|
|||||
|
|
||||||
Originally published as JCO Early Release 10.1200/JCO.2005.00.562 on September 19 2005 © 2005 American Society of Clinical Oncology. High Telomerase RNA Expression Level Is an Adverse Prognostic Factor for Favorable-Histology Wilms' TumorFrom the Departments of Hematology/Oncology and Pathology, St Jude Children's Research Hospital, Memphis, TN; Department of Biostatistics, University of Washington, Seattle, WA; Department of Pediatrics, Roswell Park Cancer Institute, Buffalo, NY; and Department of Pathology, Children's Memorial Hospital, Chicago, IL Address reprint requests to Jeffrey S. Dome, MD, Department of Hematology/Oncology, St Jude Children's Research Hospital, 332 N Lauderdale St, D5048C, Memphis, TN 38105; e-mail: jeff.dome{at}stjude.org
PURPOSE: A primary objective of the fifth National Wilms Tumor Study (NWTS-5) was to identify prognostic indicators for patients with favorable-histology Wilms' tumor. The prognostic significance of telomerase expression level in primary tumor samples was assessed. PATIENTS AND METHODS: A case-cohort study was conducted involving 291 NWTS-5 registrants. Telomerase activity was measured using the telomeric repeat amplification protocol (TRAP). Expression levels of TERT mRNA (encoding the telomerase catalytic component) and TERC/hTR (the telomerase RNA template) were measured using quantitative real-time polymerase chain reaction. RESULTS: After excluding samples because of lack of viable tumor, RNA degradation, or insufficient clinical information, 244 patients remained for the final analysis (96 with relapse and 148 without relapse). Univariate analysis revealed a positive correlation between relative risk (RR) of relapse and levels of TERT mRNA and TERC expression. For each doubling in TERT mRNA and TERC level, the RR increased by a factor of 1.16 (95% CI, 1.04 to 1.29; P = .01) and 1.35 (95% CI, 1.11 to 1.64; P = .003), respectively. The one third of patients whose tumors had the highest TERC expression level had an RR of 2.06 (95% CI, 1.14 to 3.70; P = .02) compared with patients with the lowest level. TERC expression level remained a significant prognostic indicator in a multivariate analysis adjusting for TERT mRNA, tumor stage, and patient age. TRAP level did not correlate with RR of relapse. Telomerase expression levels were not predictive of overall survival. CONCLUSION: Telomerase RNA expression level may provide a clinically useful adjunct to the current risk classification schema for favorable-histology Wilms' tumor.
Modern treatment approaches for favorable-histology Wilms' tumor have yielded cure rates of approximately 90%.1 The current challenge for the cooperative groups is to limit therapy and its associated toxicities for patients at low risk of relapse while intensifying therapy and improving cure rates for patients at high risk of relapse.2 Towards this end, the primary aim of the fifth National Wilms Tumor Study (NWTS-5) was to evaluate novel biologic prognostic factors for Wilms' tumor. Telomerase is a specialized reverse transcriptase that adds nucleotide repeats to telomeres, counteracting the progressive loss of DNA that occurs during replication. The enzyme, which plays a key role in cellular immortalization, is minimally composed of a catalytic subunit (TERT) and an RNA subunit (TERC/hTR), which provides the template for nucleotide repeat generation.3-5 Because telomerase is expressed in approximately 85% to 95% of cancer specimens but absent in most normal tissue,6,7 it has been proposed as tumor marker and therapeutic target. Moreover, the presence of telomerase expression has emerged as a predictor of adverse outcome in a variety of adult and pediatric malignancies.8 In a pilot study of 78 Wilms' tumor samples of favorable histology, we demonstrated a positive correlation between expression level of TERT mRNA and risk of relapse.9 Univariate analysis of TERT mRNA level as a continuous variable suggested that each unit increase in TERT mRNA level increased the risk of relapse by a factor of 1.66 (95% CI, 1.2 to 2.3; P < .005). This study did not detect an association between levels of telomerase enzyme activity or TERC and patient outcome but was limited by its relatively small sample size. In the present study, we sought to further evaluate whether telomerase expression level provides an independent prognostic indicator for favorable-histology Wilms' tumor.
