Advertisement
Journal of Clinical Oncology  
Search for:
Limit by:
  Browse by Subject or Issue
Home Search or Browse JCO My JCO Subscriptions Customer Service Site Map

Originally published as JCO Early Release 10.1200/JCO.2005.02.857 on July 25 2005

Journal of Clinical Oncology, Vol 23, No 25 (September 1), 2005: pp. 5900-5909
© 2005 American Society of Clinical Oncology.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow [Publisher's Note]
Right arrow [Editor's Note]
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Eberhard, D. A.
Right arrow Articles by Hillan, K. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Eberhard, D. A.
Right arrow Articles by Hillan, K. J.
Related Articles
Right arrowRelated Editorial

Mutations in the Epidermal Growth Factor Receptor and in KRAS Are Predictive and Prognostic Indicators in Patients With Non–Small-Cell Lung Cancer Treated With Chemotherapy Alone and in Combination With Erlotinib

David A. Eberhard, Bruce E. Johnson, Lukas C. Amler, Audrey D. Goddard, Sherry L. Heldens, Roy S. Herbst, William L. Ince, Pasi A. Jänne, Thomas Januario, David H. Johnson, Pam Klein, Vincent A. Miller, Michael A. Ostland, David A. Ramies, Dragan Sebisanovic, Jeremy A. Stinson, Yu R. Zhang, Somasekar Seshagiri, Kenneth J. Hillan

From the Departments of Pathology, Molecular Diagnostics, Molecular Biology, Biostatistics and BioOncology, Genentech Inc, San Francisco, CA; Department of Medical Oncology, Dana-Farber Cancer Institute, and Departments of Medicine, Brigham and Women's Hospital and Harvard Medical School, Boston, MA; The University of Texas M.D. Anderson Cancer Center, Houston, TX; Vanderbilt Medical Center, Nashville, TN; and Thoracic Oncology Service, Department of Medicine, Memorial Sloan-Kettering Cancer Center, New York, NY

Address reprint requests to Kenneth J. Hillan, MD, Genentech Inc, 1 DNA Way, San Francisco, CA 94080: e-mail: kjh{at}gene.com


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Editor’s Note
 Appendix
 Authors' Disclosures of...
 REFERENCES
 
PURPOSE: Epidermal growth factor receptor (EGFR) mutations have been associated with tumor response to treatment with single-agent EGFR inhibitors in patients with relapsed non–small-cell lung cancer (NSCLC). The implications of EGFR mutations in patients treated with EGFR inhibitors plus first-line chemotherapy are unknown. KRAS is frequently activated in NSCLC. The relationship of KRAS mutations to outcome after EGFR inhibitor treatment has not been described.

PATIENTS AND METHODS: Previously untreated patients with advanced NSCLC in the phase III TRIBUTE study who were randomly assigned to carboplatin and paclitaxel with erlotinib or placebo were assessed for survival, response, and time to progression (TTP). EGFR exons 18 through 21 and KRAS exon 2 were sequenced in tumors from 274 patients. Outcomes were correlated with EGFR and KRAS mutations in retrospective subset analyses.

RESULTS: EGFR mutations were detected in 13% of tumors and were associated with longer survival, irrespective of treatment (P < .001). Among erlotinib-treated patients, EGFR mutations were associated with improved response rate (P < .05) and there was a trend toward an erlotinib benefit on TTP (P = .092), but not improved survival (P = .96). KRAS mutations (21% of tumors) were associated with significantly decreased TTP and survival in erlotinib plus chemotherapy–treated patients.

CONCLUSION: EGFR mutations may be a positive prognostic factor for survival in advanced NSCLC patients treated with chemotherapy with or without erlotinib, and may predict greater likelihood of response. Patients with KRAS-mutant NSCLC showed poorer clinical outcomes when treated with erlotinib and chemotherapy. Further studies are needed to confirm the findings of this retrospective subset analysis.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Editor’s Note
 Appendix
 Authors' Disclosures of...
 REFERENCES
 
Lung cancer is the most common cause of cancer deaths worldwide, and most cases are associated with cigarette smoking.[1] Non–small-cell lung cancer (NSCLC) arising in smokers has a different spectrum of molecular abnormalities than those seen in nonsmokers,[2] suggesting differences in molecular etiology, pathogenesis, and possibly prognosis. For example, KRAS mutations occur in 10% to 30% of NSCLC cases, show a strong association with smoking history[3] and have been associated with poor prognosis in several studies.[4-11]

The epidermal growth factor receptor (EGFR) is a receptor tyrosine kinase expressed in the majority of NSCLCs. The efficacy of EGFR inhibitors in preclinical models,[12] together with favorable toxicity profiles, have led to their clinical development for NSCLC and other solid tumors. Erlotinib and gefitinib are small-molecule inhibitors of the EGFR tyrosine kinase, which showed antitumor activity in patients with NSCLC as single agents in phase II trials. A study of erlotinib in 57 patients with relapsed NSCLC demonstrated an objective response rate (ORR) of 12.3%,[13,14] and gefitinib provided an overall response rate of 10.4% in European patients and 27.5% in Japanese patients.[15] Subgroup analyses of 136 NSCLC patients suggest that nonsmokers have a three-fold higher ORR than smokers.[16] In phase III studies of patients with untreated advanced NSCLC, adding gefitinib or erlotinib to chemotherapy did not significantly improve outcome over chemotherapy alone.[17-19] One possible explanation for the failure to observe added benefit in these trials is that patients were not screened and selected for their capability to derive clinical benefit from an EGFR inhibitor, since there is no available test to identify such patients.[20]

Recently, tumor somatic mutations in exons 18 through 21 of the tyrosine kinase domain of EGFR were described in 13 of 14 NSCLC patients who showed objective clinical responses to gefitinib monotherapy, whereas these mutations were not detected in tumors in 11 patients who did not respond.[21,22] The frequency of heterozygous EGFR mutations (amino acid substitutions and in-frame deletions) was 2% to 8% in the United States' population and 26% in Japanese patients. Similarly, mutations were detected in the tumors of 10 of 14 NSCLC patients who responded to erlotinib, and in one of 15 nonresponders.[23,24] The patients with EGFR-mutant tumors had never smoked cigarettes or that they had remote smoking histories.[21] Functional analysis of EGFR mutants in cell lines showed elevated ligand-dependent activation of the receptor, and furthermore revealed that the mutants were inhibited by lower concentrations of gefitinib compared with wild-type EGFR.[21,22] Thus, EGFR mutations may define a subset of tumors that are highly dependent on EGFR signaling and more responsive to EGFR inhibition. It is not yet known whether NSCLC patients with EGFR-mutant tumors experience improved survival with EGFR inhibitor therapy or if there is prognostic significance of the mutations outside the setting of EGFR inhibition.

