inhibitor imatinib (Gleevec, Glivec; Novartis Pharma AG, Basel, Switzerland) has proven to be an effective treatment for patients with advanced, unresectable GIST.4,5

Recently, we identified activating mutations in the gene encoding platelet-derived growth factor receptor alpha (PDGFRA) within a subset of GISTs that lacked KIT gene mutations.6 Constitutive phosphorylation of PDGFRA was observed in extracts of tumors with these mutations, and the corresponding PDGFRA isoforms demonstrated ligand-independent kinase activity when expressed in vitro. Interestingly, no differences in the activation of downstream signaling intermediates were observed between KIT-mutant and PDGFRA-mutant tumors, suggesting that mutant PDGFRA provides oncogenic signals that parallel those of mutant KIT. The presence of PDGFRA mutations in KIT-wildtype GISTs has been confirmed by a number of groups.7-12

Although there are similarities between PDGFRA-mutant and KIT-mutant GISTs at the molecular level, a number of clinicopathologic differences between these tumors have emerged in recent studies. In comparison with KIT-mutant tumors, PDGFRA-mutant GISTs more often have an epithelioid morphology, and are more often weak or negative for KIT (CD117) by immunohistochemistry.6,8-12 In addition, these tumors arise almost exclusively in the stomach, whereas KIT-mutant tumors occur at a variety of sites along the GI tract.9,12 Furthermore, the gene expression profiles of PDGFRA-mutant tumors cluster separately from most KIT-mutant tumors.13,14 Thus, PDGFRA-mutant tumors represent a distinct subset of GISTs that raises new challenges with regard to diagnosis (particularly those that are KIT-negative) and treatment with kinase inhibitors such as imatinib.

In this report we examine the spectrum of PDGFRA mutations identified in a series of GISTs from 1,105 unique patients. In addition, we compare the in vitro sensitivities of representative mutant PDGFRA isoforms to the kinase inhibitor imatinib in transiently transfected Chinese hamster ovary cells and stably transfected BA/F3 cells. Our findings are summarized together with other recent reports of PDGFRA mutations to provide an overview of this subset of GISTs.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 REFERENCES
 
GISTs
Samples of paraffin-embedded GISTs were obtained from the pathology archives of Oregon Health & Science University Hospital, the Portland VA Medical Center, and the Northwest Kaiser Regional Laboratory (Portland, Oregon), in accordance with institutional review board regulations of all three institutions. Additional samples were obtained from patients who consented to clinical trials. The diagnosis of GIST was confirmed for all tumors by an expert pathologist (C.L.C.). Subsets of these tumors have been published in previous studies.6,10,15

PDGFRA Mutation Screening
Mutational analyses were performed on genomic DNA extracted from paraffin-embedded tumor tissue using a combination of PCR amplification, denaturing high-performance liquid chromatography screening, and automated sequencing, as described previously.6,10,16 The primers used to amplify PDGFRA exons 12 and 18 were exactly as reported.6 The primers used to amplify PDGFRA exons 10 and 14 were as follows:

Exon 10 Forward: GGCCCTATACTTAGGCCCTTT
Exon 10 Reverse: TCAGCTGATGAGTTGTCCTGA
Exon 14 Forward: TGGTAGCTCAGCTGGACTGAT
Exon 14 Reverse: GGGATGGAGAGTGGAGGATT

The PCR conditions for these two exons were 95°C for 1 minute, then 45 cycles of 94°C for 1 minute, 56°C for 1 minute, and 72°C for 1 minute. The final elongation step was at 72°C for 7 minutes. Exon 14 amplimers were screened for mutations on a WAVE denaturing high-performance liquid chromatography system (Transgenomic Inc, Omaha, NE) at 50°C (nondenaturing) and 60.1°C (denaturing). Exon 10 amplimers were screened at 50°C (non-denaturing) and 62.0°C (denaturing).

One tumor had an apparent double point mutation (DI842-843IM). Exon 18 amplimers from this tumor were subcloned into TOPO plasmids and 19 isolates were re-amplified and sequenced to determine whether the mutations were on the same or separate alleles, as previously reported.16

In Vitro Studies
Human PDGFRA mutant isoforms were generated by site-directed mutagenesis of the wild-type cDNA that had been cloned into pcDNA3.1 plasmid (Invitrogen Corp, Carlsbad, CA).6 All engineered mutations were confirmed by bidirectional sequencing. Chinese hamster ovary cells were transiently transfected with plasmids encoding cDNAs for wild-type or mutant proteins.6 Twenty-four hours after transfection, the cells were treated with control media or media containing various concentrations of imatinib for 90 minutes.6 The cells were then collected, and protein lysates were prepared and analyzed for PDGFRA activation as previously described.6 Experiments involving recombinant DNA were performed using BL2 safety conditions in accordance with National Institutes of Health Guidelines for Research Involving Recombinant DNA Molecules (http://www4.od.nih.gov/oba/rac/guidelines/guidelines.html). Imatinib was generously provided by Elisabeth Buchdunger, PhD (Novartis Pharma AG, Basel, Switzerland).