Patients A stratified sampling design was used to optimize our ability to compare biologic differences in primary tumor samples from patients with and without relapsed or progressive disease. Patients were selected from NWTS-5, which was a multi-institutional therapeutic and biology study of pediatric renal tumors that was open to accrual from August 1995 through May 2002. Participating institutions obtained local institutional review board approval to activate the study, and patients provided written informed consent to be treated on the study and to bank frozen tumor, serum, and urine for biologic studies. Additionally, the St Jude Children's Research Hospital institutional review board approved the laboratory component of this specific study. Patients were treated similarly according to stage, as previously described.10 A cohort of 1,013 patients with favorable-histology Wilms' tumor was defined from patients who were registered onto NWTS-5 before July 1, 1999 and had pretreatment tumor tissues available in the biologic specimens bank. Following the design of Prentice,11 an approximate 20% random sample, which was known as the subcohort, was selected from the identified cohort. All patients not already included who relapsed or had progressive disease before August 2001 were added to this group. A total of 291 patients (195 subcohort patients and 96 patients with relapse outside of the subcohort) were selected in this manner. Because the subcohort was randomly selected, it contained patients with tumor relapse or progression. A first event of metachronous Wilms' tumor in the contralateral kidney was not considered as a relapse for this study because the occurrence of metachronous Wilms' tumor was not thought to relate biologically to telomerase expression in the primary tumor. One subcohort patient who died of infection in the absence of disease was treated as censored at the time of this event.
Tissue Processing and Analysis
Molecular Assays of Telomerase Expression
Expression levels of TERC and TERT mRNA were determined by quantitative real-time reverse transcriptase PCR.14-16 Total RNA was isolated from approximately 25 mg of tissue using the Tri-Reagent protocol (Molecular Research Center, Cincinnati, OH). RNA was quantified by ultraviolet spectrophotometry, and 2 µg of RNA was used for each 50-µL reverse transcriptase reaction, which was run with pDN6 random primers and M-MLV reverse transcriptase (Invitrogen, Grand Island, NY). Two microliters of cDNA product were used for each 50-µL real-time PCR reaction. To detect TERT mRNA expression, we used previously reported primer-probe sets (forward: CGGAAGAGTGTCTGGAGCAA; reverse: GGATGAAGCGGAGTCTGGA; and probe: 6FAM-TTGCAAAGCATTGGAATCAGACAGCACT-TAMRA).16 To measure the For each sample, we assessed expression levels of the housekeeping genes glyceraldehyde phosphate dehydrogenase (GAPDH) and RNAse P using commercially available primer-probe sets (Applied Biosystems) and 36B4 using a primer-probe set that we optimized (forward: GGCGACCTGGAAGTCCAACT; reverse: CCATCAGCACCACAGCCTTC; and probe: VIC-ATCTGCTGCATCTGCTTGGAGCCCA-TAMRA). We found that levels of all three housekeeping genes were significantly lower in normal kidney samples compared with tumor samples, alerting us to the possibility that levels of the housekeeping genes varied according to tissue biology, thus defeating the purpose of such controls. Therefore, we used expression of GAPDH only to exclude samples with low RNA content; we did not incorporate GAPDH into the final calculations of TERC and TERT mRNA expression. The molecular assays were conducted in a blinded fashion; the assays were performed without knowledge of the patient characteristics, including outcome, corresponding to the tumor samples. To ensure the reproducibility of the measurements of telomerase activity, TERT mRNA, and TERC over time, approximately 10% of the samples were randomly selected for a repeat assay that was conducted several months from the original assays. All three assays were highly reproducible over time, with correlation coefficients (r) between values for the first and second assays greater than 0.9 (data not shown).
Statistical Analysis
Sample Selection Of the 291 patients selected for this study, 35 whose tumors contained less than 80% viable tumor on hematoxylin and eosin stain were excluded from the analysis. Nine patients with viable tumor were further excluded because of RNA degradation, as determined by low expression of the housekeeping gene GAPDH. Among the 247 patients remaining, of whom 164 had been sampled for the subcohort, 96 had tumor relapse or progression (henceforth referred to as relapse), 148 did not have relapse, and three had missing or incomplete outcome data. One subcohort patient who did experience relapse had ample tissue available to evaluate telomerase enzyme activity but not TERT mRNA or TERC expression. Hence, the final analysis of telomerase expression as a prognostic marker was conducted on 243 or 244 patients, depending on which variables were analyzed.
