Journal of Clinical Oncology, Vol 23, No 4 (February 1), 2005: pp. 857-865
© 2005 American Society of Clinical Oncology.
DOI: 10.1200/JCO.2005.08.043
EGFR Mutations in NonSmall-Cell Lung Cancer: Analysis of a Large Series of Cases and Development of a Rapid and Sensitive Method for Diagnostic Screening With Potential Implications on Pharmacologic Treatment
Antonio Marchetti,
Carla Martella,
Lara Felicioni,
Fabio Barassi,
Simona Salvatore,
Antonio Chella,
Pier P. Camplese,
Teodorico Iarussi,
Felice Mucilli,
Andrea Mezzetti,
Franco Cuccurullo,
Rocco Sacco,
Fiamma Buttitta
From the Clinical Research Center, Center of Excellence on Aging, University-Foundation, and the Department of Surgery, University of Chieti, Chieti; Department of Surgery, University of Pisa, Pisa, Italy
Address correspondence to Antonio Marchetti, MD, Pathology Unit, Clinical Research Center, Center of Excellence on Aging (CeSI), University-Foundation, Via Colle DellAra, 66013 Chieti, Italy; e-mail: amarchetti{at}unich.it
 |
ABSTRACT
|
|---|
PURPOSE: It has been reported that EGFR mutations in lung carcinomas make the disease more responsive to treatment with tyrosine kinase inhibitors. We decided to evaluate the prevalence of EGFR mutations in a large series of nonsmall-cell lung carcinomas (NSCLCs) and to develop a rapid and sensitive screening method.
PATIENTS AND METHODS: We examined 860 consecutive NSCLC patients for EGFR mutations in exons 18, 19, and 21 using a dual technical approachdirect sequencing of polymerase chain reaction (PCR) products and PCR single-strand conformation polymorphism (SSCP) analysis. Moreover, all lung adenocarcinomas were analyzed for K-ras mutations at codon 12 by allele-specific oligoprobe hybriditations.
RESULTS: There were no EGFR mutations in 454 squamous carcinomas and 31 large cell carcinomas investigated. Thirty-nine mutations were found in the series of 375 adenocarcinomas (10%). Mutations were present in 26% of 86 bronchioloalveolar carcinomas (BACs) and in 6% of 289 conventional lung adenocarcinomas; P = .000002. EGFR mutations and K-ras mutations were mutually exclusive. A multivariable analysis revealed that BAC histotype, being a never smoker, and female sex were independently associated with EGFR mutations (odds ratios: 4.542, 3.632, and 2.895, respectively). The SSCP analysis was accurate and sensitive, allowing identification of mutations that were undetectable (21% of cases) by direct sequencing.
CONCLUSION: Mutations in the EGFR tyrosine kinase domain define a new molecular type of lung carcinoma, more frequent in particular subsets of patients. The SSCP assay is a rapid and reliable method for the detection of EGFR kinase domain mutations in lung cancer.
 |
INTRODUCTION
|
|---|
The epidermal growth factor receptor (EGFR) is a transmembrane glycoprotein with an extracellular ligand-binding domain and an intracellular domain possessing intrinsic tyrosine kinase (TK) activity.1 After ligand binding, receptor dimerization leads to both activation of the TK domain and recruitment and phosphorylation of intracellular substrates, which drive normal cell growth and differentiation.2,3 Many molecular events may lead to a persistent activation of the kinase activity, which consequently triggers a broader spectrum of downstream signal transduction pathways, including K-ras activation.4-7 Thus, EGFR is believed to play a critical role in neoplastic progression.8,9 Several studies reported genomic alterations of EGFR in glioblastomas in the context of the extracellular or intracellular domain.10,11 The most common of these mutant EGF receptors, EGFRvIII, is one in which amino acids 6 to 273 of the extracellular domain are deleted. This specific mutation has been shown to promote aggressive growth of tumors in vivo. The loss of part of the extracellular domain results in a receptor that has constitutive TK activity.12 The EGFR was found to be overexpressed in several types of tumors, including lung carcinomas.13 In particular, in different series of nonsmall-cell lung carcinomas (NSCLCs), an overexpression of the EGFR, ranging from 43% to 89%, has been reported.14-18
The inhibition of EGFR by specific blocking agents induces apoptosis and reduces proliferation of tumor growth in different experimental models19; thus, EGFR inhibitors represent new promising targeted antineoplastic drugs.20 Among them, small-molecule inhibitors of EGFR TK activity have emerged, including gefitinib (Iressa, ZD1839; AstraZeneca Inc, London, United Kingdom). This synthetic anilinoquinazoline compound, approved in Japan and the United States for relapsing patients with advanced NSCLC, acts selectively by competitive inhibition of the binding of adenosine triphosphate to the TK domain of the receptor, resulting in inhibition of the EGFR signaling pathway.21 In randomized phase II trials, response rates of 9% to 19% were reported with the use of gefitinib therapy in NSCLC patients.22 However, several data indicate that neither expression level nor constitutive phosphorylation of EGFR predict sensitivity to Iressa.23 Therefore, unlike the situation for other targeted therapies, the gefinitib therapy has been given to patients with advanced NSCLC, regardless of the status of EGFR signaling. Recent data, reported simultaneously by two research groups, have shown that the presence of mutations within the EGFR gene can distinguish responders from nonresponders.24,25 In particular, Lynch et al24 found heterozygous mutations within the TK domain of EGFR in eight of nine tumors obtained from patients who had responded to gefitinib. On the contrary, no mutations were documented in seven nonresponders. Paez et al25 found that five of five tumors from gefitinib-responsive patients harbored EGFR kinase domain mutations, while tumors from patients who progressed on gefitinib were not affected by mutations. In both studies, conducted by mutational analysis of the entire EGFR coding sequence, only genetic alterations in exons 19, 21, and 18 were found. The main goal of this study was to evaluate the actual prevalence of EGFR mutations in lung cancer and to develop a sensitive method for rapid screening of mutations. We have investigated a large series of consecutive NSCLC patients for EGFR mutations in exons 18, 19, and 21 by a dual technical approach: direct sequencing of polymerase chain reaction (PCR) products and PCR single-strand conformation (SSC) polymorphism (SSCP) analysis. In addition, we have examined the relationship between EGFR mutations and several clinicopathological parameters, including mutations in the K-ras gene, a downstream component of the EGFR activation cascade.26
 |
PATIENTS AND METHODS
|
|---|
Patients and Tissues
The tumors for this study were obtained from 860 consecutive NSCLC patients surgically treated at the Department of Surgery, University of Pisa (Pisa, Italy), and at the Department of Surgery, University of Chieti (Chieti, Italy), between July 1998 and December 2002. Informed consent was obtained from all patients enrolled. In each case, tumor and macroscopically normal lung tissue samples (taken as far as possible from the neoplastic area) were snap-frozen in liquid nitrogen within 10 minutes of excision and stored at 80°C. Immediately adjacent pieces of tumor and normal tissue were fixed and processed for light microscopy. In all tumor specimens, the amount of tumor cells equaled or exceeded 80% of the overall sample, confirmed by histopathologic examination. Similarly, all the macroscopically normal samples were judged to be benign.
The study population consisted of 748 men (87%) and 112 women (13%), with a mean age of 62.7 years (range, 32 to 85 years; Table 1). Patient stage at the time of diagnosis was determined according the TNM staging system27: 490 patients (57%) were classified at stage I; 121 (14%), at stage II; and 249 (29%), at stage III. Histological type was determined according to WHO criteria28: 454 tumors were squamous cell carcinomas (53%), 289 were adenocarcinomas (34%), 86 were bronchioloalveolar carcinomas (10%), and 31 were large-cell carcinomas (4%). Histocytological subtyping of bronchioloalveolar carcinomas (BACs), according to Barkley and Green,29 revealed that 69 (80%) were nonmucinous BAC, and 17 (20%) were mucinous BAC. According to smoking history, deduced from anamnestic data, 467 patients (55%) were smokers, 278 (32%) were former smokers (stopped smoking at least 1 year before the diagnosis of lung cancer), and 115 (13%) were nonsmokers. The possibility of lung metastasis from occult gastrointestinal malignancies was ruled out by clinical examinations, including abdominal computed tomography scans.