Mutant PDGFRA isoforms were transfected into BA/F3 cells. Clones were selected for G418 resistance and IL-3 independence, as previously described.17 DNA from stable lines was checked to ensure that the expected mutant PDGFRA sequence was present, and expression was verified by immunoblotting for total and tyrosyl-phosphorylated forms of PDGFRA. Cells were added to 96-well plates at densities of 20,000 cells/well and incubated with imatinib for 72 hours before measuring cellular proliferation using a 2,3-bis[2-methoxyl-4-nitro-5-sulfophenyl]2H-tetrazolium-5-carboxanilide (XTT) –based assay (Roche Molecular Biochemicals, Indianapolis, IN).18


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 REFERENCES
 
GISTs from 1,105 unique patients have been screened for KIT and PDGFRA gene mutations in our laboratories. Subsets of these tumors were previously published.6,10,15 A total of 80 tumors with mutations in PDGFRA (7.2%) were identified, of which 46 have not been previously reported. The overall PDGFRA mutation frequency in our series may be higher than that observed by other groups due to the referral of KIT-negative cases to our laboratory for molecular testing. The most common site of mutation in our tumors was the region encoding the activation loop in the second tyrosine kinase domain (exon 18, 82.5%). Smaller numbers of mutations were found in the juxtamembrane domain (exon 12, 13.7%) and in the first tyrosine kinase domain (exon 14, 3.7%). The PDGFRA mutations identified in our 80 cases are listed in Table 1 together with 209 other reported PDGFRA-mutant GISTs. Relative to our cases, exon-18 mutations were somewhat more common among the tumors reported by other groups (93%), whereas exon-12 mutations were less frequent (7%).


View this table:
[in this window]
[in a new window]
 
Table 1. Summary of Published PDGFRA Mutations in GIST

 
It has previously been observed that PDGFRA-mutant tumors arise primarily in the stomach, mesentery and omentum.9,10,12 Our findings are similar: of 38 tumors of known origin in our series, only two were recorded as arising in the small intestine. Lasota et al9 have suggested that PDGFRA-mutant GISTs have a better prognosis than KIT-mutant tumors. We cannot confirm this observation because many of our tumors were from patients enrolled in clinical trials for the treatment of malignant disease.

Combining our series and all other reported cases, the single most common PDGFRA mutation in GISTs is the substitution D842V (62.6%; Table 1). The most common size-altering mutations are the deletions reported as DIMH842-845 and IMHD843-846; however, it should be noted that at the protein sequence these two mutations are equivalent. This is because codons IMH843-845 are flanked on both sides by aspartic acid (D842 and D846). Thus, inclusion of either D842 or D846 in an in-frame deletion (or deletion substitution) that eliminates IMH843-845 will leave a residual aspartic acid residue at codon 842. Together the DIMH842-845/IMH843-846 deletions account for 14.9% of all PDGFRA mutations (Table 1).

Among the exon-18 mutant tumors in our series was a unique example of an apparent double point mutation, DI842-843IM. To determine whether the nucleotide substitutions that resulted in this alteration (53265 A>T and 53270 C>G) were on the same allele, amplimers were subcloned into TOPO plasmids and 19 isolates were re-amplified and sequenced. All subclones were either DI842-843IM or wild type, consistent with a single affected allele.

We have previously identified a PDGFRA exon-14 mutant tumor and now report two additional examples.10 As this exon has not been surveyed by other groups, it is probably under-represented among the mutations listed in Table 1. We also examined 78 GISTs for mutations in PDGFRA exon 10, which is homologous to KIT exon 9 (the second most common site of KIT mutation in GISTs). No PDGFRA exon 10 mutations were identified among the tumors examined, which included 29 cases that were wild type for KIT exons 9, 11, 13, and 17 and for PDGFRA exons 12, 14, and 18.

Mutant isoforms corresponding to selected human PDGFRA mutations were created by site-specific mutagenesis and expressed in Chinese hamster ovary cells by transient transfection. All of the expressed mutants demonstrated phosphorylation of tyrosine residues in the absence of PDGF-AA ligand, implying constitutive activation of their kinase domains (Figs 1 and 2).



View larger version (21K):
[in this window]
[in a new window]
 
Fig 1. Imatinib sensitivity of platelet derived growth factor receptor alpha (PDGFRA) isoforms with exon-12 (A and B) or exon-14 (C) mutation. Chinese hamster ovary cells were transfected with PDGFRA constructs and 24 hours later were incubated for 90 minutes in the absence or presence of imatinib at the indicated concentrations. Cell extracts were analyzed by western blotting using anti-PDGFRA (for total PDGFRA) and anti-phosphotyrosine (P-TYR) antibodies.

 


View larger version (45K):
[in this window]
[in a new window]
 
Fig 2. Imatinib sensitivity of platelet derived growth factor receptor alpha (PDGFRA) isoforms with exon-18 mutation. Chinese hamster ovary cells were transfected with PDGFRA constructs and analyzed exactly as described in Figure 1. Panels A through H depict the results for different PDGFRA mutations. The specific mutation being tested is listed below each paired immunoblotting result.