Telomerase Expression in Wilms' Tumor Versus Adjacent Normal Kidney
Given the biologic relationship between TERT mRNA, TERC, and TRAP activity, we expected that these three measurements would correlate with each other. As shown in Figure 1, there were indeed correlations between log2 (TERT mRNA) and TRAP activity, log2 (TERC) and TRAP activity, and log2 (TERT) and log2 (TERC), although the correlations were not strong.
Association Between Telomerase Expression and Risk of Relapse Table 2 lists the results from case-cohort analyses of the RR of relapse using a single regression variable. Among the demographic and biologic variables, tumor stage, log-transformed TERT level, and log-transformed TERC level were significant prognostic factors for tumor relapse. Treating TERT and TERC expression as continuous variables, each doubling of TERT mRNA and TERC level increased the RR of relapse by a factor of 1.16 (95% CI, 1.04 to 1.29; P = .01) and 1.35 (95% CI, 1.11 to 1.64; P = .003), respectively. TRAP activity level did not correlate with the risk of relapse.
To evaluate the risk of relapse in the tumors with the highest TERT mRNA or TERC expression, we further categorized log-transformed TERT mRNA and TERC levels into three approximately equal groups representing low, medium, and high expression levels. In this analysis, the RR associated with a high TERT mRNA level was 1.77 (95% CI, 0.96 to 3.23) compared with the low level (P = .07). The RR associated with a high TERC level was 2.06 (95% CI, 1.14 to 3.70) compared with the low level (P = .02; Table 2). Weighted estimates of the relapse-free survival curves by TERC tertile are shown in Figure 2. Patients with the highest TERC levels had double the relapse risk compared with patients with the lowest TERC levels (4-year relapse-free survival rate, 78.7% v 89.4%, respectively). Combining the variables of TERT mRNA and TERC expression did not enhance the association with risk of relapse beyond that observed with TERC expression alone. Levels of TERT mRNA and TERC expression were not predictive of overall survival, although the relatively small number of deaths precluded accurate assessment of the survival outcome.
We next evaluated telomerase expression level as a prognostic indicator in the context of other known prognostic factors. Patient age and tumor stage were not significantly associated with any measures of telomerase expression (data not shown). A case-cohort analysis of the separate effects of TERT mRNA level and TERC level after adjustment for age at diagnosis, tumor stage, and each other revealed that age, high stage, and TERC level all had statistically significant effects (Table 3). After adjustment for the other variables, each doubling of the TERC level increased the RR by a factor of 1.30 (95% CI, 1.06 to 1.60; P = .007).
Expression of TERT mRNA Alternative Splice Forms in Wilms' Tumor It was recently recognized that human cells generate multiple alternative splice forms of TERT mRNA. A total of seven alternative splicing sites (four insertions and three deletions) have been identified.20-24 Deletions , ß, and and insertions 1 and 2 are predicted to abrogate telomerase catalytic activity because they interfere with the reverse transcriptase domains (Fig 3A). Insertions 3 and 4 occur distal to the reverse transcriptase domains and are not predicted to alter the catalytic function of the protein (although this has not been tested formally). Alternative splicing of TERT mRNA is responsible for telomerase repression after week 15 during the development of the fetal kidney.22 Because Wilms' tumors arise from embryonal kidney, we surmised that alternative splicing of TERT mRNA may regulate telomerase activity in Wilms' tumor.
Using a primer set that encompasses the region of the and ß deletions (Fig 3A), we evaluated the TERT mRNA alternative splicing patterns in 30 Wilms' tumors. As demonstrated in Figure 3B, the +ß splice form, which is predicted to encode a catalytically inactive protein, was the predominant splice variant. The ratio of the full length/active +ß+ variant to the inactive +ß variant was variable from tumor to tumor.
