Advertisement
Journal of Clinical Oncology  
Search for:
Limit by:
  Browse by Subject or Issue
Home Search or Browse JCO My JCO Subscriptions Customer Service Site Map

Journal of Clinical Oncology, Vol 24, No 10 (April 1), 2006: pp. 1529-1534
© 2006 American Society of Clinical Oncology.
DOI: 10.1200/JCO.2005.04.4693

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Argani, P.
Right arrow Articles by Ladanyi, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Argani, P.
Right arrow Articles by Ladanyi, M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Translocation Carcinomas of the Kidney After Chemotherapy in Childhood

Pedram Argani, Marick Laé, Edgar T. Ballard, Mahul Amin, Carlos Manivel, Brian Hutchinson, Victor E. Reuter, Marc Ladanyi

From the Departments of Pathology and Oncology, The Johns Hopkins Hospital, Baltimore, MD; Department of Pathology, Memorial Sloan-Kettering Cancer Center, New York, NY; Department of Pathology, Children's Hospital Medical Center, Cincinnati, OH; Department of Pathology, Emory University, Atlanta, GA; and Department of Pathology, University of Minnesota, Minneapolis, MN

Address reprint requests to Marc Ladanyi, MD, Memorial Sloan-Kettering Cancer Center, Department of Pathology, 1275 York Avenue, New York, NY 10021; e-mail: ladanyim{at}mskcc.org


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 REFERENCES
 
PURPOSE: Children who survive cancer are at more than 19-fold increased risk of developing another malignancy. Renal cell carcinoma (RCC) occurring as a secondary malignancy is uncommon. Translocation RCC, bearing TFE3 or TFEB gene fusions, are recently recognized entities for which risk factors have not been identified.

PATIENTS AND METHODS: We describe the clinical, pathologic, cytogenetic, and molecular data on six translocation RCCs that arose in five young patients who had received chemotherapy.

RESULTS: The ages at time of diagnosis of the RCC ranged from 6 to 22 years. Histologically, these tumors showed typical features previously described for translocation RCCs. At the molecular level, three tumors contained the ASPL-TFE3 fusion, two contained Alpha-TFEB, and one contained PRCC-TFE3. The intervals between chemotherapy and the diagnosis of RCC ranged from 4 to 13 years. The indications for the antecedent chemotherapy were varied and included acute promyelocytic leukemia, acute myeloid leukemia with t(9;11), bilateral Wilms' tumor, systemic lupus erythematosus, and conditioning regimen of bone marrow transplant for Hurler's syndrome. Only the latter patient had also received radiation. Hence, among 39 genetically confirmed translocation RCCs in our personal experience, six (15%) have arisen in patients who had received cytotoxic chemotherapy.

CONCLUSION: Cytotoxic chemotherapy may predispose to the development of renal translocation carcinomas.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 REFERENCES
 
Xp11 translocation renal carcinomas bearing fusions involving the TFE3 transcription factor gene are a recently recognized entity in the 2004 WHO renal tumor classification.1 These most commonly have ASPL-TFE3 or PRCC-TFE3 gene fusions, resulting from the translocations t(X;17)(p11;q25) and t(X;1)(p11;q21), respectively.2,3 These carcinomas predominantly affect young patients, and feature clear cells with solid to papillary architecture and frequent psammomatous calcifications.4 They typically show a peculiar underexpression of cytokeratins by immunohistochemistry (IHC). Their prognosis is not well defined at present.

Renal carcinomas with the t(6;11)(p21;q12) harbor a gene fusion between the Alpha gene and the TFEB transcription factor gene.5-8 Both TFEB and TFE3 are members of the MiTF/TFE family of transcription factors. Like the Xp11 translocation carcinomas, these tumors typically affect young patients, have clear cells with nested and occasionally papillary architecture, and also underexpress cytokeratins. These tumors consistently express the melanocytic differentiation markers HMB45 and Melan A.