The RAS/MAPK and PI3K/AKT pathways are major signaling networks linking EGFR activation to cell proliferation and survival.[25] Mutations in these downstream effectors of EGFR signaling could lead to resistance to EGFR inhibitors.[26,27] In NSCLC, the most frequently reported alteration in EGFR signaling pathways is mutation of the KRAS gene.[3-10] Because EGFR and KRAS function sequentially in the MAPK signaling pathway, activating mutations in these two molecules might be functionally redundant and therefore mutually exclusive, where this pathway is dominant for driving tumor growth. A recent study did not find an obvious relationship between KRAS-mutation status and sensitivity to EGFR inhibitors in NSCLC cell lines,[28] but there are no clinical data regarding this relationship in patients.

The present study examined the influence of somatic EGFR and KRAS mutations on the clinical outcome of patients with advanced NSCLC. Tumor DNA was sequenced from a subset of NSCLC patients enrolled on a trial of first-line carboplatin and paclitaxel (CP) with or without erlotinib (TRIBUTE). In contrast to previous studies,[21-24] tumors for sequencing were not preselected based on response or other clinical characteristics. Mutation status was then correlated with clinical data.[19]


    PATIENTS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Editor’s Note
 Appendix
 Authors' Disclosures of...
 REFERENCES
 
Patient Samples
A phase III randomized trial conducted in the United States, sponsored by Genentech (TRIBUTE), enrolled 1,079 chemotherapy-naïve patients with locally advanced or metastatic (stage IIIB or IV) NSCLC to compare the survival of patients who received erlotinib administered concurrently with a regimen of CP (n = 539) with patients who received CP alone (n = 540). The primary efficacy end point was duration of survival, and the secondary efficacy end points were time to progression (TTP), ORR (defined by RECIST), duration of response, and time to symptomatic progression. The erlotinib-containing arm did not demonstrate any advantage for survival, ORR, TTP, and duration of response over CP alone.[19]

The TRIBUTE clinical protocol was approved by institutional review boards for each participating site and by the US Food and Drug Administration. All patients gave written informed consent for participation in the clinical study. Patients were given the option of providing an additional written informed consent to allow release of their archival tumor samples for research purposes. Seven hundred ten patients provided the second, fully optional, written informed consent for tumor tissue research, and archival pathology specimens were released to Genentech Inc (San Francisco, CA) for 479 of these patients. The specimens from 274 patients contained sufficient quantities of tumor cells to attempt tumor DNA sequencing. The primary pathology reports and histopathologic diagnoses were reviewed by a pathologist (D.A.E. or K.J.H.).

Sequence Analysis
All available tissue samples were evaluated for tumor content and processed for tumor DNA sequencing in blinded fashion, without knowledge of clinical outcome or treatment received.

Formalin-fixed paraffin-embedded tissue sections were stained with hematoxylin and eosin for laser capture microdissection of tumor cells (PixCell II, Arcturus, Mountain View, CA). DNA was extracted from microdissected tissue, and amplifications of exons 18 through 21 of EGFR and exon 2 of KRAS were carried out using nested primers (primer sequences and details of the amplification procedures are provided in Supplemental [Table 1]). Polymerase chain reaction products were sequenced in both sense and antisense directions. EGFR mutations detected in the initial round of sequencing were confirmed by subsequent rounds of independent polymerase chain reaction and sequencing reactions. Only confirmed mutations in both rounds are reported. KRAS mutations identified in the initial sequencing round are reported.


View this table:
[in this window]
[in a new window]
 
Table 1. Summary of the EGFR and KRAS Mutational Analysis

 
Statistical Analyses
Demographic variables were summarized by mutation status. ORR was summarized by mutation status and treatment received. Formal comparisons across groups were made with Fisher's exact tests (categoric variables) and t tests (continuous variables). Time to event variables (ie, duration of survival and TTP) were summarized by Kaplan-Meier curves. Median time to event was estimated from the Kaplan-Meier curve. Formal comparisons between groups for time-to-event variables were performed via log-rank tests. Hazard ratios were estimated by Cox regression. All hypothesis tests were two-sided. Patients with missing values (including indeterminant tumor mutation status) for a given clinical variable were excluded from any analysis involving that variable.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Editor’s Note
 Appendix
 Authors' Disclosures of...
 REFERENCES
 
Baseline demographics of patients with EGFR or KRAS sequence data were analyzed. All examined variables seem balanced between the patients with available tumor DNA sequence and those without (see Supplemental [Table 2] for stage of disease, Eastern Cooperative Oncology Group status, age, smoking, and sex). The outcome variables also seem roughly balanced between the two groups. Median TTP was 4.8 months for patients without sequence versus 5.4 months for patients with sequence (P = .12). Median survival was 10.2 months (without sequence) versus 11.5 months (with sequence; P = .38; Supplemental [Table 2]).


View this table:
[in this window]
[in a new window]
 
Table 2. Mutations in EGFR and KRAS

 
Tumor EGFR mutations were identified in 29 (12.7%) of 228 (95% CI, 8% to 17%) patients ([Tables 1] and [2], and Supplemental [Table 3]). The E746-A750 deletion (15 of 29) and L858R substitution (seven of 29) mutations were the most common, as previously described.[21,22] Five novel mutations (one in exon 18, one in exon 19, and three in exon 20) and three other previously reported mutations were also observed ([Table 2] and Supplemental [Fig 1]). One tumor had mutations in both exons 18 and 20, for a total of 30 mutations. Two of the three mutations observed in exon 20 were insertions, in contrast to the in-frame deletions seen in exon 19; 26 of the 30 mutations were heterozygous.