The primer set that was used to assess the prognostic significance of TERT mRNA expression level was directed against a region of cDNA that amplifies all TERT mRNA splice forms, both active and inactive (Fig 3A). Therefore, we designed a real-time PCR primer-probe set to specifically measure levels of the active
This study demonstrated a positive correlation between risk of recurrence in patients with favorable-histology Wilms' tumor and tumor expression level of telomerase RNA (TERC and, to a lesser extent, TERT mRNA). The one third of patients with the highest TERC expression level had twice the risk of relapse compared with patients with the lowest TERC expression level. TERC expression level remained a significant predictor of relapse after adjustment for the known prognostic factors of patient age and tumor stage. These results indicate that measurement of TERC expression may be a useful adjunct to the current risk classification schema for favorable-histology Wilms' tumor. Our findings add to a growing body of evidence that suggest that high telomerase expression level is associated with unfavorable outcome in human cancer.8 In pediatric cancer, a detectable or high level of telomerase expression has been associated with unfavorable prognosis in neuroblastoma,25-28 hepatoblastoma,29 osteosarcoma,30 and acute myeloid leukemia.31 The biologic basis for this correlation is poorly understood. The simplest explanation is that tumors with low or absent telomerase expression are unable to maintain telomeres and, therefore, have limited proliferative potential.32 It is also possible that excess telomerase expression may mediate resistance to DNA-damaging agents because telomerase can act as a chromosome-healing enzyme.33-35 In support of this premise, studies of in vitro drug sensitivity have shown that cell lines become more sensitive to various classes of chemotherapy agents with the inhibition of telomerase.36-39 Finally, recent studies using mouse models have shown that the telomerase complex may promote tumorigenicity and metastatic potential in a manner independent of telomere lengthening.40,41 The optimal assay for telomerase expression has not been established and may vary according to tumor type. We assessed three measures of telomerase expression, each with distinct advantages and disadvantages. Telomerase enzyme activity, as assessed by the TRAP assay, is the most widely used measure for telomerase expression because it provides a functional readout of the protein and was the first telomerase assay to be developed. In contrast to the findings in other cancers, TRAP level was not predictive of relapse in our study of Wilms' tumor. A potential explanation for this lack of correlation is that TRAP activity is subject to inactivation with heat and time,13 which could be particularly problematic in a multi-institutional study, such as ours, in which the processing of tumor tissue was not uniform. Additionally, Wilms' tumor may differ from other tumors with regard to the extent of variation of telomerase activity level between tumors. Nearly all Wilms' tumors in our study had TRAP activity, whereas other cancers had a more dichotomous pattern of activity (either absent or present).26,28,30,42-45 When quantitative, rather than qualitative, measurement of activity is important, the TRAP assay may have limitations.
The second telomerase assay we undertook was quantitative reverse transcriptase PCR to measure expression level of TERT mRNA, which encodes the catalytic component of the telomerase enzyme complex. TERT mRNA expression level was more predictive of relapse than TRAP activity in a univariate analysis but was not predictive after adjustment for patient age and tumor stage, which corroborates the findings of our pilot study.9 A limitation of the TERT mRNA expression assay is that TERT mRNA undergoes alternative splicing, generating splice forms that encode inactive protein. We attempted to correct for this by exclusively amplifying the The third telomerase assay used in our study was quantitative PCR of TERC, the RNA template component of the telomerase enzyme complex. Interestingly, TERC expression was the best prognosticator of the three telomerase measures, which differs from the conclusions of our pilot study.9 This difference likely relates to the larger sample size and improved assays (ie, real-time quantitative PCR) in the current study. However, the CIs indicate that the differences observed between the two studies are within the bounds of expected statistical variation. Although TERC is constitutively expressed in both normal and malignant cells, TERC is known to be upregulated during the process of tumorigenesis.46-50 A high level of TERC expression has been linked to adverse outcome in neuroblastoma and breast cancer.27,51-53 Recent studies of individuals with the autosomal dominant form of dyskeratosis congenita have revealed that TERC haploinsufficiency results in impaired telomere length maintenance and clinical phenotype, indicating that the level of TERC expression is physiologically important.54,55 Likewise, in a mouse model system, haploinsufficiency of TERC was limiting for telomere maintenance.56 Although correlative, our findings suggest that level of TERC expression may be of biologic significance in human cancer and that measurement of TERC level deserves further consideration as a prognostic indicator. In summary, our findings indicate that high TERC expression level in primary favorable-histology Wilms' tumors is predictive of relapse, even after adjustment for patient age and tumor stage. These results suggest that measurement of TERC expression may provide a clinically useful adjunct to the current risk stratification schema for favorable-histology Wilms' tumor. Because this is the first study demonstrating a correlation between TERC level and relapse in Wilms' tumor, further validation of this molecular marker will be required before the results of this test can be used for treatment stratification.