EGFR Gene Analysis
Genomic DNA was extracted from tumors and normal lung tissues according to standard procedures. Genetic analysis of the EGFR gene was performed by PCR amplification of exons 18, 19, and 21 with flanking intronic sequences and direct sequencing of the PCR products. The following primers, specifically designed for this study, were used for PCR amplification: exon 18 (forward, 5'-AGGGCTGAGGTGACCCTTGT-3'; reverse, 5'-TCCCCACCAGACCATGAGAG-3'), exon 19 (forward, 5'-ACCATCTCACAATTGCCAGTTAAC-3'; reverse, 5'-GAGGTTCAGAGCCATGGACC-3'), exon 21 (forward, 5'-TCACAGCAGGGTCTTCTCTGTTT-3'; reverse, 5'-ATGCTGGCTGACCTAAAGCC-3'). TK exons were amplified in a 384-well format PCR setup. PCR was performed in a total volume of 10 µL, containing 1x TaqMan buffer, 1.5 mmol/L MgCl2, 800 µmol/L dNTPs, 300 nmol/L each primer, 0.3 units Taq DNA polymerase, and 10 ng genomic DNA. Thermal cycling conditions included 4 minutes at 95°C, followed by 35 cycles of 95°C for 30 seconds, 60°C for 30 seconds, 72 degrees for 1 minute, and one cycle of 72°C for 7 minutes. The PCR products were then purified by Multiscreen 384-PCR filter plate (Millipore Corp, Bedford, CA) and subjected to bidirectional dye-terminator sequencing using the same primers used for amplification. Sequencing fragments were detected by capillary electrophoresis using the ABI Prism 3100 DNA analyzer (Applied Biosystems, Foster City, CA). In all cases, samples harboring mutations were reamplified and resequenced using the same experimental conditions. Sequence chromatograms were analyzed by Mutation Surveyor 2.2 (SoftGenetics, State College, PA), followed by manual review.
A nonradioactive SSCP assay was devised to screen for mutations in exons 18, 19, and 21, as previously described,30 with the following modifications. After completion of the PCR reaction (performed as reported above, in a volume of 30 µL), the product was diluted 1:5 in loading buffer (95% formamide, 2 mmol/L EDTA, pH 8.3). Fifteen µL of the diluted samples were denatured (5' at 90°C), immediately cooled on ice, and loaded onto a nondenaturing polyacrylamide gel. The concentration of acrilamide was 10% for the screening of exon 19, and 12% for the screening of exons 18 and 21. Tumor samples were loaded side by side with the corresponding normal lung control tissue. Electrophoresis was carried out for 14 hours at 20°C at 3W. On complete migration, the gels were subjected to silver staining using the PlusOne Silver Staining Kit (Amersham Pharmacia Biotech, Piscataway, NJ). Positive cases were reamplified in the same experimental conditions, and subjected again to SSCP to confirm the mutations. The shifted bands were removed from the gel, and the recovered DNA was amplified in duplicate and subjected to direct sequencing as reported earlier.
K-ras Gene Analysis
The following primers were used to amplify the K-ras gene around codon 12: 5'GGCCTGCTGAAAATGACTGA3' and 5'TGATTCTGAATTAGCTGTAT3'. The PCR reaction was programmed as follows: initial denaturation, 4 minutes at 94°C; amplification, 30 seconds at 94°C, 30 seconds at 54°C, and 1 minute at 72°C for 35 cycles; elongation, 10 minutes at 72°C.
The amplified products of the PCR reaction were denatured and blotted onto nylon membranes pre-wetted with 10x SSC (1x SSC is 150 mmol/L NaCl, 15 mmol/L Na citrate at pH 7.6). Each membrane was then hybridized separately with 32P-labeled mutation specific oligodeoxynucleotide probes.31 The hybridization was performed for at least 1 hour at 56°C in a specific solution (3M tetramethylammonium chloride, 50 mmol/L Tris-HCl, 5 mmol/L EDTA, 1% sodium dodecyl sulfate, and 1% milk protein). The membranes were then washed at 63°C in 5x sodium chloride-sodium phosphate-EDTA (SSPE) (1x SSPE is 180 mmol/L NaCL, 8 mmol/L NH2P04, 1 mmol/L EDTA) and 0.1% sodium dodecyl sulfate for 20 minutes, and subsequently rinsed in 2x SSC at room temperature. The filters were exposed to Kodak XAR 5 (Eastman Kodak, Rochester, NY) films for 1 day at 70°C.
Statistical Analysis
The variables measured in the study were investigated for association by using the Fishers exact test or 2 test as appropriate. The associations of EGFR mutational status, as a dependent variable, with histologic type (BAC v conventional lung adenocarcinoma [CLA]), sex (male v female), and smoking history (smoker or former smoker v nonsmoker) were also investigated by logistic regression analysis to account for the effect of the different variables. A P value less than .05 was considered significant.
 |
RESULTS
|
|---|
EGFR Mutations
The genomic status of the TK domain of the EGFR gene was evaluated in a series of 860 primary NSCLCs. Exons 18, 19 and 21, which were known to contain all the EGFR mutations identified in lung cancer patients, were subjected to mutational analysis. We decided to use two screening procedures: PCR amplification and direct sequencing of the PCR products; and PCR amplification followed by SSCP analysis and sequencing of the shifted bands. There were no EGFR mutations in 454 squamous carcinomas and 31 large-cell carcinomas investigated. A total of 39 mutations were found in the series of 375 patients affected by lung adenocarcinomas (10%). All the mutations identified were not present in the DNA of normal lung tissue from the same patients. Eighteen mutations (46%) were located in exon 19; 18 (46%) in exon 21; and three (8%) in exon 18.
Direct sequencing of PCR products allowed detection of eterozygous mutations in 31 adenocarcinomas (8%): 18 (58%) in exon 19; 11 (36%) in exon 21; and two (6%) in exon 18. SSCP analysis confirmed all the results obtained by sequencing, moreover it allowed identification of additional eight mutations: seven in exon 21 and one in exon 18. No false-positive or false-negative results were obtained using the SSCP assay. The mutations identified only by the SSCP screening were all point mutations. SSCP-positive cases were repeated in order to confirm the data and were subjected to amplification in replicate and direct sequencing of the shifted bands.
Of the 39 mutations identified, 18 (46%) were in frame deletions in exon 19, and 21 (54%) were aminoacidic substitutions in exons 21 and 18 (Table 2). The deletions "L747_T751del" and "L747_P753del" were associated with the insertion of a serine residue, resulting from a novel codon at the deletion breakpoint, whereas the deletion "L746_T751del" was associated with an alanine residue. Deletions "E746_T751del (ins ala [insertion of alanine residue])" and "L747_E749del" have never been described before. Interestingly all the deletions overlapped and shared the deletion of two amino acids, arginine and glutamic acid at codons 748 and 749. Among the amino acid substitutions, the leucin to arginin mutation (L858R) was found in 17 (44%) of the 39 tumors, representing the main hot spot mutation in the EGFR gene. We report a new amino acidic substitution at codon 858, L858M (Fig 1G). This rare mutation confirms the crucial role of codon 858 in lung cancerogenesis. Three missense mutations were found at codon 719, resulting in the substitution of cysteine for glicine.