View this table:
[in this window]
[in a new window]
 
Table 3. Demographics of Patients With Mutations in Their Tumor Versus Those Without

 


View larger version (21K):
[in this window]
[in a new window]
 
Fig 1. Kaplan-Meier curves by epidermal growth factor receptor (EGFR) mutation status. One EGFR wild-type patient had a missing value for treatment received and was excluded from [Figures 1C and 1D]. The tick marks indicate patients who were still alive at the time of the analyses or who were censored. All P values refer to log-rank tests. (A) Time to progression, by EGFR mutation status. The P value for patients with EGFR-mutant versus wild-type tumors is < .001. (B) Survival, by EGFR mutation status. The P value for patients with EGFR-mutant versus wild-type tumors is < .001. (C) Time to progression by treatment received and EGFR mutation status: P = .092 for erlotinib plus chemotherapy versus chemotherapy alone among patients with EGFR-mutant tumors (dashed lines) and P = .156 for erlotinib plus chemotherapy versus chemotherapy alone among patients with wild-type tumors (solid lines). (D) Survival by treatment received and EGFR mutation status: P = .958 for erlotinib plus chemotherapy versus chemotherapy alone among patients with EGFR-mutant tumors (dashed lines) and P = .294 for erlotinib plus chemotherapy versus chemotherapy alone among patients with wild-type tumors (solid lines).

 
KRAS mutations were detected in DNA from tumors in 55 (21%) of 264 (95% CI, 16% to 26%) patients ([Tables 1] and [2], and Supplemental [Table 3]). KRAS was successfully sequenced more often than EGFR because of the simpler sequencing strategy required. Single amino acid substitutions in codon 12 were most common (51 of 55), whereas codon 13 mutations were found in only four samples ([Table 2] and Supplemental [Fig 1]). Only two patients had tumors carrying both EGFR and KRAS mutations ([Table 1] and Supplemental [Table 3]).

Seventeen percent of patients with EGFR mutations were never smokers, compared with 8% of wild-type patients. Conversely, 17% (33 of 199) of wild-type patients were current smokers, compared with 7% (two of 29) of those with mutations. However, in both EGFR subgroups, three quarters of patients had a previous smoking history, and the overall differences in smoking histories between the subgroups did not reach statistical significance (P = .12; [Table 3]). There is a statistically significant association between EGFR mutations and younger age (median ages were 59 and 64 years for patients with mutant versus wild-type tumors, respectively, P < .01). The presence of KRAS mutations was positively associated with a history of smoking (P < .01); no KRAS mutations were detected in 10 never smokers sequenced. Among patients whose mutation status was determined for both EGFR and KRAS, two patients were mutant for both genes ([Table 1] and Supplemental [Table 3]). If EGFR and KRAS mutations occurred independently, roughly six patients would be expected to have tumors mutant for both genes in this data set. Formal testing of this discrepancy (P = .051) suggests a possible negative association between EGFR and KRAS mutation.

Improved ORR to treatment with erlotinib plus CP was observed among patients with EGFR-mutant tumors (53%) versus patients with wild-type tumors (18%; [Table 4]; P < .01). Among patients with EGFR-mutant tumors, 53% of those treated with erlotinib plus CP achieved response, versus 21% for those treated with CP alone (P = .13). Furthermore, no other pair-wise comparison of ORR was significant (P < .05). Combining treatment arms, an increased percentage of patients with EGFR-mutant tumors (38%) responded to treatment, compared with patients who had wild-type tumors (23%; P = .01).


View this table:
[in this window]
[in a new window]
 
Table 4. Objective Response: EGFR or KRAS Mutant Versus Wild-Type

 
While tumor response by RECIST may indicate drug activity, for cytostatic agents such as erlotinib, it may be more appropriate to assess clinical benefit by TTP or survival rather than ORR. Both TTP and survival for the patients were affected by EGFR-mutation status. Combining the erlotinib plus CP and CP alone treatment groups, the patients with EGFR-mutant tumors experienced a prolonged median TTP of 8 months, compared with 5 months for those without mutations (P < .001; 95% CI for hazard ratio ]HR[, 0.5 to 0.8; [Fig 1A]). The median survival of patients with wild-type tumors was 10 months (P < .001; 95% CI for HR, 0.1 to 0.5); however, Kaplan-Meier estimates of median survival could not be calculated for the EGFR-mutated subgroup ([Fig 1B]). Comparing treatment arms, there was an increased TTP with erlotinib plus CP treatment (median TTP, 12.5 months) compared with CP alone (median TTP, 6.6 months) in the EGFR-mutated subgroup, but the difference did not reach statistical significance with this number of patients (P = .092; 95% CI for HR, 0.2 to 1.2; [Fig 1C]). There was no discernable difference in the survival curves of EGFR-mutated subgroups between the two treatment arms (P = .96; 95% CI for HR, 0.2 to 3.9; [Fig 1D]). Kaplan-Meier estimates of median survival could not be calculated for the EGFR-mutated subgroups since only four deaths were observed.

The response rate for 209 patients with KRAS–wild-type tumors was 26%, irrespective of therapy ([Table 4]; 95% CI for difference, –12% to 12%). In patients with KRAS-mutant tumors, ORR was 8% for those receiving erlotinib plus CP, compared with 23% in the subgroup receiving CP alone ([Table 4]; P = .16; 95% CI for difference, –5% to 35%). As seen in [Figure 2], patients with KRAS-mutant tumors who were treated with erlotinib plus CP had shorter median TTP (3.4 months; 95% CI, 1.5 to 6.3 months) and survival (4.4 months; 95% CI, 3.4 to 12.9 months) than the other three patient groups: KRAS mutant and CP alone (TTP: 6 months; 95% CI, 4.9 to 7.1 months; survival: 13.5 months; 95% CI, 11.1 to 15.9 months); KRAS wild-type and CP alone (TTP: 5.4 months; 95% CI, 4.4 to 6.1; survival: 11.3 months; 95% lower confidence limit = 9.1 months), and KRAS wild-type and erlotinib plus CP (TTP: 5.3 months; 95% CI, 4.4 to 6.1 months; survival, 12.1 months; 95% CI, 9.2 to 15.6 months.). Among patients with KRAS-mutant tumors, the HR of erlotinib plus CP versus CP alone was 2.1 (95% CI, 1.1 to 3.8) for survival and 1.9 (95% CI, 1.1 to 3.6) for TTP.