Because of their similarities at the clinical, morphologic, immunohistochemical, and genetic levels, we have proposed that the t(6;11) renal carcinomas (Alpha-TFEB renal carcinomas) are related to the Xp11 translocation carcinomas, and should be grouped together under the category of MiTF/TFE renal translocation carcinomas.4

Both of these renal translocation carcinomas can be identified in archival material using IHC. This is because both chromosome translocations effectively result in promoter substitution, such that the fusion gene is overexpressed relative to the native TFE3 or TFEB gene. In normal cells and virtually all other neoplasms, these transcription factors in their native form are undetectable by IHC; however, in neoplasms harboring these specific chromosome translocations, the fusion gene products are detectable. Hence, nuclear labeling for TFE3 by IHC is specific for the Xp11 translocation carcinomas,9 whereas nuclear labeling for TFEB by IHC is specific for the t(6;11) renal carcinomas.6 This special feature of these neoplasms facilitates their identification in archival pathology material, as used in this study.

Risk factors for developing these renal translocation carcinomas are not known. After encountering several new renal translocation carcinomas recently that arose in the setting of prior chemotherapy, we reviewed our files and the literature to identify previously reported translocation carcinomas that arose after chemotherapy. We report the clinicopathologic and genetic features of six translocation renal carcinomas arising in patients treated previously with chemotherapy.


    PATIENTS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 REFERENCES
 
This study was approved by the institutional review board of The Johns Hopkins Hospital (Baltimore, MD).

For IHC labeling, detection of antibody binding was achieved using a biotinylated secondary antibody and horseradish peroxidase-conjugated streptavidin (Dako Corp, Carpinteria, CA) and 3',3'-diamino-benzidine as chromogen. The standard antibodies, vendors, pretreatments, and dilutions were used as described elsewhere.2,3 Confirmatory IHC for TFE3 (Xp11 translocation carcinomas) and/or TFEB (Alpha-TFEB translocation carcinomas) was performed in each case as previously described.6,9

Reverse transcriptase polymerase chain reaction (RT-PCR) for specific gene fusions involving TFE3 or TFEB was performed on five tumors with available frozen tissue. RNA extraction was performed from frozen tissue using standard commercial organic extraction reagents (Trizol; Gibco BRL, Friendsworth, TX). To assess the adequacy of the extracted RNA for analysis, RT-PCR was performed using primers spanning an intron of the ubiquitously expressed phosphoglycerate kinase (PGK) gene, resulting in amplification of a 247-bp fragment, as described in detail elsewhere.2,3

For the PRCC-TFE3 RT-PCR, multiple combinations of PRCC forward and TFE3 reverse primers (sequences provided in Argani et al3) were used because of the previously described variability in PRCC and TFE3 fusion points.3 To detect the presence of an ASPL-TFE3 fusion transcript, we performed RT-PCR using a forward primer from ASPL (AAAGAAGTCCAAGTCGGGCCA) and a TFE3 exon 4 reverse primer (CGTTTGATGTTGGGCAGCTCA), as previously described.2 For the Alpha-TFEB RT-PCR, two different Alpha forward primers were used in combination with the TFEB reverse primer because of the previously described variability in Alpha and TFEB fusion points (sequences provided in Argani et al6). PCR was performed in a final reaction volume of 80 µL containing 10 µL of RT product, 1x PCR buffer (Qiagen, Valencia, CA), 10 µmol/L each of sense and antisense primer, and 2.5 U of HotStar Taq DNA polymerase (Qiagen). PCR conditions were as previously described.6 The amplification products were analyzed by agarose gel electrophoresis and discrete RT-PCR products were then subjected to direct sequencing.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 REFERENCES
 
The clinical, pathologic, and molecular features of these patients are summarized in Table 1.