 
As previously documented in a report by Hirota et al7 and in a study from our laboratories,15 the substitution V561D in exon 12 results in an isoform of PDGFRA that is highly sensitive to imatinib. Illustrated in Figures 1A and 1B are the imatinib sensitivities for a deletion/substitution (SPDGHE566-571R) and an in-frame insertion mutation (ER561-562) in exon 12. In addition, the N659K substitution in exon 14 showed decreased phosphorylation in the presence of imatinib at concentrations as low as 0.1 µM (Fig 1C). These observations are consistent with similar degrees of drug sensitivity observed with homologous juxtamembrane and TK I domain mutations of KIT.15

We and others7,15,23 have previously shown that the most common PDGFRA mutant isoform, D842V, shows significant resistance to imatinib at 1 µM (Fig 2A), which is equivalent to the highest serum levels generally achieved in patients. Interestingly, other substitutions that include codon 842 (RD841-842KI and DI842-843IM) also result in significant drug resistance (Figs 2B and 2C). However, not all alterations affecting this codon result in decreased imatinib sensitivity. For example, substitution D842Y is clearly more sensitive than D842V (compare Figs 2A and 2D). In addition, we have previously reported that an in-frame deletion adjacent to codon 842 (deletion I843) does not result in imatinib resistance in vitro.15

Two other substitutions in exon 18, D846Y and Y849C, were imatinib sensitive (Figs 2E and 2G), as was the deletion/substitution (HDSN845-848P) in the same region of the activation loop domain (Fig 2H). Observing similarities in imatinib sensitivity between the mutant isoforms of PDGFRA and KIT, we created a PDGFRA homologue for the N822K mutation of KIT, which has been reported in seminoma, GIST, and acute myelogenous leukemia.24-26 While the corresponding isoform of PDGFRA, N848K, has yet to be identified in a GIST or other human tumor, it is nevertheless autophosphorylated when expressed in CHO cells and appears to be quite sensitive to imatinib (Fig 2F), consistent with the phenotype of KIT N822K.25

To confirm the above observations made in transiently transfected CHO cells, BA/F3 cell lines were generated for four of the PDGFRA-mutant isoforms by selecting in the absence of IL-3 (on which these cells are normally dependent). As illustrated in Figure 3, survival of the V561D, D846Y and Y849C lines was inhibited by imatinib at clinically relevant concentrations, while the D842V clone was completely resistant to the drug. These results match well with the imatinib sensitivities predicted for these PDGFRA isoforms in CHO transfections.



View larger version (18K):
[in this window]
[in a new window]
 
Fig 3. Proliferation of BA/F3 cell lines expressing mutant platelet derived growth factor receptor alpha (PDGFRA) isoforms. BA/F3 cells expressing the indicated mutant isoform of PDGFRA were incubated for 72 hours in the presence or absence of varying concentrations of imatinib. Cell numbers were determined by an XTT-based assay as previously described.18

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 REFERENCES
 
The discovery that some KIT wild-type GISTs harbor oncogenic mutations in PDGFRA has introduced a new level of complexity with respect to both the diagnosis of GISTs and their treatment with kinase inhibitors such as imatinib. In many regards PDGFRA-mutant GISTs are similar to KIT-mutant GISTs. The mutations in both kinases occur in homologous domains, and activation of downstream MAP kinase and STAT3 signaling pathways appears similar between the two mutant kinase subtypes. Moreover, cytogenetic aberrations that correlate with progression of KIT-mutant GISTs are also observed in PDGFRA-mutant tumors, suggesting parallel pathways of tumorigenesis.7,15

There are, however, clinicopathologic differences that correlate with kinase mutation status. For example, more than 95% of PDGFRA-mutant GISTs arise in the stomach, mesentery, or omentum,9,12 whereas GISTs harboring mutations in KIT exon 9 are almost exclusive to the small intestine.27,28 The majority of PDGFRA-mutant GISTs have an epithelioid morphology, while spindle cells dominate most KIT-mutant tumors. In addition, KIT (CD117) expression is immunohistochemically detectable in approximately 95% of KIT-mutant tumors, but up to 40% of PDGFRA-mutant tumors are weak or negative for this kinase.8,10,12 These phenotypic differences reflect underlying differences in gene expression. For example, p70S6K/RPS6KA1 and PRKCQ are two genes that are commonly expressed in KIT-mutant tumors, but not in PDGFRA-mutant tumors.13

If KIT and PDGFRA are such highly homologous kinases, what accounts for the phenotypic and genotypic differences between GISTs that are oncogenically driven by one versus the other? One clue may be the strikingly different distribution of mutations within the two kinases. Two thirds of all KIT gene mutations in GISTs occur in the juxtamembrane domain (exon 11), but only 9.3% of PDGFRA mutations are found in this region (exon 12). In contrast, mutations in the activation loop of KIT (exon 17) are rare in GISTs (less than 1%),1 but they dominate in PDGFRA-mutant tumors (89.6% exon 18). In addition, these exon-18 mutations include in-frame deletions and deletion/substitutions, neither of which has been observed in KIT exon 17. Another difference is that KIT mutations sometimes occur in the extracellular domain encoded by exon 9, but we have not found mutations in the homologous exon of PDGFRA (exon 10). The reasons for these differences in the distribution of mutations are unknown, but one possibility is that the stem cells that give rise to PDGFRA-mutant GISTs have slightly different signaling requirements than the cells from which KIT-mutant GISTs originate.