The authors indicated no potential conflicts of interest.
We thank the staff of the National Wilms Tumor Study Group (NWTSG) Data and Statistical Center for their invaluable assistance and the members of the NWTSG for their helpful advice. We thank the many medical professionals who cared for the participants enrolled onto NWTS-5.
Supported by Grant Nos. RO1 CA87903, P30 CA21765, and U10 CA42326 from the National Institutes of Health (Bethesda, MD) and by the American Lebanese Syrian Associated Charities of St Jude Children's Research Hospital. Presented in part at the 40th Annual Meeting of the American Society of Clinical Oncology, New Orleans, LA, June 5-8, 2004. Authors' disclosures of potential conflicts of interest are found at the end of this article.
1. Jemal A, Tiwari RC, Murray T, et al: Cancer statistics, 2004. CA Cancer J Clin 54:8-29, 2004 2. Kalapurakal JA, Dome JS, Perlman EJ, et al: Management of Wilms' tumour: Current practice and future goals. Lancet Oncol 5:37-46, 2004[CrossRef][Medline] 3. Nakamura TM, Morin GB, Chapman KB, et al: Telomerase catalytic subunit homologs from fission yeast and human. Science 277:955-959, 1997 4. Feng J, Funk WD, Wang SS, et al: The RNA component of human telomerase. Science 269:1236-1241, 1995 5. Counter CM, Meyerson M, Eaton EN, et al: Telomerase activity is restored in human cells by ectopic expression of hTERT (hEST2), the catalytic subunit of telomerase. Oncogene 16:1217-1222, 1998[CrossRef][Medline] 6. Kim NW, Piatyszek MA, Prowse KR, et al: Specific association of human telomerase activity with immortal cells and cancer. Science 266:2011-2015, 1994 7. Shay JW, Bacchetti S: A survey of telomerase activity in human cancer. Eur J Cancer 33:787-791, 1997[CrossRef][Medline] 8. Hiyama E, Hiyama K: Clinical utility of telomerase in cancer. Oncogene 21:643-649, 2002[CrossRef][Medline] 9. Dome JS, Chung S, Bergemann T, et al: High telomerase reverse transcriptase (hTERT) messenger RNA level correlates with tumor recurrence in patients with favorable histology Wilms' tumor. Cancer Res 59:4301-4307, 1999 10. Grundy PE, Green DM, Coppes MJ, et al: Renal tumors, in Pizzo PA, Poplack DG (eds): Principles and Practice of Pediatric Oncology (ed 4). Philadelphia, PA, Lippincott Williams & Wilkins, 2002, pp 865-893 11. Prentice RL: A case-cohort design for epidemiologic cohort studies and disease prevention trials. Biometrika 73:1-11, 1986 12. Kim NW, Wu F: Advances in quantification and characterization of telomerase activity by the telomeric repeat amplification protocol (TRAP). Nucleic Acids Res 25:2595-2597, 1997 13. Piatyszek MA, Kim NW, Weinrich SL, et al: Detection of telomerase activity in human cells and tumors by a telomeric repeat amplification protocol (TRAP). Methods Cell Sci 17:1-15, 1995[Medline] 14. Heid CA, Stevens J, Livak KJ, et al: Real time quantitative PCR. Genome Res 6:986-994, 1996 15. Gibson UEM, Heid CA, Williams PM: A novel method for real time quantitative RT-PCR. Genome Res 6:995-1001, 1996 16. Bieche I, Nogues C, Paradis V, et al: Quantitation of hTERT gene expression in sporadic breast tumors with a real-time reverse transcription-polymerase chain reaction assay. Clin Cancer Res 6:452-459, 2000 17. Cox DR: Regression models and life tables. J R Stat Soc B 34:187-220, 1972 18. Lin DY, Ying Z: Cox regression with incomplete covariate measurements. J Am Stat Assoc 88:1341-1349, 1993[CrossRef] 19. Kaplan EL, Meier P: Nonparametric estimation from incomplete observations. J Am Stat Assoc 53:457-481, 1958[CrossRef] 20. Meyerson