View larger version (47K):
[in this window]
[in a new window]
|
Fig 1. Single-strand conformation polymorphism and correspondent sequence analysis of mutations found in the EGFR gene. (A to D) Cases with the more frequent deletions observed in exon 19; (E) point mutation 2573 T > G (L858R); (F) point mutation 2155 G > T (G719C); (G) point mutation 2572 C > A (L858M). T, tumor sample; N, healthy lung sample.
|
|
All the mutations gave distinct and characteristic SSCP patterns, allowing a fast and accurate detection of the type of mutation by direct SSCP analysis. In particular, six SSCP patterns, corresponding to the hot spot mutations observed, were identified (Figs 1A to F). During mutational screening, we identified a new silent polymorphism at codon 836 (CGC>CGT), in 12 (1.4%) of the 860 patients examined.
Correlations of EGFR Mutations With Clinicopathologic Data
Among adenocarcinomas, the distribution of EGFR gene mutations was significantly different between BACs and CLAs. They were present in 22 (26%) of 86 BACs and in 17 (6%) of 289 CLAs; P = .000002 (Table 3). All 22 mutations detected in BAC were seen in the nonmucinous subtype; P = .005 (Table 4).
The frequency of nonsmokers in the series of patients with tumors having EGFR mutations was significantly higher than that observed in the series of patients affected by tumors without mutations, (P = .000006; Table 3). Among the 39 tumors with mutations, 23 (59%) were from nonsmokers, and 16 (41%) were from smokers or former smokers.
EGFR mutations were more frequent in women (21 of 71; 30%) than in men (18 of 304; 6%); P = .0000002. However, among the 39 tumors with mutations, 18 (46%) were from men, and 21 (54%) were from women (Table 3). This apparent similar distribution of EGFR mutations in men and women is ascribable to the greater number of men in our series of patients.
In this series of tumors, the BAC and CLA histotypes were also investigated for K-ras mutations at codon 12 by the allele-specific olygonucleotide assay. All of the tumors affected by EGFR were found to be negative for K-ras mutations, whereas tumors negative for EGFR mutations showed a K-ras mutation in 32% of cases (P = .000001; Table 3). The prevalence of K-ras mutations was 29% in CLA and 27% in BAC. In the 108 tumors with mutated ras, the normal DNA sequence GGT (glycine) at codon 12 was altered to TGT (cysteine) in 57 cases (53%), to GTT (valine) in 38 cases (35%), and to GAT (aspartic acid) in 13 cases (12%). The frequency of K-ras mutations, as well as the distribution of the different types of mutations at codon 12, did not vary significantly between BAC and CLA (P = .7 and P = .5, respectively). Fourteen percent of nonmucinous BACs carried a K-ras point mutation at codon 12, while mucinous BACs showed K-ras mutations in 76% of cases (P = .00002; Table 4). The other clinocopathologic parameters, including age, tumor size, nodal status, and tumor stage were not significantly associated with EGFR mutations (Table 3).
The association of EGFR mutations, as a dependent variable, with tumor histotype, sex, and smoking history, was also evaluated by logistic regression analysis to take into consideration the reciprocal effects of the covariates investigated. As presented in Table 5, EGFR mutations were found to be independently associated with the BAC histotype, the absence of smoking history, and female sex (odds ratios: 4.542, 3.632, and 2.895, respectively).
View this table:
[in this window]
[in a new window]
|
Table 5. Association Between Mutations in the EGFR Gene and Independent Covariates Computed by Logistic Regression Analysis
|
|
 |
DISCUSSION
|
|---|
Two recent studies have reported that mutations in the EGFR gene in lung carcinomas make the disease more responsive to treatment with TK inhibitors.24,25 We have analyzed a large series of NSCLCs for mutations in the TK domain of the EGFR gene to assess the actual incidence of this genetic abnormality and its distribution according to histological type, sex, smoking history, TNM system parameters, and K-ras mutations.
The gene was not mutated in squamous cell carcinomas and large-cell carcinomas, whereas approximately 10% of adenocarcinomas showed the mutation. Among adenocarcinomas, the prevalence of EGFR mutations was significantly different in CLA and BAC. While in CLA, EGFR mutations were found in only 6% of cases, 26% of BAC tumors harbored EGFR mutations. Clinical reports indicate that patients who experienced a response to EGFR TK inhibitors often had a bronchioloalveolar histology.32-36 Studies with oral EGFR TK inhibitors (gefitinib, erlotinib), specifically on BAC, are ongoing. Preliminary results of the Southwest Oncology Group S0126 trial, evaluating gefitinib in BAC, indicate a response in previously untreated patients in 21% of cases.37 Preliminary results of an erlotinib trial in BAC indicate a response rate of 26%.38 Since these frequencies are very similar to the frequency of EGFR mutations observed in our series of BAC, we suggest that about one fourth of BACs may respond to EGFR TK inhibitors because of mutations affecting the gene.
Tumors with EGFR mutations were more often T1, but data were not significant. There were no differences in the propensity to metastasize (N status) and in the pathological stage between tumors with and without EGFR mutations.
In univariate analysis, EGFR mutations were significantly more frequent in women and in nonsmokers. These results are in keeping with those recently reported by Lynch et al,24 Paez et al,25 and Pao et al39 in smaller series of patients. In this regard, it is important to note that in clinical trials, a partial or complete clinical response to EGFR TK inhibitors has been observed more frequently in women and nonsmokers.35 In our study, when the histotype, sex, and smoking history were tested in a multivariable analysis against the presence of mutations in EGFR as dependent variable, the bronchioloalveolar histology, a history of never having smoked, and female sex, remained significant. Of these three variables, the most strongly related to the presence of EGFR mutations was BAC histotype, followed by smoking history. The highest fraction of EGFR mutations was observed in nonsmokers affected by BAC13 (57%) of 22 cases. These results are in agreement with recently published data indicating that BAC subtype and smoking history independently predict sensitivity to gefitinib in NSCLC patients.34,36
BACs are lung tumors believed to arise from bronchiolar and alveolar epithelium, with a characteristic growth pattern along the alveolar walls.40 Compared with other subtypes of NSCLC, BAC is characterized by distinct clinical presentation, radiographic appearance, and natural history.41 Patients with BAC tend to be younger at diagnosis and are more likely to be females and nonsmokers when compared with other NSCLC patients.41 These differences raise the question of whether BAC represents a separate biologic entity. We have previously shown that there are differences in the distribution and/or quality of p53, K-ras, and FHIT mutations between BAC and CLA.31,42,43 In keeping with these results, the present data suggest that BAC is a distinct biologic entity of lung carcinoma.
BACs are histologically classified into two major subsets: nonmucinous and mucinous.29 The mucinous type is characterized by tall columnar cells, similar to goblet cells, with abundant apical mucin-rich cytoplasm. In nonmucinous BAC, the neoplastic cells are cuboidal to columnar, and frequently show apical snouts and a hobnail appearance, resembling Clara cells. All the EGFR mutations found in BAC were seen in the nonmucinous type. Eighteen (35%) of 51 nonmucinous BACs had mutations in EGFR. Conversely, mucinous BAC, always negative for EGFR mutations, were frequently affected by codon 12 mutations of the K-ras gene. These observations suggest a mucinous and nonmucinous pathway of BAC carcinogenesis, characterized by specific genetic changes, in agreement with our previous observations.31,42 However, due to the limited number of mucinous BACs investigated, additional studies are required to confirm these data. EGFR mutations and K-ras mutations were found to be mutually exclusive in that none of the 39 tumors with EGFR mutations had a concomitant mutation in K-ras. This inverse relation can be explained considering that these two genes belong to the same signaling cascade. Since mutations of EGFR and K-ras genes seem to be related to the development of different BAC types, we speculate that they could have different effects on tumor morphology; alternatively, they could affect different cells (goblet cells, Clara cells) or cell precursors.