With regard to imatinib and its use to treat PDGFRA-mutant GISTs, our findings suggest that resistance to the drug correlates selectively with substitution mutations that affect codon 842 of the activation loop. The single most common mutation, D842V, is homologous to D816V of KIT, which is well established as being resistant to imatinib in vitro.29-31 It is thought that alterations of D816 interfere with a swinging movement of the activation loop that is associated with a conformational shift of the adenosine triphosphate (ATP) –binding pocket from an "open" or active conformation to a "closed" or inactive conformation. As imatinib binds selectively to the closed conformation of the kinase, substitutions at KIT 816 (or PDGFRA 842) effectively reduce the accessibility of the ATP pocket and thereby confer relative resistance to the drug.32,33 Interestingly, not all substitutions at KIT 816 are equivalent in this regard. D816H is comparable to D816V, but the D816F and D816Y isoforms of KIT are relatively more sensitive to imatinib.30 Here, again, a parallel is seen in PDGFRA, as we observed that the D842Y isoform is more sensitive to imatinib in vitro than D842V (Fig 2).

Preliminary data suggest that resistance of the D842V isoform to imatinib in vitro may correlate with relative drug resistance in treated patients. In phase II clinical trials of imatinib for the treatment of advanced GIST, there were four assessable patients whose tumors contained PDGFRA D842V; two had stable disease as their best response and two showed outright progression.15,34 More compelling are two recent cases in which acquired resistance to imatinib after an initial clinical response was associated with gain of a secondary D842V mutation in tumors originally harboring an exon 12 mutation.35,36 As D842V represents 181 of the 289 published PDGFRA mutations (62.6%; Table 1), the benefit of imatinib therapy will likely be limited in the majority of patients with PDGFRA-mutant GISTs. It is therefore critical that new kinase inhibitors be developed that will target D842V more effectively. Based on recent work with the D816V isoform of KIT, MLN518 is one possible candidate.37 BMS-354825, AP23464 and AP23848 are other inhibitors that look promising for the treatment of GISTs with KIT D816 substitutions and, by extension, PDGFRA D842 mutations38-40 In the meantime, pending the results of ongoing clinical trials, imatinib is still regarded as the first-line therapy for advanced GISTs, including those with PDGFRA D842V mutations.

The substitution T674I is another potential cause of imatinib resistance in PDGFRA-mutant GISTs. Cools et al41 identified this mutation in relation to secondary imatinib resistance in a patient with hypereosinophilic syndrome, which is a myeloproliferative disease driven by the fusion gene product FIP1L1-PDGFRA. While T674I has yet to be identified in a GIST, the homologous substitution in KIT (T670I) has been reported in imatinib-resistant tumors.35,42 Based on structural analyses, KIT T670I and PDGFRA T674I would likely alter the ATP-binding pocket in the same manner as T315I in ABL, a mutation that accounts for approximately 20% of secondary imatinib resistance in chronic myelogenous leukemia.32 Thus, in all three kinases, substitution of this critical threonine with a bulkier amino acid is predicted to interfere directly with imatinib binding. The search for compounds less susceptible to this problem is ongoing.

In summary, we have surveyed the spectrum of PDGFRA mutations found in gastrointestinal stromal tumors and examined their sensitivity to imatinib in vitro. On the basis of our findings and other cases of PDGFRA-mutant tumors published to date, the benefit of imatinib treatment may be limited for approximately 62.6% of these tumors. On the other hand, in vitro data suggest that more than a third of PDGFRA-mutant GISTs may be imatinib responsive and, therefore, patients with such tumors deserve a therapeutic trial with the drug. It is likely that molecular screening for KIT and PDGFRA gene mutations, which is now available as a diagnostic adjunct in a number of laboratories around the world, will have an increasing role in the management of patients treated with kinase inhibitors like imatinib.


    Authors' Disclosures of Potential Conflicts of Interest
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 REFERENCES
 
Although all authors completed the disclosure declaration, the following authors or their immediate family members indicated a financial interest. No conflict exists for drugs or devices used in a study if they are not being evaluated as part of the investigation. For a detailed description of the disclosure categories, or for more information about ASCO's conflict of interest policy, please refer to the Author Disclosure Declaration and the Disclosures of Potential Conflicts of Interest section in Information for Contributors.

Authors


Employment


Leadership


Consultant


Stock


Honoraria


Research Funds


Testimony


Other


Christopher L. Corless Novartis Pharmaceuticals (A) Novartis Pharmaceuticals (A)
Michael C. Heinrich





Novartis Pharmaceuticals (A)



Novartis Pharmaceuticals (A)







Dollar Amount Codes (A) < $10,000 (B) $10,000-99,999 (C) ≥ $100,000 (N/R) Not Required


    NOTES
 
Supported by a Merit Review Grant from the Department of Veterans Affairs (M.C.H.).

Terms in blue are defined in the glossary, found at the end of this issue and online at www.jco.org.