View larger version (12K):
[in this window]
[in a new window]
 
Fig 2. Kaplan-Meier curves by treatment received and KRAS-mutation status. Two KRAS-wild-type patients had missing values for treatment received and were excluded from [Figures 2A and 2B]. The tick marks indicate patients who were still alive at the time of the analyses or who were censored. All P values refer to log-rank tests. (A) Time to progression, by treatment received and KRAS-mutation status: P = .03 for erlotinib plus chemotherapy versus chemotherapy alone among patients with KRAS-mutant tumors (dashed lines) and P = .668 for erlotinib plus chemotherapy versus chemotherapy alone among patients with wild-type tumors (solid lines). (B) Survival, by treatment received and KRAS-mutation status: P = .019 for erlotinib plus chemotherapy versus chemotherapy alone among patients with KRAS-mutant tumors (dashed lines) and P = .792 for erlotinib plus chemotherapy versus chemotherapy alone among patients with wild-type tumors (solid lines).

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Editor’s Note
 Appendix
 Authors' Disclosures of...
 REFERENCES
 
The phase III TRIBUTE trial did not show improvement in overall clinical benefit for patients with advanced NSCLC when erlotinib was added to first-line combination chemotherapy; however, subgroup analyses have added to our understanding of the potential effects of erlotinib in this setting. Three subgroups of particular interest are nonsmokers, patients with EGFR-mutant tumors, and those with KRAS-mutant tumors. Nonsmokers appear especially responsive to single-agent gefitinib[16] and showed improved survival with erlotinib treatment in TRIBUTE.[19] Lynch et al[21] reported that gefitinib-sensitive patients with EGFR mutations in exons 18 through 21 are likely to have a negative or remote smoking history. In the present study, all available tumors were sequenced from the TRIBUTE trial and showed an overall EGFR mutation frequency of 12.7%. The proportion of patients who were never smokers was higher in the subgroup with EGFR mutations compared with the wild-type subgroup, but the difference in smoking history was not significant overall. Previous observations also associated EGFR mutations with other clinical subsets of NSCLC patients known to be more responsive to gefitinib, including women, patients with a Japanese racial background, and those with adenocarcinoma or bronchioloalveolar tumor subtype.[20,21] There was no significant sex, histologic subtype, or racial difference in EGFR mutation status, though Asian rather than Japanese ethnicity was captured in the clinical database. It is possible that the previously suggested associations between EGFR mutation and various demographic and pathologic parameters seemed stronger because the examined tumors were preselected for response to gefitinib or other clinicopathologic characteristics, whereas no such preselection was performed in the present study.

The majority of the EGFR mutations in this study confirmed those previously reported,[20,21] and five novel mutations were also identified. The majority of the mutations identified were heterozygous, suggesting that they are likely dominant and play a role in tumorigenesis. There was no matched normal tissue available for sequencing, and previous reports indicate that the mutations are likely somatic.[22] As previously noted, the identified mutations cluster around the adenosine triphosphate–binding pocket of the kinase domain and could alter the residues that make contact with adenosine triphosphate or erlotinib, resulting in altered regulation of the kinase.21,22]

Subgroup analysis of TRIBUTE based on tumor EGFR mutation status demonstrated that patients with EGFR mutations showed significantly better clinical outcomes than those with wild-type EGFR in all assessed end points (ORR, TTP, and survival). For this reason, tumor EGFR-mutation status is a favorable prognostic factor. Whether tumor EGFR status is predictive of meaningful clinical benefit specific to erlotinib in combination with chemotherapy is, however, less clear. Patients with EGFR-mutant tumors showed a significantly better ORR than wild-type EGFR when treated with erlotinib plus CP. Among EGFR mutants, ORR was higher in the erlotinib plus CP arm compared with CP alone, but this did not reach statistical significance. These findings are consistent with previous observations[21,22] that suggest EGFR mutations may be associated with greater likelihood of objective response to EGFR inhibitors. There was no observed difference in survival between treatment groups in patients with NSCLC tumors carrying EGFR mutations, though at the time of this analysis, the number of events was too few to allow the determination of median survival in the EGFR-mutated groups. The ability of these data to clearly demonstrate the relationship of EGFR mutation to the clinical effects of erlotinib is confounded by the presence of active chemotherapy and is statistically limited by the relatively small numbers of patients in the subgroups. The statistical limitation is evident in the wide 95% CIs for the HRs between treatment groups among patients with EGFR-mutated tumors: progression-free survival HR, 0.2 to 1.2; survival HR, 0.2 to 3.9. Mutations in codons 12 or 13 account for nearly all KRAS mutations in NSCLC[29] and were detected in 21% of the TRIBUTE tumor samples. In contrast to EGFR mutations, KRAS mutations were not found in never smokers, and there was a tendency for mutations in the two genes to be mutually exclusive of each other. This may indicate a difference in the etiologies of the mutations; for example, smoking-dependent versus -independent. It also could reflect functional redundancy between the two genes so that acquisition of the second mutation confers little additional biologic advantage and does not undergo selection during tumor evolution in tumor cells carrying one mutation.

We hypothesized that activating KRAS mutations might diminish tumor responsiveness to EGFR inhibition since KRAS is downstream of EGFR signaling. The correlation of KRAS status to clinical outcomes showed that patients with KRAS-mutant tumors not only fail to benefit from erlotinib plus CP, but may experience decreased survival and TTP compared with CP alone in the first-line metastatic setting. The observed negative interaction between erlotinib and KRAS mutation is difficult to explain given our present knowledge of the mechanism of erlotinib action and KRAS tumor biology. The clinical data do not support a possible antagonistic interaction between erlotinib and chemotherapy since the response rate in patients with EGFR-mutated tumors was significantly higher in the erlotinib plus CP arm compared with CP alone, and erlotinib treatment resulted in a substantial survival advantage in the prospectively defined subgroup of never smokers in TRIBUTE.[29A] Despite demonstrating statistical significance, the erlotinib-KRAS interaction results must be viewed cautiously, especially since survival results were not overwhelming (P = .019 for survival), and because the study involved multiple subsets and was retrospective. Moreover, the relatively small number of patients with KRAS-mutant tumors increases the likelihood of an imbalance in baseline characteristics that could have been responsible for some or all of the observed difference between treatment groups. Although no such imbalance was found during clinical review and exploratory multivariate modeling efforts (data not shown), this possibility cannot be completely excluded.