M, Counter CM, Eaton EN, et al: HEST2, the putative human telomerase catalytic subunit gene, is up-regulated in tumor cells and during immortalization. Cell 90:785-795, 1997[CrossRef][Medline] 21. Kilian A, Bowtell DDL, Abud H, et al: Isolation of a candidate human telomerase catalytic subunit gene, which reveals complex splicing patterns in different cell types. Hum Mol Genet 6:2011-2019, 1997 22. Ulaner GA, Hu JF, Vu TH, et al: Telomerase activity in human development is regulated by human telomerase reverse transcriptase (hTERT) transcription and by alternate splicing of hTERT transcripts. Cancer Res 58:4168-4172, 1998 23. Wick M, Zubov D, Hagen G: Genomic organization and promoter characterization of the gene encoding the human telomerase reverse transcriptase (hTERT). Gene 232:97-106, 1999[CrossRef][Medline] 24. Hisatomi H, Ohyashiki K, Ohyashiki JH, et al: Expression profile of a gamma-deletion variant of the human telomerase reverse transcriptase gene. Neoplasia 5:193-197, 2003[Medline] 25. Hiyama E, Hiyama K, Yokoyama T, et al: Correlating telomerase activity levels with human neuroblastoma outcomes. Nat Med 1:249-255, 1995[CrossRef][Medline] 26. Poremba C, Scheel C, Hero B, et al: Telomerase activity and telomerase subunits gene expression patterns in neuroblastoma: A molecular and immunohistochemical study establishing prognostic tools for fresh-frozen and paraffin-embedded tissues. J Clin Oncol 18:2582-2592, 2000 27. Choi LM, Kim NW, Zuo JJ, et al: Telomerase activity by TRAP assay and telomerase RNA (hTR) expression are predictive of outcome in neuroblastoma. Med Pediatr Oncol 35:647-650, 2000[CrossRef][Medline] 28. Krams M, Hero B, Berthold F, et al: Full-length telomerase reverse transcriptase messenger RNA is an independent prognostic factor in neuroblastoma. Am J Pathol 162:1019-1026, 2003 29. Hiyama E, Yamaoka H, Matsunaga T, et al: High expression of telomerase is an independent prognostic indicator of poor outcome in hepatoblastoma. Br J Cancer 91:972-979, 2004[Medline] 30. Sanders RP, Drissi R, Billups CA, et al: Telomerase expression predicts unfavorable outcome in osteosarcoma. J Clin Oncol 22:3790-3797, 2004 31. Verstovsek S, Manshouri T, Smith FO, et al: Telomerase activity is prognostic in pediatric patients with acute myeloid leukemia. Cancer 97:2212-2217, 2003[CrossRef][Medline] 32. Hamad NM, Banik SS, Counter CM: Mutational analysis defines a minimum level of telomerase activity required for tumourigenic growth of human cells. Oncogene 21:7121-7125, 2002[CrossRef][Medline] 33. Wang H, Blackburn EH: De novo telomere addition by Tetrahymena telomerase in vitro. EMBO J 16:866-879, 1997[CrossRef][Medline] 34. Bednenko J, Melek M, Greene EC, et al: Developmentally regulated initiation of DNA synthesis by telomerase: Evidence for factor-assisted de novo telomere formation. EMBO J 16:2507-2518, 1997[CrossRef][Medline] 35. Kramer KM, Haber JE: New telomeres in yeast are initiated with a highly selected subset of TG1-3 repeats. Genes Dev 7:2345-2356, 1993 36. Kondo Y, Kondo S, Tanaka Y, et al: Inhibition of telomerase increases the susceptibility of human malignant glioblastoma cells to cisplatin-induced apoptosis. Oncogene 16:2243-2248, 1998[CrossRef][Medline] 37. Ludwig A, Saretzki G, Holm PS, et al: Ribozyme cleavage of telomerase mRNA sensitizes breast epithelial cells to inhibitors of topoisomerase. Cancer Res 61:3053-3061, 2001 38. Yuan Z, Mei HD: Inhibition of telomerase activity with hTERT antisense increases the effect of CDDP-induced apoptosis in