Authors' disclosures of potential conflicts of interest are found at the end of this article.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 REFERENCES
 
1. Corless CL, Fletcher JA, Heinrich MC: Biology of gastrointestinal stromal tumors. J Clin Oncol 22:3813-3825, 2004[Abstract/Free Full Text]

2. Heinrich MC, Rubin BP, Longley BJ, et al: Biology and genetic aspects of gastrointestinal stromal tumors: KIT activation and cytogenetic alterations. Hum Pathol 33:484-495, 2002[CrossRef][Medline]

3. Miettinen M, Majidi M, Lasota J: Pathology and diagnostic criteria of gastrointestinal stromal tumors (GISTs): A review. Eur J Cancer 38:S39-S51, 2002 (suppl 5)

4. Demetri GD, von Mehren M, Blanke CD, et al: Efficacy and safety of imatinib mesylate in advanced gastrointestinal stromal tumors. N Engl J Med 347:472-480, 2002[Abstract/Free Full Text]

5. Van Oosterom AT, Judson I, Verweij J, et al: Safety and efficacy of imatinib (STI571) in metastatic gastrointestinal stromal tumours: A phase I study. Lancet 358:1421-1423, 2001[CrossRef][Medline]

6. Heinrich MC, Corless CL, Duensing A, et al: PDGFRA Activating Mutations in Gastrointestinal Stromal Tumors. Science 299:708-710, 2003[Abstract/Free Full Text]

7. Hirota S, Ohashi A, Nishida T, et al: Gain-of-function mutations of platelet-derived growth factor receptor alpha gene in gastrointestinal stromal tumors. Gastroenterology 125:660-667, 2003[CrossRef][Medline]

8. Debiec-Rychter M, Wasag B, Stul M, et al: Gastrointestinal stromal tumours (GISTs) negative for KIT (CD117 antigen) immunoreactivity. J Pathol 202:430-438, 2004[CrossRef][Medline]

9. Lasota J, Dansonka-Mieszkowska A, Sobin LH, et al: A great majority of GISTs with PDGFRA mutations represent gastric tumors of low or no malignant potential. Lab Invest 84:874-883, 2004[CrossRef][Medline]

10. Medeiros F, Corless CL, Duensing A, et al: KIT-negative gastrointestinal stromal tumors: Proof of concept and therapeutic implications. Am J Surg Pathol 28:889-894, 2004[Medline]

11. Wasag B, Debiec-Rychter M, Pauwels P, et al: Differential expression of KIT/PDGFRA mutant isoforms in epithelioid and mixed variants of gastrointestinal stromal tumors depends predominantly on the tumor site. Mod Pathol 17:889-894, 2004[CrossRef][Medline]

12. Wardelmann E, Hrychyk A, Merkelbach-Bruse S, et al: Association of platelet-derived growth factor receptor alpha mutations with gastric primary site and epithelioid or mixed cell morphology in gastrointestinal stromal tumors. J Mol Diagn 6:197-204, 2004[Abstract/Free Full Text]

13. Subramanian S, West RB, Corless CL, et al: Gastrointestinal stromal tumors (GISTs) with KIT and PDGFRA mutations have distinct gene expression profiles. Oncogene 23:7780-7790, 2004[CrossRef][Medline]

14. Kang HJ, Nam SW, Kim H, et al: Correlation of KIT and platelet-derived growth factor receptor alpha mutations with gene activation and expression profiles in gastrointestinal stromal tumors. Oncogene 24:1066-1074, 2005[CrossRef][Medline]

15. Heinrich MC, Corless CL, Demetri GD, et al: Kinase mutations and imatinib response in patients with metastatic gastrointestinal stromal tumor. J Clin Oncol 21:4342-4349, 2003[Abstract/Free Full Text]

16. Corless CL, McGreevey L, Haley A, et al: KIT mutations are common in incidental gastrointestinal stromal tumors one centimeter or less in size. Am J Pathol 160:1567-1572, 2002[Abstract/Free Full Text]

17. Tse KF, Mukherjee G, Small D: Constitutive activation of FLT3 stimulates multiple intracellular signal transducers and results in transformation. Leukemia 14:1766-1776, 2000[CrossRef][Medline]

18. Yee KW, Schittenhelm M, O'Farrell AM, et al: Synergistic effect of SU11248 with cytarabine or daunorubicin on FLT3-ITD positive leukemic cells. Blood 104:4202-4209, 2004[Abstract/Free Full Text]

19. Sakurai S, Hasegawa T, Sakuma Y, et al: Myxoid epithelioid gastrointestinal stromal tumor (GIST) with mast cell infiltrations: A subtype of GIST with mutations of platelet-derived growth factor receptor alpha gene. Hum Pathol 35:1223-1230, 2004[CrossRef][Medline]

20. Yamamoto H, Oda Y, Kawaguchi K, et al: c-kit and PDGFRA mutations in extragastrointestinal stromal tumor (gastrointestinal stromal tumor of the soft tissue). Am J Surg Pathol 28:479-488, 2004[CrossRef][Medline]

21. Chompret A, Kannengiesser C, Barrois M, et al: PDGFRA germline mutation in a family with multiple cases of gastrointestinal stromal tumor. Gastroenterology 126:318-321, 2004[CrossRef][Medline]

22. Sihto H, Sarlomo-Rikala M, Tynninen O, et al: KIT and platelet-derived growth factor receptor alpha tyrosine kinase gene mutations and KIT amplifications in human solid tumors. J Clin Oncol 23:49-57, 2005[Abstract/Free Full Text]

23. Ohashi A, Kinoshita K, Isozaki K, et al: Different inhibitory effect of imatinib on phosphorylation of mitogen-activated protein kinase and Akt and on proliferation in cells expressing different types of mutant platelet-derived growth factor receptor-alpha. Int J Cancer 111:317-321, 2004[CrossRef][Medline]