While the retrospective analyses of tumor-specific EGFR and KRAS mutations in a subgroup of patients from an overall negative clinical trial has methodological and statistical shortcomings, the findings described generate hypotheses that can be tested prospectively in appropriately designed studies. The present findings suggest that testing for EGFR mutations could be of prognostic importance for patients with NSCLC, but the relevance of such testing in selecting NSCLC patients for erlotinib therapy remains unclear. The implications of these observations are particularly intriguing when considered in context of recent results from BR.21, a randomized phase III trial of single-agent erlotinib in unselected second- and third-line NSCLC patients. The trial demonstrated a 42.5% improvement in median survival (4.7 v 6.7 months) and a 41% relative improvement in 1-year survival rates (21% v 32%) compared with placebo,[30] so it is possible that retrospective analyses of tumor samples from patients in the BR.21 trial might provide a stronger indication of whether or not EGFR mutations are associated with the survival benefit of erlotinib. Definitive answers will require larger prospective trials with mandatory tissue testing, sufficiently powered to demonstrate erlotinib treatment effect in subgroups identified by EGFR status.


    Editor’s Note
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Editor’s Note
 Appendix
 Authors' Disclosures of...
 REFERENCES
 
A related article on this subject will be published in the November 1, 2005, issue titled Epidermal Growth Factor Receptor Mutations and Gene Amplification in Non–Small-Cell Lung Cancer: Molecular Analysis of the IDEAL/INTACT Gefitinib Trials; by Daphne W. Bell, Thomas J. Lynch, Sara M. Haserlat, Patricia L. Harris, Ross A. Okimoto, Brian W. Brannigan, Dennis C. Sgroi, Beth Muir, Markus J. Riemenschneider, Renee Bailey Iacona, Annetta D. Krebs, David H. Johnson, Giuseppe S. Giaccone, Roy S. Herbst, Christian Manegold, Masahiro Fukuoka, Mark G. Kris, Jose Baselga, Judith S. Ochs, and Daniel A. Haber.


    Appendix
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Editor’s Note
 Appendix
 Authors' Disclosures of...
 REFERENCES
 
The following investigators provided tissue blocks and/or unstained sections from one or more of their patients enrolled on the TRIBUTE clinical trial; without their enthusiasm and hard work this study would not have been possible: Abramson N, Jacksonville, FL; Abubakr Y, Jacksonville, FL; Anderson T, Bedford, TX; Anthony S, Spokane, WA; Arseneau J, Amsterdam, NY; Beck T, Boise, ID; Belt R, Westwood, MT; Berry W, Cary, NC; Bhaskar B, Orange, CA; Breyer W, Provo, UT; Bushunow P, Rochester, NY; Butler R, Charlotte, NC; Canfield V, Norman, OK; Chittoor S, Mesquite, TX; Chu L, Sarasota, FL; Cobb P, Billings, MT; Cohn A, Denver, CO; Del Prete S, Stamford, CT; Deutsch M, Raleigh, NC; DiBella N, Aurora, CO; Dowlati A, Cleveland, OH; Dreisbach P, Rancho Mirage, CA; Entmacher M, Mt Holly, NJ; Fanucchi M, Atlanta, GA; Fehrenbacher L, Vallejo, CA; Figueroa J, Lubbock, TX; Fitzgibbons J, Eugene, OR; Fleagle J, Boulder, CO; Flynn P, St Louis Park, MN; Fox S, Paoli, PA; Frank R, Norwalk, CT; Gabrail N, Canton, OH; Geils G, Charleston, SC; Gill A, Aiken, SC; Greco F, Nashville, TN; Grunberg S, Burlington, VT; Gucalp R, Bronx, NY; Guerra M, Miami, FL; Gupta V, St Joseph, MO; Gutierrez M, Fort Lauderdale, FL; Hajdenberg J, Atlanta, GA; Hamm J, Louisville, KY; Harker G, Salt Lake City, UT; Harper H, Hackensack, NJ; Harrer G, Great Falls, MT; Hart L, Fort Myers, FL; Herbst R, Houston, TX; Hermann R, Marietta, GA; Hoffman P, Chicago, IL; Hoffman S, Altoona, PA; Iannotti N, Port St Lucie, FL; Jahan T, San Francisco, CA; Johnson B, Boston, MA; Kaywin P, Miami, FL; Khandelwal P, Odessa, TX; Kramer A, San Francisco, CA; Langer C, Philadelphia, PA; Lawrence D, Boston, MA; Lindquist D, Sedona, AZ; Link D, Littleton, CO; Lipton A, Hershey, PA; Loesch D, Greenfield, IN; Marsland T, Orange Park, FL; McCann J, Springfield, MA; McCroskey R, Puyallup, WA; McIntyre K, Dallas, TX; McMahon R, Englewood, CO; Mintzer D, Philadephia, PA; Myo T, Baltimore, MD; Oliff I, Skokie, IL; Olivares J, Garland, TX; Olsen M, Tulsa, OK; Orlowski R, Hickory, NC; O'Rourke M, Greenville, SC; Osborn D, Olympia, WA; Otero H, Seattle, WA; Otsuka A, Lakewood, CO; Papish S, Morristown, NJ; Patel T, Columbus, OH; Paulson R, Dallas, TX; Pluard T, St Charles, MO; Polikoff J, San Diego, CA; Rearden T, St Louis, MO; Ribeiro M, Decatur, GA; Richards D, Tyler, TX; Rivkin S, Seattle, WA; Robbins G, Hudson, FL; Robert N, Annandale, VA; Ross H, Portland, OR; Saidman B, Kingston, PA; Sandler A, Nashville, TN; Savin M, Dallas, TX; Schwartzberg L, Memphis, TN; Smith D, Oregon City, OR; Stone J, Jacksonville, FL; Strickland D, Memphis TN; Tai M, Albany, NY; Tezcan H, Coeur d'Alene, ID; Thachil J, Wichita Falls, TX; Townley P, Omaha, NE; Vivacqua R, Upland, PA; Wax M, Summit, NJ; Weisberg T, Scarborough, ME; Westberg M, Des Moines, IA; Wierman A, Las Vegas, NV; Wiesenfeld M, Cedar Rapids, IA; Wiznitzer I, Boca Raton, FL; Yates S, Gastonia, NC; Zielinski R, Williamsville, NY.