In our series of tumors, only 6% of CLA harbored EGFR mutations. However, since CLA was more frequent than BAC, 44% of the tumors with mutated EGFR were conventional adenocarcinomas. These data indicate that for an accurate detection of EGFR mutations in lung cancer, all patients affected by BAC and CLA must be subjected to mutational screening. A large-scale screening requires a rapid and sensitive technique. In the present study, we describe a reliable SSCP assay for the detection of mutations occurring in the EGFR TK domain. The SSCP analysis was found to be more sensitive than direct sequencing of PCR products, allowing identification of mutations that were hardly detectable or undetectable (21% of cases) by direct sequencing. Mutations missed by direct sequencing were all point mutations. These results are in accordance with previous data published by our group and others, indicating that PCR-SSCP can be more sensitive than direct sequencing. The PCR-SSCP technique is able to detect mutations in samples containing as little as 10% mutated DNA, whereas direct sequencing requires at least 30% of mutated DNA in the sample.44,45
In our series of cases, we found three new mutations (two new types of deletions and a new aminoacid substitution at codon 858) and confirmed the presence of several hot spot mutations. In particular, we found that the leucin to arginin substitution at codon 858 is the most frequent mutation (46% of cases). This point mutation, together with the deletion "E746_A750del" accounts for approximately 70% of the mutations affecting the TK domain of EGFR.
Six SSCP patterns, corresponding to the hot spot mutations observed, were identified. Using these patterns, more than 90% of the mutations in the EGFR gene can be immediately recognized by SSCP analysis. No false-positive or false-negative results were obtained using the SSCP assay. In addition, we have previously reported that the PCR-SSCP assay can be performed on formalin-fixed, paraffin-embedded small biopsies,46 allowing the detection of mutations from minimal amounts (< 1 µg) of starting DNA. We are confident that this method, followed by sequencing of the shifted bands, can be successfully used for rapid screening of patients with nonsquamous cell lung carcinomas.
In conclusion, mutations in the EGFR tyrosine kinase domain define a new molecular type of lung carcinoma, more frequent in the BAC histotype, in nonsmokers, and in females, independent from K-ras mutations, that is likely to respond to EGFR tyrosine kinase inhibitors. The SSCP assay described is a rapid and reliable method for the screening of EGFR kinase domain mutations in lung cancer patients.
 |
Authors Disclosures of Potential Conflicts of Interest
|
|---|
The authors indicated no potential conflicts of interest.
 |
NOTES
|
|---|
Supported in part by grants from Centro Nazionale RicercheMinistero dellUniversità e della Ricerca Scientifica e Tecnologica(CNR-MURST), Center of Excellence on Aging (CeSI), and Fondo per gli Investimenti della Ricerca di Base (FIRB).
Authors disclosures of potential conflicts of interest are found at the end of this article.
 |
REFERENCES
|
|---|
1. Cohen S: Purification of the receptor for epidermal growth factor from A-431 cells: Its function as a tyrosyl kinase. Methods Enzymol 99:379-387, 1983[Medline]
2. Jorissen RN, Walker F, Pouliot N, et al: Epidermal growth factor receptor: Mechanisms of activation and signalling. Exp Cell Res 284:31-53, 2003[CrossRef][Medline]
3. Wells A: Molecules in focus: EGF receptor. Int J Biochem Cell Biol 31:637-643, 1999[CrossRef][Medline]
4. Cohen P: The role of protein phosphorylation in human health and disease: The Sir Hans Krebs Medal Lecture. Eur J Biochem 268:5001-5010, 2001[Medline]
5. Huang HS, Nagane M, Klingbeil CK, et al: The enhanced tumorigenic activity of a mutant epidermal growth factor receptor common in human cancers is mediated by threshold levels of constitutive tyrosine phosphorylation and unattenuated signaling. J Biol Chem 272:2927-2935, 1997[Abstract/Free Full Text]
6. Antonyak MA, Moscatello DK, Wong AJ: Constitutive activation of c-Jun N-terminal kinase by a mutant epidermal growth factor receptor. J Biol Chem 273:2817-2822, 1998[Abstract/Free Full Text]
7. Blume-Jensen P, Hunter T: Oncogenic kinase signalling. Nature 411:355-365, 2001[CrossRef][Medline]
8. Roskoski R Jr: The ErbB/HER receptor protein-tyrosine kinases and cancer. Biochem Biophys Res Commun 319:1-11, 2004[CrossRef][Medline]
9. Ciardiello F, De Vita F, Orditura M, et al: The role of EGFR inhibitors in nonsmall cell lung cancer. Curr Opin Oncol 16:130-135, 2004[CrossRef][Medline]
10. Frederick L, Wang XY, Eley G, et al: Diversity and frequency of epidermal growth factor receptor mutations in human glioblastomas. Cancer Res 60:1383-1387, 2000[Abstract/Free Full Text]
11. Wong AJ, Ruppert JM, Bigner SH, et al: Structural alterations of the epidermal growth factor receptor gene in human gliomas. Proc Natl Acad Sci U S A 89:2965-2969, 1992[Abstract/Free Full Text]
12. Lorimer IA: Mutant epidermal growth factor receptors as targets for cancer therapy. Curr Cancer Drug Targets 2:91-102, 2002[CrossRef][Medline]
13. Levitzki A: EGF receptor as a therapeutic target. Lung Cancer 41:9-14, 2003[CrossRef]
14. Hirsch FR, Scagliotti GV, Langer CJ, et al: Epidermal growth factor family of receptors in preneoplasia and lung cancer: Perspectives for targeted therapies. Lung Cancer 41:29-42, 2003[Medline]
15. Brabender J, Danenberg KD, Metzger R, et al: Epidermal growth factor receptor and HER2-neu mRNA expression in non-small cell lung cancer Is correlated with survival. Clin Cancer Res 7:1850-1855, 2001[Abstract/Free Full Text]
16. Rusch V, Klimstra D, Venkatraman E, et al: Overexpression of the epidermal growth factor receptor and its ligand transforming growth factor alpha is frequent in resectable non-small cell lung cancer but does not predict tumor progression. Clin Cancer Res 3:515-522, 1997[Abstract]
17. Arteaga C: ErbB-targeted therapeutic approaches in human cancer. Exp Cell Res 284:122-130, 2003[CrossRef][Medline]
18. Rusch V, Baselga J, Cordon-Cardo C, et al: Differential expression of the epidermal growth factor receptor and its ligands in primary non-small cell lung cancers and adjacent benign lung. Cancer Res 53:2379-2385, 1993[Abstract/Free Full Text]
19. Ciardiello F, Tortora G: A novel approach in the treatment of cancer: Targeting the epidermal growth factor receptor. Clin Cancer Res 7:2958-2970, 2001[Abstract/Free Full Text]
20. Ritter CA, Arteaga CL: The epidermal growth factor receptor-tyrosine kinase: A promising therapeutic target in solid tumors. Semin Oncol 30:3-11, 2003[Medline]
21. Cohen MH, Williams GA, Sridhara R, et al: FDA drug approval summary: Gefitinib (ZD1839) (Iressa) tablets. Oncologist 8:303-306, 2003[Abstract/Free Full Text]
22. Green MR: Targeting targeted therapy. N Engl J Med 350:2191-2193, 2004[Free Full Text]