24. Beghini A, Magnani I, Ripamonti CB, et al: Amplification of a novel c-Kit activating mutation Asn(822)-Lys in the Kasumi-1 cell line: a t(8;21)-Kit mutant model for acute myeloid leukemia. Hematol J 3:157-163, 2002[CrossRef][Medline]

25. Kemmer K, Corless CL, Fletcher JA, et al: KIT mutations are common in testicular seminomas. Am J Pathol 164:305-313, 2004[Abstract/Free Full Text]

26. Przygodzki RM, Hubbs AE, Zhao FQ, et al: Primary mediastinal seminomas: Evidence of single and multiple KIT mutations. Lab Invest 82:1369-1375, 2002[Medline]

27. Antonescu CR, Sommer G, Sarran L, et al: Association of KIT exon 9 mutations with nongastric primary site and aggressive behavior: KIT mutation analysis and clinical correlates of 120 gastrointestinal stromal tumors. Clin Cancer Res 9:3329-3337, 2003[Abstract/Free Full Text]

28. Lasota J, Wozniak A, Sarlomo-Rikala M, et al: Mutations in exons 9 and 13 of KIT gene are rare events in gastrointestinal stromal tumors: A study of 200 cases. Am J Pathol 157:1091-1095, 2000[Abstract/Free Full Text]

29. Heinrich M, Wait CL, Yee KWH, et al: STI571 inhibits the kinase activity of wild type and juxtamembrane c-kit mutants but not the exon 17 D816V mutation associated with mastocytosis. Blood 96:173b, 2000

30. Ma Y, Zeng S, Metcalfe DD, et al: The c-KIT mutation causing human mastocytosis is resistant to STI571 and other KIT kinase inhibitors: Kinases with enzymatic site mutations show different inhibitor sensitivity profiles than wild-type kinases and those with regulatory-type mutations. Blood 99:1741-1744, 2002[Abstract/Free Full Text]

31. Zermati Y, De Sepulveda P, Feger F, et al: Effect of tyrosine kinase inhibitor STI571 on the kinase activity of wild-type and various mutated c-kit receptors found in mast cell neoplasms. Oncogene 22:660-664, 2003[CrossRef][Medline]

32. Daub H, Specht K, Ullrich A: Strategies to overcome resistance to targeted protein kinase inhibitors. Nat Rev Drug Discov 3:1001-1010, 2004[CrossRef][Medline]

33. Mol CD, Fabbro D, Hosfield DJ: Structural insights into the conformational selectivity of STI-571 and related kinase inhibitors. Curr Opin Drug Discov Devel 7:639-648, 2004[Medline]

34. Debiec-Rychter M, Dumez H, Judson I, et al: Use of c-KIT/PDGFRA mutational analysis to predict the clinical response to imatinib in patients with advanced gastrointestinal stromal tumours entered on phase I and II studies of the EORTC Soft Tissue and Bone Sarcoma Group. Eur J Cancer 40:689-695, 2004

35. Fletcher JA, Corless CL, Dimitrijevic S, et al: Mechanisms of resistance to imatinib mesylate (IM) in advanced gastrointestinal stromal tumor (GIST). Proc Am Soc Clin Oncol 22:815, 2003 (abstr 3275)

36. Debiec-Rychter M, van OA, Marynen P: Mechanisms of resistance to imatinib mesylate in gastrointestinal stromal tumors and activity of the PKC412 inhibitor against imatinib-resistant mutants. Gastroenterology 128:270-279, 2005[CrossRef][Medline]

37. Corbin AS, Griswold IJ, La Rosee P, et al: Sensitivity of oncogenic KIT mutants to the kinase inhibitors MLN518 and PD180970. Blood 104:3754-3757, 2004[Abstract/Free Full Text]

38. Schittenhelm M, Shiraga S, Lee FY, et al: BMS-354825 potently inhibits the kinase activity of KIT activation loop mutations associated with systemic mastocytosis and induces apoptosis of mastocytosis cell lines. Blood 104:666a, 2004

39. Shah NP, Lee FY, Sawyers CL, et al: BMS-354825 Is a SRC/ABL Inhibitor with High Nanomolar Activity Against the Kit D816v Mutation, Which Drives Systemic Mastocytosis and Is Imatinib-Resistant. Blood 104:228a, 2004

40. Corbin AS, Demehri S, Griswold IJ, et al: In vitro and in vivo activity of ATP-based kinase inhibitors AP23464 and AP23848 against activation loop mutants of Kit. Blood: Epub ahead of print, March 3, 2005

41. Cools J, DeAngelo DJ, Gotlib J, et al: A tyrosine kinase created by fusion of the PDGFRA and FIP1L1 genes as a therapeutic target of imatinib in idiopathic hypereosinophilic syndrome. N Engl J Med 348:1201-1214, 2003[Abstract/Free Full Text]

42. Tamborini E, Bonadiman L, Greco A, et al: A new mutation in the KIT ATP pocket causes acquired resistance to imatinib in a gastrointestinal stromal tumor patient. Gastroenterology 127:294-299, 2004[CrossRef][Medline]

Submitted January 28, 2005; accepted March 24, 2005.