myeloid leukemia. Hematol J 3:201-205, 2002[CrossRef][Medline] 39. Misawa M, Tauchi T, Sashida G, et al: Inhibition of human telomerase enhances the effect of chemotherapeutic agents in lung cancer cells. Int J Oncol 21:1087-1092, 2002[Medline] 40. Stewart SA, Hahn WC, O'Connor BF, et al: Telomerase contributes to tumorigenesis by a telomere length-independent mechanism. Proc Natl Acad Sci U S A 99:12606-12611, 2002 41. Chang S, Khoo CM, Naylor ML, et al: Telomere-based crisis: Functional differences between telomerase activation and ALT in tumor progression. Genes Dev 17:88-100, 2003 42. Hiyama E, Yokoyama T, Tatsumoto N, et al: Telomerase activity in gastric cancer. Cancer Res 55:3258-3262, 1995 43. Langford LA, Piatyszek MA, Xu R, et al: Telomerase activity in ordinary meningiomas predicts poor outcome. Hum Pathol 28:416-420, 1997[CrossRef][Medline] 44. Marchetti A, Bertacca G, Buttitta F, et al: Telomerase activity as a prognostic indicator in stage 1 non-small cell lung cancer. Clin Cancer Res 5:2077-2081, 1999 45. Wang L, Soria JC, Kemp BL, et al: HTERT expression is a prognostic factor of survival in patients with stage I non-small cell lung cancer. Clin Cancer Res 8:2883-2889, 2002 46. Blasco MA, Rizen M, Greider CW, et al: Differential regulation of telomerase activity and telomerase RNA during multi-stage tumorigenesis. Nat Genet 12:200-204, 1996[CrossRef][Medline] 47. Soder AI, Hoare SF, Muir S, et al: Amplification, increased dosage and in situ expression of the telomerase RNA gene in human cancer. Oncogene 14:1013-1021, 1997[CrossRef][Medline] 48. Yi X, Tesmer VM, Savre-Train I, et al: Both transcriptional and posttranscriptional mechanisms regulate human telomerase template RNA levels. Mol Cell Biol 19:3989-3997, 1999 49. Yashima K, Maitra A, Timmons CF, et al: Expression of the RNA component of telomerase in Wilms tumor and nephrogenic rest recapitulates renal embryogenesis. Hum Pathol 29:536-542, 1998[CrossRef][Medline] 50. Guilleret I, Yan P, Guillou L, et al: The human telomerase RNA gene (hTERC) is regulated during carcinogenesis but is not dependent on DNA methylation. Carcinogenesis 23:2025-2030, 2002 51. Maitra A, Yashima K, Rathi A, et al: The RNA component of telomerase as a marker of biologic potential and clinical outcome in childhood neuroblastic tumors. Cancer 85:741-749, 1999[CrossRef][Medline] 52. Poremba C, Shroyer KR, Frost M, et al: Telomerase is a highly sensitive and specific molecular marker in fine-needle aspirates of breast lesions. J Clin Oncol 17:2020-2026, 1999 53. Poremba C, Heine B, Diallo R, et al: Telomerase as a prognostic marker in breast cancer: High-throughput tissue microarray analysis of hTERT and hTR. J Pathol 198:181-189, 2002[CrossRef][Medline] 54. Vulliamy T, Marrone A, Goldman F, et al: The RNA component of telomerase is mutated in autosomal dominant dyskeratosis congenita. Nature 413:432-435, 2001[CrossRef][Medline] 55. Hathcock KS, Hemann MT, Opperman KK, et al: Haploinsufficiency of mTR results in defects in telomere elongation. Proc Natl Acad Sci U S A 99:3591-3596, 2002 56. Chiang YJ, Hemann MT, Hathcock KS, et al: Expression of telomerase RNA template, but not telomerase reverse transcriptase, is limiting for telomere length maintenance in vivo. Mol Cell Biol 24:7024-7031, 2004 Submitted August 24, 2004; accepted February 22, 2005.
Related Editorial
This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|||||||||||
|
Copyright © 2005 by the American Society of Clinical Oncology, Online ISSN: 1527-7755. Print ISSN: 0732-183X
|