Supplemental Table 1. Oligonucleotides and Protocols for PCR and Sequencing EGFR oligonucleotides for PCR <5pEGFR.ex18.out> CAAATGAGCTGGCAAGTGCCGTGTC <3pEGFR.ex18.out> GAGTTTCCCAAACACTCAGTGAAAC <5pEGFR.ex19.out> GCAATATCAGCCTTAGGTGCGGCTC <3pEGFR.ex19.out> CATAGAAAGTGAACATTTAGGATGTG <5pEGFR.ex20.out> CCATGAGTACGTATTTTGAAACTC <3pEGFR.ex20.out> CATATCCCCATGGCAAACTCTTGC <5pEGFR.ex21.out> CTAACGTTCGCCAGCCATAAGTCC <3pEGFR.ex21.out> GCTGCGAGCTCACCCAGAATGTCTGG <5pEGFR.ex18.in.m13f> TGTAAAACGACGGCCAGTCAAGTGCCGTGTCCTGGCACCCAAGC <3pEGFR.ex18.in.m13r> CAGGAAACAGCTATGACCCCAAACACTCAGTGAAACAAAGAG <5pEGFR.ex19.in.m13f> TGTAAAACGACGGCCAGTCCTTAGGTGCGGCTCCACAGC <3pEGFR.ex19.in.m13r> CAGGAAACAGCTATGACCCATTTAGGATGTGGAGATGAGC <5pEGFR.ex20.in.m13f> TGTAAAACGACGGCCAGTGAAACTCAAGATCGCATTCATGC <3pEGFR.ex20.in.m13r> CAGGAAACAGCTATGACCGCAAACTCTTGCTATCCCAGGAG <5pEGFR.ex21.in.m13f> TGTAAAACGACGGCCAGTCAGCCATAAGTCCTCGACGTGG <3pEGFR.ex21.in.m13r> CAGGAAACAGCTATGACCCATCCTCCCCTGCATGTGTTAAAC KRAS oligonucleotides for PCR <5pKRAS-out> TACTGGTGGAGTATTTGATAGTG <3pKRAS-out> CTGTATCAAAGAATGGTCCTG <5pKRAS-in.m13f> TGTAAAACGACGGCCAGTTAGTGTATTAACCTTATGTG <3pKRAS-in.m13r> CAGGAAACAGCTATGACCACCTCTATTGTTGGATCATATTCG(continued on following page)Supplemental Table 1. Oligonucleotides and protocols for PCR and sequencing (continued) Sequencing Primers: <m13f> TGTAAAACGACGGCCAGT <m13r> CAGGAAACAGCTATGACC PCR and sequencing methods Formalin-fixed paraffin embedded tissue sections were deparaffinized and stained with H&E in preparation for laser capture microdissection of tumor cells (PixCell II, Arcturus). Tumor was collected from multiple sections in cases where there were fewer than ~500 tumor cells per section. DNA was extracted by incubating dissected tissue in 40 ml PicoPure Proteinase K extraction buffer (Arcturus, Mountainview, CA) for 48 hours at 65°C. The digest was heat inactivated at 95°C for 10 minutes and added directly to PCR reactions. Amplification of exons 18-21 of EGFR and exon 2 of KRAS was carried out using nested primers (primers are listed in Supplemental Table 1). One µl of digested DNA was added to a 50 µl reaction containing 0.5 µM of each primer, 0.2 µM of each dNTP, 1.5 mM MgCl2 and 1.5 U of a taq/pwo blend (Expand High Fidelity PCR system, Roche Molecular Biochemicals, Indianapolis, IN). PCR reactions were run in a PT200 MJ Thermocycler (MJ Research, Inc. Waltham, MA) using the following cycling conditions: an initial incubation at 94°C for 3 minutes, 35 cycles of 94°C for 30 seconds, 58°C for 30 seconds and 72°C for 1 minute, followed by a final extension at 72°C for 8 minutes. Second-step reactions with nested primers were cycled 30 times, otherwise using the same conditions. The presence of an appropriate PCR product was confirmed by resolving the PCR products on a 2% agarose gel. PCR products were purified using the QIAquick PCR Purification Kit (Qiagen, Valencia, CA) and sequenced using fluorescent dye-terminator chemistry (Applied Biosystems, Foster City CA). Sequencing reaction products were resolved using a 3700 sequencing instrument (Applied Biosystems, Foster City, CA). Mutations were identified by visual analysis of the sequence chromatograms using Sequencher (GeneCodes, MI).

Supplemental Table 2. Demographics of Patients With Tumors Sequenced Versus Patients With Tumors Not Sequenced Disease stage (IIIB or IV)20311.548920 Sequenced (n = 274)Unsequenced (n = 793) No.%No.% Gender Male1615948962 Age, years Median6463  Range24 to 8226 to 84 Smoking history Never2599011  Previous2037454569  Current461715820 Disease stage (IIIB or IV) IV2358665683 ECOG status (0 or 1) 11816651164 Median TTP, months5.44.8 Median survival, months11.510.2

NOTE: P values are shown only when P < .05. Abbreviations: ECOG, Eastern Cooperative Oncology Group; TTP, time to progression. Patients with missing values for a given clinical variable were excluded from any analysis involving that variable.


    Authors' Disclosures of Potential Conflicts of Interest
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Editor’s Note
 Appendix
 Authors' Disclosures of...
 REFERENCES
 
Although all authors have completed the disclosure declaration, the followig authors or their immediate family members have indicated a financial interest. No conflict exists for drugs or devices used in a study if they are not being evaluated as part of the investigation. For a detailed description of the disclosure categories, or for more information about ASCO’s conflict of interest policy, please refer to the Author Disclosure Declaration and the Disclosures of Potential Conflicts of Interest section in Information for Contributors.
Authors Employment Leadership Consultant Stock Honoraria Research Funds Testimony Other

David A. Eberhard Genentech Inc Genentech Inc (B)
Lukas C. Amler Genentech Inc Genentech Inc (B)
Audrey D. Goddard Genentech Inc Genentech Inc (B)
Sherry L. Heldens Genentech Inc Genentech Inc (B)
Roy S. Herbst Genentech Inc (A) Genentech Inc (C)
William L. Ince Genentech Inc (A)
Thomas Januario Genentech Inc Genentech Inc (A)
David H. Johnson Genentech Inc (A) Genentech Inc (A)
Pam Klein Genentech Inc
Vincent A. Miller AstraZeneca (A) AstraZeneca (A);Genentech Inc (A)
Michael A. Ostland Genentech Inc Genentech Inc (C)
David A. Ramies Genentech Inc
Dragan Sebisanovic Genentech Inc
Jeremy A. Stinson Genentech Inc Genentech Inc (B)
Yu R. Zhang Genentech Inc Genentech Inc (A)
Somasekar Seshagiri Genentech Inc Genentech Inc (B)
Kenneth J. Hillan Genentech Inc Genentech Inc (C) Genentech Inc (C)