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Facebook Facebook   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
Am. J. Pathol.Home page
J. Paulsson, T. Sjoblom, P. Micke, F. Ponten, G. Landberg, C.-H. Heldin, J. Bergh, D. J. Brennan, K. Jirstrom, and A. Ostman
Prognostic Significance of Stromal Platelet-Derived Growth Factor {beta}-Receptor Expression in Human Breast Cancer
Am. J. Pathol., July 1, 2009; 175(1): 334 - 341.
[Abstract] [Full Text] [PDF]


Home page
Arch DermatolHome page
C. Gebhardt, M. Averbeck, U. Paasch, S. Ugurel, H. Kurzen, P. Stumpp, J. C. Simon, and R. Treudler
A Case of Cutaneous Rosai-Dorfman Disease Refractory to Imatinib Therapy
Arch Dermatol, May 1, 2009; 145(5): 571 - 574.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
U. McDermott, R. Y. Ames, A. J. Iafrate, S. Maheswaran, H. Stubbs, P. Greninger, K. McCutcheon, R. Milano, A. Tam, D. Y. Lee, et al.
Ligand-Dependent Platelet-Derived Growth Factor Receptor (PDGFR)-{alpha} Activation Sensitizes Rare Lung Cancer and Sarcoma Cells to PDGFR Kinase Inhibitors
Cancer Res., May 1, 2009; 69(9): 3937 - 3946.
[Abstract] [Full Text] [PDF]


Home page
The OncologistHome page
T. W. Kim, M.-H. Ryu, H. Lee, S. J. Sym, J.-L. Lee, H. M. Chang, Y. S. Park, K. H. Lee, W. K. Kang, D. B. Shin, et al.
Kinase Mutations and Efficacy of Imatinib in Korean Patients with Advanced Gastrointestinal Stromal Tumors
Oncologist, May 1, 2009; 14(5): 540 - 547.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
N. von Bubnoff, R. A. Engh, E. Aberg, J. Sanger, C. Peschel, and J. Duyster
FMS-Like Tyrosine Kinase 3-Internal Tandem Duplication Tyrosine Kinase Inhibitors Display a Nonoverlapping Profile of Resistance Mutations In vitro
Cancer Res., April 1, 2009; 69(7): 3032 - 3041.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
F. Carlomagno, T. Guida, S. Anaganti, L. Provitera, S. Kjaer, N. Q McDonald, A. J Ryan, and M. Santoro
Identification of tyrosine 806 as a molecular determinant of RET kinase sensitivity to ZD6474
Endocr. Relat. Cancer, March 1, 2009; 16(1): 233 - 241.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
M. C. Heinrich, R. G. Maki, C. L. Corless, C. R. Antonescu, A. Harlow, D. Griffith, A. Town, A. Mckinley, W.-B. Ou, J. A. Fletcher, et al.
Primary and Secondary Kinase Genotypes Correlate With the Biological and Clinical Activity of Sunitinib in Imatinib-Resistant Gastrointestinal Stromal Tumor
J. Clin. Oncol., November 20, 2008; 26(33): 5352 - 5359.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
M. C. Heinrich, K. Owzar, C. L. Corless, D. Hollis, E. C. Borden, C. D.M. Fletcher, C. W. Ryan, M. von Mehren, C. D. Blanke, C. Rankin, et al.
Correlation of Kinase Genotype and Clinical Outcome in the North American Intergroup Phase III Trial of Imatinib Mesylate for Treatment of Advanced Gastrointestinal Stromal Tumor: CALGB 150105 Study by Cancer and Leukemia Group B and Southwest Oncology Group
J. Clin. Oncol., November 20, 2008; 26(33): 5360 - 5367.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
B. Dewaele, B. Wasag, J. Cools, R. Sciot, H. Prenen, P. Vandenberghe, A. Wozniak, P. Schoffski, P. Marynen, and M. Debiec-Rychter
Activity of Dasatinib, a Dual SRC/ABL Kinase Inhibitor, and IPI-504, a Heat Shock Protein 90 Inhibitor, against Gastrointestinal Stromal Tumor-Associated PDGFRAD842V Mutation
Clin. Cancer Res., September 15, 2008; 14(18): 5749 - 5758.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
A. Artinyan, J. Kim, P. Soriano, W. Chow, S. Bhatia, and J. D.I. Ellenhorn
Metastatic Gastrointestinal Stromal Tumors in the Era of Imatinib: Improved Survival and Elimination of Socioeconomic Survival Disparities
Cancer Epidemiol. Biomarkers Prev., August 1, 2008; 17(8): 2194 - 2201.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. C. Heinrich, H. Joensuu, G. D. Demetri, C. L. Corless, J. Apperley, J. A. Fletcher, D. Soulieres, S. Dirnhofer, A. Harlow, A. Town, et al.
Phase II, Open-Label Study Evaluating the Activity of Imatinib in Treating Life-Threatening Malignancies Known to Be Associated with Imatinib-Sensitive Tyrosine Kinases
Clin. Cancer Res., May 1, 2008; 14(9): 2717 - 2725.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
T. Trowe, S. Boukouvala, K. Calkins, R. E. Cutler Jr., R. Fong, R. Funke, S. B. Gendreau, Y. D. Kim, N. Miller, J. R. Woolfrey, et al.
EXEL-7647 Inhibits Mutant Forms of ErbB2 Associated with Lapatinib Resistance and Neoplastic Transformation
Clin. Cancer Res., April 15, 2008; 14(8): 2465 - 2475.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Pathol.Home page
A L Gomes, A Gouveia, A F Capelinha, D de la Cruz, P Silva, R M Reis, A Pimenta, and J M Lopes
Molecular alterations of KIT and PDGFRA in GISTs: evaluation of a Portuguese series
J. Clin. Pathol., February 1, 2008; 61(2): 203 - 208.
[Abstract] [Full Text] [PDF]