23. Cappuzzo F, Gregorc V, Rossi E, et al: Gefitinib in pretreated non-small-cell lung cancer (NSCLC): Analysis of efficacy and correlation with HER2 and epidermal growth factor receptor expression in locally advanced or metastatic NSCLC. J Clin Oncol 21:2658-2663, 2003[Abstract/Free Full Text]
24. Lynch TJ, Bell DW, Sordella R, et al: Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. N Engl J Med 350:2129-2139, 2004[Abstract/Free Full Text]
25. Paez JG, Janne PA, Lee JC, et al: EGFR mutations in lung cancer: Correlation with clinical response to gefitinib therapy. Science 304:1497-1500, 2004[Abstract/Free Full Text]
26. Smith MR, DeGudicibus SJ, Stacey DW: Requirement for c-ras proteins during viral oncogene transformation. Nature 320:540-543, 1986[CrossRef][Medline]
27. Sobin LH, Witteking CH: TNM Classification of Malignant Tumours (ed 6). New York, NY, John Wiley & Sons Inc, 2002
28. Travis WD, Colby TV, Corrin B, et al: Histologic Typing of Tumours of Lung and Pleura: World Health Organization International Classification of Tumors (ed 3). New York, NY, Springer Verlag, 1999
29. Barkley JE, Green MR: Bronchioloalveolar carcinoma. J Clin Oncol 14:2377-2386, 1996[Abstract]
30. Marchetti A, Buttitta F, Merlo G, et al: p53 alterations in non-small cell lung cancers correlate with metastatic involvement of hilar and mediastinal lymph nodes. Cancer Res 53:2846-2851, 1993[Abstract/Free Full Text]
31. Marchetti A, Buttitta F, Pellegrini S, et al: Bronchioloalveolar lung carcinomas: K-ras mutations are constant events in the mucinous subtype. J Pathol 179:254-259, 1996[CrossRef][Medline]
32. Yano S, Kanematsu T, Miki T, et al: A report of two bronchioloalveolar carcinoma cases which were rapidly improved by treatment with the epidermal growth factor receptor tyrosine kinase inhibitor ZD1839 ("Iressa"). Cancer Sci 94:453-458, 2003[CrossRef][Medline]
33. Takao M, Inoue K, Watanabe F, et al: Successful treatment of persistent bronchorrhea by gefitinib in a case with recurrent bronchioloalveolar carcinoma: A case report. World J Surg Oncol 1:8, 2003[CrossRef][Medline]
34. Miller VA, Kris MG, Shah N, et al: Bronchioloalveolar pathologic subtype and smoking history predict sensitivity to gefitinib in advanced non-small-cell lung cancer. J Clin Oncol 22:1103-1109, 2004[Abstract/Free Full Text]
35. Gandara DR, West H, Chansky K, et al: Bronchioloalveolar carcinoma: A model for investigating the biology of epidermal growth factor receptor inhibition. Clin Cancer Res 10:4205-4209, 2004
36. Evans TL: Highlights from the Tenth World Conference on Lung Cancer. Oncologist 9:232-238, 2004[Abstract/Free Full Text]
37. West H, Franklin WA, Gumerlock PH, et al: Gefitinib (ZD1839) therapy for advanced bronchioloalveolar lung cancer (BAC): Southwest Oncology Group (SWOG) Study S0126. Proc Am Soc Clin Oncol 22:14s, 2004 (abstr 7014)
38. Sandler A: Clinical experience with the HER1/EGFR tyrosine kinase inhibitor erlotinib. Oncology (Huntingt) 17:17-22, 2003
39. Pao W, Miller V, Zakowski M, et al: EGF receptor gene mutations are common in lung cancers from "never smokers" and are associated with sensitivity of tumors to gefitinib and erlotinib. Proc Natl Acad Sci U S A 101:13306-13311, 2004[Abstract/Free Full Text]
40. Clayton F: The spectrum and significance of bronchioloalveolar carcinomas. Pathol Annu 23:361-394, 1988
41. Breathnach OS, Ishibe N, Williams J, et al: Clinical features of patients with stage IIIB and IV bronchioloalveolar carcinoma of the lung. Cancer 86:1165-1173, 1999[CrossRef][Medline]
42. Marchetti A, Pellegrini S, Bertacca G, et al: FHIT and p53 gene abnormalities in bronchioloalveolar carcinomas: Correlations with clinicopathological data and K-ras mutations. J Pathol 184:240-246, 1998[CrossRef][Medline]
43. Marchetti A, Pellegrini S, Sozzi G, et al: Genetic analysis of lung tumours of non-smoking subjects: p53 gene mutations are constantly associated with loss of heterozygosity at the FHIT locus. Br J Cancer 78:73-78, 1998[Medline]
44. Bosari S, Marchetti A, Buttitta F, et al: Detection of p53 mutations by single-strand conformation polymorphisms (SSCP) gel electrophoresis: A comparative study of radioactive and nonradioactive silver-stained SSCP analysis. Diagn Mol Pathol 4:249-255, 1995[Medline]
45. Fan X, Furnari FB, Cavenee WK, et al: Non-isotopic silver-stained SSCP is more sensitive than automated direct sequencing for the detection of PTEN mutations in a mixture of DNA extracted from normal and tumor cells. Int J Oncol 18:1023-1026, 2001[Medline]
46. Marchetti A, Merlo G, Buttitta F, et al: Detection of DNA mutations in acid formalin-fixed paraffin-embedded archival tumor specimens by polymerase chain reaction-single strand conformation polymorphism analysis. Cancer Detect Prev 19:278-281, 1995[Medline]
Submitted August 5, 2004;
accepted November 2, 2004.

CiteULike Complore Connotea Del.icio.us Digg Facebook Reddit Technorati Twitter What's this?
This article has been cited by other articles:

|
 |

|
 |
 
P. Ceppi, M. Papotti, V. Monica, M. L. Iacono, S. Saviozzi, M. Pautasso, S. Novello, S. Mussino, E. Bracco, M. Volante, et al.
Effects of Src kinase inhibition induced by dasatinib in non-small cell lung cancer cell lines treated with cisplatin
Mol. Cancer Ther.,
November 1, 2009;
8(11):
3066 - 3074.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Rosell, T. Moran, C. Queralt, R. Porta, F. Cardenal, C. Camps, M. Majem, G. Lopez-Vivanco, D. Isla, M. Provencio, et al.
Screening for Epidermal Growth Factor Receptor Mutations in Lung Cancer
N. Engl. J. Med.,
September 3, 2009;
361(10):
958 - 967.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Rossi, G. Pelosi, P. Graziano, M. Barbareschi, and M. Papotti
Review Article: A Reevaluation of the Clinical Significance of Histological Subtyping of Non--Small-Cell Lung Carcinoma: Diagnostic Algorithms in the Era of Personalized Treatments
International Journal of Surgical Pathology,
June 1, 2009;
17(3):
206 - 218.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Yu, S. Kane, J. Wu, E. Benedettini, D. Li, C. Reeves, G. Innocenti, R. Wetzel, K. Crosby, A. Becker, et al.
Mutation-Specific Antibodies for the Detection of EGFR Mutations in Non-Small-Cell Lung Cancer
Clin. Cancer Res.,
May 1, 2009;
15(9):
3023 - 3028.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Sartori, A. Cavazza, A. Sgambato, A. Marchioni, F. Barbieri, L. Longo, M. Bavieri, B. Murer, E. Meschiari, S. Tamberi, et al.
EGFR and K-ras Mutations Along the Spectrum of Pulmonary Epithelial Tumors of the Lung and Elaboration of a Combined Clinicopathologic and Molecular Scoring System to Predict Clinical Responsiveness to EGFR Inhibitors
Am J Clin Pathol,
April 1, 2009;
131(4):
478 - 489.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Cappuzzo, A. Marchetti, M. Skokan, E. Rossi, S. Gajapathy, L. Felicioni, M. del Grammastro, M. G. Sciarrotta, F. Buttitta, M. Incarbone, et al.