Dollar Amount Codes (A) < $10,000 (B) $10,000-99,999 (C) ≥ $100,000 (N/R) Not Required



View larger version (32K):
[in this window]
[in a new window]
 
Supplemental Fig 1. Mutations in epidermal growth factor receptor (EGFR) and KRAS in patient samples. (A-D). Multiple sequence alignments for each EGFR exon where mutations were observed are shown. The amino acids corresponding to the wild-type sequence are shown on top, in the reference wild-type sequence. Point mutations are shown in red and in-frame deletions are shown as gaps in the alignment. (E) Multiple sequence alignments of mutations identified in KRAS. The wild-type protein sequence is shown on top of the alignment. Point mutations are shown in red below the wild-type sequence. (F) Schematic representations of the EGFR mutations in the EGFR kinase domain. The ligand binding, transmembrane (T), and tyrosine kinase domains are shown on the full-length receptor. An expanded view of the tyrosine kinase domain with the positions and identities of the mutations is presented.

 

View this table:
[in this window]
[in a new window]
 
Supplement Table 3. Details for Patients With EGFR- and/or KRAS-mutant tumors

 

    Acknowledgment
 
We thank the patients who participated in the TRIBUTE clinical trial, and their families, particularly those who consented to the use of their archival tumor material for research; Genentech's Oligonucleotide synthesis and DNA Sequencing groups; and Patti Tobin and Michelle Gossage for technical assistance.


    NOTES
 
This work was supported by Genentech Inc.

Presented in an oral presentation by P. Jänne at the 40th Annual Meeting of the American Society of Clinical Oncology, New Orleans, LA, June 7, 2004; and in a poster presentation at European Organization for Research and Treatment of Cancer National Cancer Institute–American Association for Cancer Research Conference on "Molecular Targets and Cancer Therapeutics," Geneva, Switzerland, September 30, 2004.

Drs Eberhard and Johnson contributed equally to the article.

Authors' disclosures of potential conflicts of interest are found at the end of this article.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Editor’s Note
 Appendix
 Authors' Disclosures of...
 REFERENCES
 
1. Parkin DM, Bray FI, Devasa SS: Cancer burden in the year 2000: The global picture. Eur J Cancer 37:S4-S66, 2001

2. Sanchez-Cespedes M, Ahrendt SA, Piantadosi S, et al: Chromosomal alterations in lung adenocarcinoma from smokers and nonsmokers. Cancer Res 61:1309-1313, 2001[Abstract/Free Full Text]

3. Ahrendt SA, Decker PA, Alawi EA, et al: Cigarette smoking is strongly associated with mutation of the K-ras gene in patients with primary adenocarcinoma of the lung. Cancer 92:1525-1530, 2001[CrossRef][Medline]

4. Grossi F, Loprevite M, Chiaramondia M, et al: Prognostic significance of K-ras, p53, bcl-2, PCNA, CD34 in radically resected non-small cell lung cancers. Eur J Cancer 39:1242-1250, 2003

5. Broermann P, Junker K, Brandt BH, et al: Trimodality treatment in stage III non small cell lung carcinoma: Prognostic impact of K-ras mutations after neoadjuvant therapy. Cancer 94:2055-2062, 2002[CrossRef][Medline]

6. Huncharek M, Muscat J, Geschwind JF: K-ras oncogene mutation as a prognostic marker in non-small cell lung cancer: A combined analysis of 881 cases. Carcinogen 20:1507-1510, 1999[Abstract/Free Full Text]

7. Nelson HH, Christiani DC, Mark EJ, et al: Implications and prognostic value of K-ras mutation for early-stage lung cancer in women. J Nat Can Inst 91:2032-2038, 1999

8. Rajagopalan H, Bardelli A, Lengauer C, et al: Tumorigenesis: RAF/RAS oncogenes and mismatch-repair status. Nature 418:934, 2002[CrossRef][Medline]

9. Keller SM, Vangel MG, Adak S, et al: The influence of gender on survival and tumor recurrence following adjuvant therapy of completely resected stages II and IIIa non-small cell lung cancer. Lung Cancer 37:303-309, 2002[CrossRef][Medline]

10. Schiller JH, Adak S, Feins RH, et al: Lack of prognostic significance of p53 and K-ras mutations in primary resected non-small-cell lung cancer on E4592: A laboratory ancillary study on an Eastern Cooperative Oncology Group prospective randomized trial of postoperative adjuvant therapy. J Clin Oncol 19:448-457, 2001[Abstract/Free Full Text]

11. Graziano SL, Gamble GP, Newman NB, et al: Prognostic significance of K-ras codon 12 mutations in patients with resected stage I and II non-small-cell lung cancer. J Clin Oncol 17:668-675, 1999[Abstract/Free Full Text]

12. Akita RW, Sliwkowski MX: Preclinical studies with erlotinib (Tarceva). Semin Oncol 30:15-24, 2003

13. Perez-Soler R, Chachoua A, Hammond LA, et al: Determinants of tumor response and survival with erlotinib in patients with non-small-cell lung cancer. J Clin Oncol 22:3238-3247, 2004[Abstract/Free Full Text]

14. Sandler A: Clinical experience with the HER1/EGFR tyrosine kinase inhibitor erlotinib. Oncology (Huntington) 17:17-22, 2003

15. Fukuoka M, Yano S, Giaccone G, et al: Multi-institutional randomized phase II trial of gefitinib for previously treated patients with advanced non-small-cell lung cancer. J Clin Oncol 21:2237-2246, 2003[Abstract/Free Full Text]

16. Miller VA, Kris MG, Shah N, et al: Bronchioloalveolar pathologic subtype and smoking history predict sensitivity to gefitinib in advanced non-small-cell lung cancer. J Clin Oncol 22, 2004

17. Giaccone G, Herbst RS, Manegold C, et al: Gefitinib in combination with gemcitabine and cisplatin in advanced non-small-cell lung cancer: A phase III trial - INTACT 1. J Clin Oncol 22:777-784, 2004[Abstract/Free Full Text]