Home page
Am Soc Clin Oncol Ed BookHome page
P. A. Cassier, A. Dufresne, and J.-Y. Blay
Controversies in the Adjuvant Treatment of Gastrointestinal Stromal Tumors (GIST) with Imatinib
ASCO Educational Book, January 1, 2008; 2008(1): 524 - 528.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
B. Pasini, L. Matyakhina, T. Bei, M. Muchow, S. Boikos, B. Ferrando, J. A. Carney, and C. A. Stratakis
Multiple Gastrointestinal Stromal and Other Tumors Caused by Platelet-Derived Growth Factor Receptor {alpha} Gene Mutations: A Case Associated with a Germline V561D Defect
J. Clin. Endocrinol. Metab., September 1, 2007; 92(9): 3728 - 3732.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
T. Guida, S. Anaganti, L. Provitera, R. Gedrich, E. Sullivan, S. M. Wilhelm, M. Santoro, and F. Carlomagno
Sorafenib Inhibits Imatinib-Resistant KIT and Platelet-Derived Growth Factor Receptor {beta} Gatekeeper Mutants
Clin. Cancer Res., June 1, 2007; 13(11): 3363 - 3369.
[Abstract] [Full Text] [PDF]


Home page
J. Mol. Diagn.Home page
A. Zamo, A. Bertolaso, I. Franceschetti, G. Weirich, P. Capelli, S. Pecori, M. Chilosi, H. Hoefler, F. Menestrina, and A. Scarpa
Microfluidic Deletion/Insertion Analysis for Rapid Screening of KIT and PDGFRA Mutations in CD117-Positive Gastrointestinal Stromal Tumors: Diagnostic Applications and Report of a New KIT Mutation
J. Mol. Diagn., April 1, 2007; 9(2): 151 - 157.
[Abstract] [Full Text] [PDF]


Home page
J. Mol. Diagn.Home page
J. Lasota, B. Wasag, S. E. Steigen, J. Limon, and M. Miettinen
Improved Detection of KIT Exon 11 Duplications in Formalin-Fixed, Paraffin-Embedded Gastrointestinal Stromal Tumors
J. Mol. Diagn., February 1, 2007; 9(1): 89 - 94.
[Abstract] [Full Text] [PDF]


Home page
Ann. Surg. Oncol.Home page
H.-Y. Huang, W.-W. Huang, C.-N. Lin, H.-L. Eng, S.-H. Li, C.-F. Li, D. Lu, S.-C. Yu, and C.-Y. Hsiung
Immunohistochemical Expression of p16INK4A, Ki-67, and Mcm2 Proteins in Gastrointestinal Stromal Tumors: Prognostic Implications and Correlations with Risk Stratification of NIH Consensus Criteria
Ann. Surg. Oncol., December 1, 2006; 13(12): 1633 - 1644.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
M. C. Heinrich, C. L. Corless, C. D. Blanke, G. D. Demetri, H. Joensuu, P. J. Roberts, B. L. Eisenberg, M. von Mehren, C. D.M. Fletcher, K. Sandau, et al.
Molecular Correlates of Imatinib Resistance in Gastrointestinal Stromal Tumors
J. Clin. Oncol., October 10, 2006; 24(29): 4764 - 4774.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Pathol.Home page
L Tornillo and L M Terracciano
An update on molecular genetics of gastrointestinal stromal tumours.
J. Clin. Pathol., June 1, 2006; 59(6): 557 - 563.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
H. Prenen, J. Cools, N. Mentens, C. Folens, R. Sciot, P. Schoffski, A. Van Oosterom, P. Marynen, and M. Debiec-Rychter
Efficacy of the Kinase Inhibitor SU11248 against Gastrointestinal Stromal Tumor Mutants Refractory to Imatinib Mesylate
Clin. Cancer Res., April 15, 2006; 12(8): 2622 - 2627.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
V. Rand, J. Huang, T. Stockwell, S. Ferriera, O. Buzko, S. Levy, D. Busam, K. Li, J. B. Edwards, C. Eberhart, et al.
Sequence survey of receptor tyrosine kinases reveals mutations in glioblastomas
PNAS, October 4, 2005; 102(40): 14344 - 14349.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Corless, C. L.
Right arrow Articles by Heinrich, M. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Corless, C. L.
Right arrow Articles by Heinrich, M. C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

About
JCO
 Editorial
Roster
 Advertising
Information
 Librarians &
Institutions
 Rights &
Permissions
 PDA Services

Copyright © 2005 by the American Society of Clinical Oncology, Online ISSN: 1527-7755. Print ISSN: 0732-183X
Terms and Conditions of Use
  HighWire Press HighWire Press™ assists in the publication of JCO Online