Increased MET Gene Copy Number Negatively Affects Survival of Surgically Resected Non-Small-Cell Lung Cancer Patients
J. Clin. Oncol.,
April 1, 2009;
27(10):
1667 - 1674.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Liu, M. Li, X. Li, X. Meng, G. Yang, S. Zhao, Y. Yang, L. Ma, Z. Fu, and J. Yu
PET-Based Biodistribution and Radiation Dosimetry of Epidermal Growth Factor Receptor-Selective Tracer 11C-PD153035 in Humans
J. Nucl. Med.,
February 1, 2009;
50(2):
303 - 308.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-Y. Wu, C.-J. Yu, C.-H. Yang, S.-G. Wu, Y.-H. Chiu, C.-H. Gow, Y.-C. Chang, Y.-C. Hsu, P.-F. Wei, J.-Y. Shih, et al.
First- or Second-line Therapy with Gefitinib Produces Equal Survival in Non-Small Cell Lung Cancer
Am. J. Respir. Crit. Care Med.,
October 15, 2008;
178(8):
847 - 853.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Tatematsu, J. Shimizu, Y. Murakami, Y. Horio, S. Nakamura, T. Hida, T. Mitsudomi, and Y. Yatabe
Epidermal Growth Factor Receptor Mutations in Small Cell Lung Cancer
Clin. Cancer Res.,
October 1, 2008;
14(19):
6092 - 6096.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Fukui, Y. Ohe, K. Tsuta, K. Furuta, H. Sakamoto, T. Takano, H. Nokihara, N. Yamamoto, I. Sekine, H. Kunitoh, et al.
Prospective Study of the Accuracy of EGFR Mutational Analysis by High-Resolution Melting Analysis in Small Samples Obtained from Patients with Non-Small Cell Lung Cancer
Clin. Cancer Res.,
August 1, 2008;
14(15):
4751 - 4757.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-Y. Wu, S.-G. Wu, C.-H. Yang, C.-H. Gow, Y.-L. Chang, C.-J. Yu, J.-Y. Shih, and P.-C. Yang
Lung Cancer with Epidermal Growth Factor Receptor Exon 20 Mutations Is Associated with Poor Gefitinib Treatment Response
Clin. Cancer Res.,
August 1, 2008;
14(15):
4877 - 4882.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M.-J. Ahn, B.-B. Park, J. S. Ahn, S. W. Kim, H.-T. Kim, J. S. Lee, J. H. Kang, J. Y. Cho, H. S. Song, S. H. Park, et al.
Are There Any Ethnic Differences in Molecular Predictors of Erlotinib Efficacy in Advanced Non-Small Cell Lung Cancer?
Clin. Cancer Res.,
June 15, 2008;
14(12):
3860 - 3866.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Felip, F. Rojo, M. Reck, A. Heller, B. Klughammer, G. Sala, S. Cedres, S. Peralta, H. Maacke, D. Foernzler, et al.
A Phase II Pharmacodynamic Study of Erlotinib in Patients with Advanced Non-Small Cell Lung Cancer Previously Treated with Platinum-Based Chemotherapy
Clin. Cancer Res.,
June 15, 2008;
14(12):
3867 - 3874.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. S. Hodkinson, A. MacKinnon, and T. Sethi
Targeting Growth Factors in Lung Cancer
Chest,
May 1, 2008;
133(5):
1209 - 1216.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Yatabe, T. Takahashi, and T. Mitsudomi
Epidermal Growth Factor Receptor Gene Amplification Is Acquired in Association with Tumor Progression of EGFR-Mutated Lung Cancer
Cancer Res.,
April 1, 2008;
68(7):
2106 - 2111.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Pinter, J. Papay, A. Almasi, Z. Sapi, E. Szabo, M. Kanya, A. Tamasi, B. Jori, E. Varkondi, J. Moldvay, et al.
Epidermal Growth Factor Receptor (EGFR) High Gene Copy Number and Activating Mutations in Lung Adenocarcinomas Are Not Consistently Accompanied by Positivity for EGFR Protein by Standard Immunohistochemistry
J. Mol. Diagn.,
March 1, 2008;
10(2):
160 - 168.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Barbareschi, F. Buttitta, L. Felicioni, S. Cotrupi, F. Barassi, M. Del Grammastro, A. Ferro, P. Dalla Palma, E. Galligioni, and A. Marchetti
Different Prognostic Roles of Mutations in the Helical and Kinase Domains of the PIK3CA Gene in Breast Carcinomas
Clin. Cancer Res.,
October 15, 2007;
13(20):
6064 - 6069.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Wu, M. S. O'Reilly, R. R. Langley, R. Z. Tsan, C. H. Baker, N. Bekele, X. M. Tang, A. Onn, I. J. Fidler, and R. S. Herbst
Expression of epidermal growth factor (EGF)/transforming growth factor-{alpha} by human lung cancer cells determines their response to EGF receptor tyrosine kinase inhibition in the lungs of mice
Mol. Cancer Ther.,
October 1, 2007;
6(10):
2652 - 2663.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Takano, Y. Ohe, K. Tsuta, T. Fukui, H. Sakamoto, T. Yoshida, U. Tateishi, H. Nokihara, N. Yamamoto, I. Sekine, et al.
Epidermal Growth Factor Receptor Mutation Detection Using High-Resolution Melting Analysis Predicts Outcomes in Patients with Advanced Non Small Cell Lung Cancer Treated with Gefitinib
Clin. Cancer Res.,
September 15, 2007;
13(18):
5385 - 5390.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Pao and M. Ladanyi
Epidermal Growth Factor Receptor Mutation Testing in Lung Cancer: Searching for the Ideal Method
Clin. Cancer Res.,
September 1, 2007;
13(17):
4954 - 4955.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Hoshi, H. Takakura, Y. Mitani, K. Tatsumi, N. Momiyama, Y. Ichikawa, S. Togo, T. Miyagi, Y. Kawai, Y. Kogo, et al.
Rapid Detection of Epidermal Growth Factor Receptor Mutations in Lung Cancer by the SMart-Amplification Process
Clin. Cancer Res.,
September 1, 2007;
13(17):
4974 - 4983.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. E. Finberg, L. V. Sequist, V. A. Joshi, A. Muzikansky, J. M. Miller, M. Han, J. Beheshti, L. R. Chirieac, E. J. Mark, and A. J. Iafrate
Mucinous Differentiation Correlates with Absence of EGFR Mutation and Presence of KRAS Mutation in Lung Adenocarcinomas with Bronchioloalveolar Features
J. Mol. Diagn.,
July 1, 2007;
9(3):
320 - 326.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Wislez, M. Antoine, N. Rabbe, V. Gounant, V. Poulot, A. Lavole, J. Fleury-Feith, and J. Cadranel
Neutrophils Promote Aerogenous Spread of Lung Adenocarcinoma with Bronchioloalveolar Carcinoma Features
Clin. Cancer Res.,
June 15, 2007;
13(12):
3518 - 3527.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Horiike, H. Kimura, K. Nishio, F. Ohyanagi, Y. Satoh, S. Okumura, Y. Ishikawa, K. Nakagawa, T. Horai, and M. Nishio
Detection of Epidermal Growth Factor Receptor Mutation in Transbronchial Needle Aspirates of Non-Small Cell Lung Cancer
Chest,
June 1, 2007;
131(6):
1628 - 1634.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Zhang and A. Chang
Somatic mutations of the epidermal growth factor receptor and non-small-cell lung cancer
J. Med. Genet.,
March 1, 2007;
44(3):
166 - 172.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. V. Sequist, D. W. Bell, T. J. Lynch, and D. A. Haber
Molecular Predictors of Response to Epidermal Growth Factor Receptor Antagonists in Non-Small-Cell Lung Cancer
J. Clin. Oncol.,
February 10, 2007;
25(5):
587 - 595.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Toschi and F. Cappuzzo
Understanding the New Genetics of Responsiveness to Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors
Oncologist,
February 1, 2007;
12(2):
211 - 220.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. M. Chin, D. Anuar, R. Soo, M. Salto-Tellez, W. Q. Li, B. Ahmad, S. C. Lee, B. C. Goh, K. Kawakami, A. Segal, et al.