18. Herbst RS, Giaccone G, Schiller JH, et al: Gefitinib in combination with paclitaxel and carboplatin in advanced non-small-cell lung cancer: A phase III trial-INTACT 2. J Clin Oncol 22:785-794, 2004[Abstract/Free Full Text]

19. Herbst RS, Prager D, Hermann R, et al: TRIBUTE: A phase III trial of erlotinib HCI (OSI-774) combined with carboplatin and paclitaxel (CP) chemotherapy in advanced non-small cell lung cancer (NSCLC). J Clin Oncol 22:617, 2004 (abstr 7011)

20. Baselga J: Combining the anti-EGFR agent gefitinib with chemotherapy in non-small-cell lung cancer: How do we go from INTACT to impact? J Clin Oncol 22:759-761, 2004[Free Full Text]

21. Lynch TJ, Bell DW, Sordella R, et al: Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. N Engl J Med 350:2129-2139, 2004[Abstract/Free Full Text]

22. Paez JG, Jänne PA, Lee JC, et al: EGFR mutations in lung cancer: Correlation with clinical response to gefitinib therapy. Science 304:1497-1500, 2004[Abstract/Free Full Text]

23. Pao W, Miller V, Zakowski M, et al: EGF receptor gene mutations are common in lung cancers from "never smokers" and are associated with sensitivity of tumors to gefitinib and erlotinib. Proc Natl Acad Sci U S A 101:13306-13311, 2004[Abstract/Free Full Text]

24. Johnson BE, Lucca J, Rabin MS, et al: Preliminary results from a phase II study of the epidermal growth factor receptor tyrosine kinase inhibitor erlotinib in patients >70 years of age with previously untreated advanced non-small cell lung carcinoma. J Clin Oncol 22:633, 2004 (abstr 7080)

25. Yarden Y, Sliwkowski MX: Untangling the ErbB signalling network. Nat Rev Mol Cell Biol 2:127-137, 2001[CrossRef][Medline]

26. Bianco R, Shin I, Ritter CA, et al: Loss of PTEN/MMAC1/TEP in EGF receptor-expressing tumor cells counteracts the antitumor action of EGFR tyrosine kinase inhibitors. Oncogene 22:2812-2822, 2003[CrossRef][Medline]

27. She Q-B, Solit Basso A, et al: Resistance to gefitinib in PTEN-null HER-overexpressing tumor cells can be overcome through restoration of PTEN function or pharmacologic modulation of constitutive phosphatidylinositol 3'-kinase/Akt pathway signaling. Clin Cancer Res 9:4340-4346, 2003[Abstract/Free Full Text]

28. Suzuki T, Nakagawa T, Endo H, et al: The sensitivity of lung cancer cell lines to the EGFR-selective tyrosine kinase inhibitor ZD1839 ('Iressa') is not related to the expression of EGFR or HER-2 or to K-ras gene status. Lung Cancer 42:35-41, 2003[CrossRef][Medline]

29. Sugio K, Ishida T, Yokoyama H, et al: Ras gene mutations as a prognostic marker in adenocarcinoma of the human lung without lymph node metastasis. Cancer Res 52:2903-2906, 1992[Abstract/Free Full Text]

29. Herbst RS, Prager D, Hermann R, et al: TRIBUTE: A phase III trial of erlotinib HCl (OSI-774) combined with carboplatin and paclitaxel chemotherapy in advanced non–small-cell lung cancer. J Clin Oncol 23: 10.1200/JCO.2005.02.840

30. Shepherd FA, Pereira J, Ciuleanu TE, et al: A randomized placebo-controlled trial of erlotinib in patients with advanced non-small cell lung cancer (NSCLC) following failure of 1st line or 2nd line chemotherapy. J Clin Oncol 22:18, 2004 (abstr 7022)

Submitted March 16, 2005; accepted March 23, 2005.


Related Editorial

  • Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors Plus Chemotherapy: Case Closed or Is the Jury Still Out?
    David R. Gandara and Paul H. Gumerlock
    JCO 2005 23: 5856-5858 [Full Text]


This article has been cited by other articles:


Home page
Ann OncolHome page
M. A. Pantaleo, M. Nannini, A. Maleddu, S. Fanti, C. Nanni, S. Boschi, F. Lodi, G. Nicoletti, L. Landuzzi, P. L. Lollini, et al.
Experimental results and related clinical implications of PET detection of epidermal growth factor receptor (EGFr) in cancer
Ann. Onc., October 7, 2008; (2008) mdn625v1.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
F. R. Hirsch, M. Varella-Garcia, R. Dziadziuszko, Y. Xiao, S. Gajapathy, M. Skokan, M. Lin, V. O'Neill, and P. A. Bunn Jr.
Fluorescence In situ Hybridization Subgroup Analysis of TRIBUTE, a Phase III Trial of Erlotinib Plus Carboplatin and Paclitaxel in Non-Small Cell Lung Cancer
Clin. Cancer Res., October 1, 2008; 14(19): 6317 - 6323.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
R. S. Herbst, J. V. Heymach, and S. M. Lippman
Lung Cancer
N. Engl. J. Med., September 25, 2008; 359(13): 1367 - 1380.
[Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
N. Personeni, S. Fieuws, H. Piessevaux, G. De Hertogh, J. De Schutter, B. Biesmans, W. De Roock, A. Capoen, M. Debiec-Rychter, J.-L. Van Laethem, et al.
Clinical Usefulness of EGFR Gene Copy Number as a Predictive Marker in Colorectal Cancer Patients Treated with Cetuximab: A Fluorescent In situ Hybridization Study
Clin. Cancer Res., September 15, 2008; 14(18): 5869 - 5876.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
C.-Q. Zhu, G. da Cunha Santos, K. Ding, A. Sakurada, J.-C. Cutz, N. Liu, T. Zhang, P. Marrano, M. Whitehead, J. A. Squire, et al.
Role of KRAS and EGFR As Biomarkers of Response to Erlotinib in National Cancer Institute of Canada Clinical Trials Group Study BR.21
J. Clin. Oncol., September 10, 2008; 26(26): 4268 - 4275.
[Abstract] [Full Text] [PDF]


Home page
The OncologistHome page
T. E. Stinchcombe and M. A. Socinski
Gefitinib in Advanced Non-Small Cell Lung Cancer: Does It Deserve a Second Chance?
Oncologist, September 1, 2008; 13(9): 933 - 944.