Detection of Epidermal Growth Factor Receptor Variations by Partially Denaturing HPLC
Clin. Chem.,
January 1, 2007;
53(1):
62 - 70.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. V. Sequist, V. A. Joshi, P. A. Janne, A. Muzikansky, P. Fidias, M. Meyerson, D. A. Haber, R. Kucherlapati, B. E. Johnson, and T. J. Lynch
Response to treatment and survival of patients with non-small cell lung cancer undergoing somatic EGFR mutation testing.
Oncologist,
January 1, 2007;
12(1):
90 - 98.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Rosell, M. Taron, N. Reguart, D. Isla, and T. Moran
Epidermal Growth Factor Receptor Activation: How Exon 19 and 21 Mutations Changed Our Understanding of the Pathway
Clin. Cancer Res.,
December 15, 2006;
12(24):
7222 - 7231.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. J. Riely, K. A. Politi, V. A. Miller, and W. Pao
Update on Epidermal Growth Factor Receptor Mutations in Non-Small Cell Lung Cancer
Clin. Cancer Res.,
December 15, 2006;
12(24):
7232 - 7241.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P Ceppi, M Volante, S Novello, I Rapa, K. Danenberg, P. Danenberg, A Cambieri, G Selvaggi, S Saviozzi, R Calogero, et al.
ERCC1 and RRM1 gene expressions but not EGFR are predictive of shorter survival in advanced non-small-cell lung cancer treated with cisplatin and gemcitabine
Ann. Onc.,
December 1, 2006;
17(12):
1818 - 1825.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Giaccone, M. Gallegos Ruiz, T. Le Chevalier, N. Thatcher, E. Smit, J. A. Rodriguez, P. Janne, D. Oulid-Aissa, and J.-C. Soria
Erlotinib for Frontline Treatment of Advanced Non-Small Cell Lung Cancer: a Phase II Study.
Clin. Cancer Res.,
October 15, 2006;
12(20):
6049 - 6055.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Matsukuma, M. Yoshihara, F. Kasai, A. Kato, A. Yoshida, M. Akaike, O. Kobayashi, H. Nakayama, Y. Sakuma, T. Yoshida, et al.
Rapid and Simple Detection of Hot Spot Point Mutations of Epidermal Growth Factor Receptor, BRAF, and NRAS in Cancers Using the Loop-Hybrid Mobility Shift Assay
J. Mol. Diagn.,
September 1, 2006;
8(4):
504 - 512.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. C. Shin, S. J. Lee, J. E. Choi, S. I. Cha, C. H. Kim, W. K. Lee, S. Kam, Y. M. Kang, T. H. Jung, and J. Y. Park
Glu346Lys Polymorphism in the Methyl-CpG Binding Domain 4 Gene and the Risk of Primary Lung Cancer
Jpn. J. Clin. Oncol.,
August 1, 2006;
36(8):
483 - 488.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W.-C. Chou, S.-F. Huang, K.-Y. Yeh, H.-M. Wang, M.-Y. Liu, J.-J. Hsieh, Y.-C. Cheung, and J. W.-C. Chang
Different Responses to Gefitinib in Lung Adenocarcinoma Coexpressing Mutant- and Wild-Type Epidermal Growth Factor Receptor Genes
Jpn. J. Clin. Oncol.,
August 1, 2006;
36(8):
523 - 526.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. K. Thomas, B. Weir, and M. Meyerson
Genomic approaches to lung cancer.
Clin. Cancer Res.,
July 15, 2006;
12(14):
4384s - 4391s.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. V. Sequist, V. A. Joshi, P. A. Janne, D. W. Bell, P. Fidias, N. I. Lindeman, D. N. Louis, J. C. Lee, E. J. Mark, J. Longtine, et al.
Epidermal growth factor receptor mutation testing in the care of lung cancer patients.
Clin. Cancer Res.,
July 15, 2006;
12(14):
4403s - 4408s.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. A. Janne and B. E. Johnson
Effect of epidermal growth factor receptor tyrosine kinase domain mutations on the outcome of patients with non-small cell lung cancer treated with epidermal growth factor receptor tyrosine kinase inhibitors.
Clin. Cancer Res.,
July 15, 2006;
12(14):
4416s - 4420s.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Yatabe, T. Hida, Y. Horio, T. Kosaka, T. Takahashi, and T. Mitsudomi
A Rapid, Sensitive Assay to Detect EGFR Mutation in Small Biopsy Specimens from Lung Cancer
J. Mol. Diagn.,
July 1, 2006;
8(3):
335 - 341.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Sonobe, T. Manabe, H. Wada, and F. Tanaka
Lung Adenocarcinoma Harboring Mutations in the ERBB2 Kinase Domain
J. Mol. Diagn.,
July 1, 2006;
8(3):
351 - 356.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Kimura, K. Kasahara, M. Kawaishi, H. Kunitoh, T. Tamura, B. Holloway, and K. Nishio
Detection of Epidermal Growth Factor Receptor Mutations in Serum as a Predictor of the Response to Gefitinib in Patients with Non-Small-Cell Lung Cancer.
Clin. Cancer Res.,
July 1, 2006;
12(13):
3915 - 3921.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Albini and U. Pfeffer
A new tumor suppressor gene: invasion, metastasis, and angiogenesis as potential key targets.
J Natl Cancer Inst,
June 21, 2006;
98(12):
800 - 801.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. J. Raz, B. He, R. Rosell, and D. M. Jablons
Current concepts in bronchioloalveolar carcinoma biology.
Clin. Cancer Res.,
June 15, 2006;
12(12):
3698 - 3704.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Politi, M. F. Zakowski, P.-D. Fan, E. A. Schonfeld, W. Pao, and H. E. Varmus
Lung adenocarcinomas induced in mice by mutant EGF receptors found in human lung cancers respond to a tyrosine kinase inhibitor or to down-regulation of the receptors
Genes & Dev.,
June 1, 2006;
20(11):
1496 - 1510.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Van Schaeybroeck, J. Kyula, D. M. Kelly, A. Karaiskou-McCaul, S. A. Stokesberry, E. Van Cutsem, D. B. Longley, and P. G. Johnston
Chemotherapy-induced epidermal growth factor receptor activation determines response to combined gefitinib/chemotherapy treatment in non-small cell lung cancer cells
Mol. Cancer Ther.,
May 1, 2006;
5(5):
1154 - 1165.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-W. Han, T.-Y. Kim, Y. K. Jeon, P. G. Hwang, S.-A. Im, K.-H. Lee, J. H. Kim, D.-W. Kim, D. S. Heo, N. K. Kim, et al.
Optimization of Patient Selection for Gefitinib in Non-Small Cell Lung Cancer by Combined Analysis of Epidermal Growth Factor Receptor Mutation, K-ras Mutation, and Akt Phosphorylation
Clin. Cancer Res.,
April 15, 2006;
12(8):
2538 - 2544.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Pham, M. G. Kris, G. J. Riely, I. S. Sarkaria, T. McDonough, S. Chuai, E. S. Venkatraman, V. A. Miller, M. Ladanyi, W. Pao, et al.
Use of Cigarette-Smoking History to Estimate the Likelihood of Mutations in Epidermal Growth Factor Receptor Gene Exons 19 and 21 in Lung Adenocarcinomas
J. Clin. Oncol.,
April 10, 2006;
24(11):
1700 - 1704.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Y. Jung, J. E. Choi, J. M. Park, M. H. Chae, H.-G. Kang, K. M. Kim, S. J. Lee, W. K. Lee, S. Kam, S. I. Cha, et al.
Polymorphisms in the hMSH2 Gene and the Risk of Primary Lung Cancer.
Cancer Epidemiol. Biomarkers Prev.,
April 1, 2006;
15(4):
762 - 768.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Haneda, H. Sasaki, N. Lindeman, O. Kawano, K. Endo, E. Suzuki, S. Shimizu, H. Yukiue, Y. Kobayashi, M. Yano, et al.
A Correlation between EGFR Gene Mutation Status and Bronchioloalveolar Carcinoma Features in Japanese Patients with Adenocarcinoma
Jpn. J. Clin. Oncol.,
February 1, 2006;
36(2):
69 - 75.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. A. Janne, A. M. Borras, Y. Kuang, A. M. Rogers, V. A. Joshi, H. Liyanage, N. Lindeman, J. C. Lee, B. Halmos, E. A. Maher, et al.
A Rapid and Sensitive Enzymatic Method for Epidermal Growth Factor Receptor Mutation Screening
Clin. Cancer Res.,
February 1, 2006;
12(3):
751 - 758.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. J. Riely, W. Pao, D. Pham, A. R. Li, N. Rizvi, E. S. Venkatraman, M. F. Zakowski, M. G. Kris, M. Ladanyi, and V. A. Miller
Clinical Course of Patients with Non-Small Cell Lung Cancer and Epidermal Growth Factor Receptor Exon 19 and Exon 21 Mutations Treated with Gefitinib or Erlotinib
Clin. Cancer Res.,
February 1, 2006;
12(3):
839 - 844.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. E.W. Cohen, M. W. Lingen, L. E. Martin, P. L. Harris, B. W. Brannigan, S. M. Haserlat, R. A. Okimoto, D. C. Sgroi, S. Dahiya, B. Muir, et al.
Response of Some Head and Neck Cancers to Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors May Be Linked to Mutation of ERBB2 rather than EGFR
Clin. Cancer Res.,
November 15, 2005;
11(22):
8105 - 8108.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-S. Jang, S. J. Lee, J. E. Choi, S. I. Cha, E. B. Lee, T. I. Park, C. H. Kim, W. K. Lee, S. Kam, J.-Y. Choi, et al.
Methyl-CpG Binding Domain 1 Gene Polymorphisms and Risk of Primary Lung Cancer
Cancer Epidemiol. Biomarkers Prev.,
November 1, 2005;
14(11):
2474 - 2480.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. W. Bell, T. J. Lynch, S. M. Haserlat, P. L. Harris, R. A. Okimoto, B. W. Brannigan, D. C. Sgroi, B. Muir, M. J. Riemenschneider, R. B. Iacona, et al.
Epidermal Growth Factor Receptor Mutations and Gene Amplification in Non-Small-Cell Lung Cancer: Molecular Analysis of the IDEAL/INTACT Gefitinib Trials
J. Clin. Oncol.,
November 1, 2005;
23(31):
8081 - 8092.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Schwab, F. Pinter, J. Moldavy, J. Papay, J. Strausz, L. Kopper, G. Keri, A. Pap, I. Petak, K. Oreskovich, et al.
Modern Treatment of Lung Cancer: CASE 1. Amplification and Mutation of the Epidermal Growth Factor Receptor in Metastatic Lung Cancer With Remission From Gefitinib
J. Clin. Oncol.,
October 20, 2005;
23(30):
7736 - 7738.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Takano, Y. Ohe, H. Sakamoto, K. Tsuta, Y. Matsuno, U. Tateishi, S. Yamamoto, H. Nokihara, N. Yamamoto, I. Sekine, et al.
Epidermal Growth Factor Receptor Gene Mutations and Increased Copy Numbers Predict Gefitinib Sensitivity in Patients With Recurrent Non-Small-Cell Lung Cancer
J. Clin. Oncol.,
October 1, 2005;
23(28):
6829 - 6837.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. E. Johnson and P. A. Janne
Selecting Patients for Epidermal Growth Factor Receptor Inhibitor Treatment: A FISH Story or a Tale of Mutations?
J. Clin. Oncol.,
October 1, 2005;
23(28):
6813 - 6816.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Tomizawa, H. Iijima, N. Sunaga, K. Sato, A. Takise, Y. Otani, S. Tanaka, T. Suga, R. Saito, T. Ishizuka, et al.
Clinicopathologic Significance of the Mutations of the Epidermal Growth Factor Receptor Gene in Patients with Non-Small Cell Lung Cancer
Clin. Cancer Res.,
October 1, 2005;
11(19):
6816 - 6822.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. E. Johnson and P. A. Janne
Epidermal Growth Factor Receptor Mutations in Patients with Non-Small Cell Lung Cancer
Cancer Res.,
September 1, 2005;
65(17):
7525 - 7529.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. P. Dicker and U. Rodeck
Predicting the Future From Trials of the Past: Epidermal Growth Factor Receptor Expression and Outcome of Fractionated Radiation Therapy Trials
J. Clin. Oncol.,
August 20, 2005;
23(24):
5437 - 5439.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Weber, K. Fukino, M. Villalona-Calero, and C. Eng
Limitations of Single-Strand Conformation Polymorphism Analysis As a High-Throughput Method for the Detection of EGFR Mutations in the Clinical Setting
J. Clin. Oncol.,
August 20, 2005;
23(24):
5847 - 5848.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Marchetti, F. Barassi, L. Felicioni, C. Martella, S. Salvatore, A. Mezzetti, F. Cuccurullo, F. Buttitta, A. Chella, P. P. Camplese, et al.
In Reply:
J. Clin. Oncol.,
August 20, 2005;
23(24):
5848 - 5849.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Taron, Y. Ichinose, R. Rosell, T. Mok, B. Massuti, L. Zamora, J. L. Mate, C. Manegold, M. Ono, C. Queralt, et al.
Activating Mutations in the Tyrosine Kinase Domain of the Epidermal Growth Factor Receptor Are Associated with Improved Survival in Gefitinib-Treated Chemorefractory Lung Adenocarcinomas
Clin. Cancer Res.,
August 15, 2005;
11(16):
5878 - 5885.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q. Pan, W. Pao, and M. Ladanyi
Rapid Polymerase Chain Reaction-Based Detection of Epidermal Growth Factor Receptor Gene Mutations in Lung Adenocarcinomas
J. Mol. Diagn.,
August 1, 2005;
7(3):
396 - 403.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. S. Tsao, A. Sakurada, J.-C. Cutz, C.-Q. Zhu, S. Kamel-Reid, J. Squire, I. Lorimer, T. Zhang, N. Liu, M. Daneshmand, et al.
Erlotinib in Lung Cancer -- Molecular and Clinical Predictors of Outcome
N. Engl. J. Med.,
July 14, 2005;
353(2):
133 - 144.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-Y. Shih, C.-H. Gow, and P.-C. Yang
EGFR Mutation Conferring Primary Resistance to Gefitinib in Non-Small-Cell Lung Cancer
N. Engl. J. Med.,
July 14, 2005;
353(2):
207 - 208.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. V. Scagliotti and on behalf of the Adjuvant Lung Cancer Project Ital
The ALPI Trial: The Italian/European Experience with Adjuvant Chemotherapy in Resectable Non-Small Lung Cancer
Clin. Cancer Res.,
July 1, 2005;
11(13):
5011s - 5016s.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R.K. THOMAS, H. GREULICH, Y. YUZA, J.C. LEE, T. TENGS, W. FENG, T.-H. CHEN, E. NICKERSON, J. SIMONS, M. EGHOLM, et al.
Detection of Oncogenic Mutations in the EGFR Gene in Lung Adenocarcinoma with Differential Sensitivity to EGFR Tyrosine Kinase Inhibitors
Cold Spring Harb Symp Quant Biol,
January 1, 2005;
70(0):
73 - 81.
[Abstract]
[PDF]
|
 |
|
|