View this table:
[in this window]
[in a new window]
 
Table 1. Genetically Confirmed Translocation RCC Arising After Chemotherapy

 
New Patients in This Report
Patient 1. This patient was reported previously (although without detailed clinical history) as patient 5 among the eight patients included in our initial characterization of the ASPL-TFE3 renal carcinomas.2 We discovered subsequently that this patient had a history of systemic lupus erythematosus, and was treated since age 9 with cyclophosphamide 1,000 mg intravenously every 6 weeks and 20 mg of prednisone each day. He had presented at age 17 with a right flank mass, and underwent a right radical nephrectomy, which revealed an 8 cm, largely necrotic translocation renal cell carcinoma (RCC) with the type 1 ASPL-TFE3 fusion. The tumor extended through the renal capsule to involve the perinephric fat. Surgical margins were negative for tumor. The pathologic stage of this tumor was pT3NXMX. Of note, the surrounding non-neoplastic kidney revealed a diffuse proliferative glomerulonephritis consistent with the patient's history of active systemic lupus erythematosus. The patient received no additional therapy for his RCC, but continued to take cyclophosphamide and prednisone. He was clinically free of disease until 5 years later, when he was found to have a 5-cm mass within his now nonfunctional left kidney, associated with a 14-cm retroperitoneal mass. The patient underwent left radical nephrectomy along with excision of the retroperitoneal tumor. The working diagnosis was that this left kidney mass represented a recurrence of the prior right-sided RCC, given the locally advanced stage of that neoplasm.

Similar to the prior right-sided RCC, the left-sided RCC had extensive papillary architecture and clear cytoplasm with psammoma bodies. However, the two tumors had slightly different morphologies. The prior right-sided carcinoma had a less compact, more dyscohesive appearance, had more abundant cytoplasm, and more psammoma bodies. Taken together, these three features suggested that the left-sided recurrence had the morphologic features of a PRCC-TFE3 renal carcinoma, which differed from the right-sided ASPL-TFE3 renal carcinoma3,4 (Fig 1). The new left-sided RCC was associated with metastatic carcinoma in one of two left perinephric lymph nodes.


Figure 1
View larger version (136K):
[in this window]
[in a new window]
 
Fig 1. Metachronous ASPL-TFE3 RCC and PRCC-TFE3 RCC in patient 1 (tumors 1 and 2 in Table 1). (A) Hematoxylin and eosin, tumor 1 (ASPL-TFE3 positive); (B) hematoxylin and eosin, tumor 2 (PRCC-TFE3 positive).

 
The two carcinomas had similar IHC profiles. Both showed limited reactivity for epithelial markers, a characteristic feature of the Xp11.2 translocation carcinomas. Both were focally positive for broad-spectrum cytokeratin cocktails AE1/3 and Cam5.2. Both tumors were diffusely positive for CD10 and weakly positive for the RCC marker antigen; both are well-described markers of renal tubular epithelium. Both tumors showed diffuse nuclear labeling for TFE3 protein, a sensitive and specific marker of tumors harboring TFE3 gene fusions.9

The previous right-sided carcinoma had not been studied by conventional cytogenetics. The left-sided carcinoma was sent for cytogenetic analysis, which revealed a t(X;1)(p11;q21), which is known to give rise to the PRCC-TFE3 gene fusion. We then analyzed the left-sided carcinoma by RT-PCR for the PRCC-TFE3 gene fusion. A discrete RT-PCR product was identified, and direct sequencing confirmed an in-frame fusion of PRCC to TFE3 that was different from that of the control.

Given the unexpected finding of different gene fusions in these two neoplasms, we next tested each neoplasm by RT-PCR for the gene fusion identified in the contralateral tumor. This analysis revealed the right-sided ASPL-TFE3 renal carcinoma lacked evidence of the PRCC-TFE3 gene fusion, whereas the left-sided PRCC-TFE3 renal carcinoma lacked evidence of the ASPL-TFE3 gene fusion. Hence, these two neoplasms were clonally unrelated (Fig 2).


Figure 2
View larger version (15K):
[in this window]
[in a new window]
 
Fig 2. Reverse transcriptase polymerase chain reaction (RT-PCR) analysis of tumors 1 and 2 in patient 1. RT-PCR assay for ASPL-TFE3 is positive in tumor 1 and negative in tumor 2. RT-PCR assay for PRCC-TFE3 is positive in tumor 2 and negative in tumor 1. +, positive control; M, molecular weight marker.

 
Patient 2. This patient's clinical history was previously reported,10 but the pathology of the renal carcinoma was neither described in detail nor illustrated. The patient had presented at age 11 years with acute promyelocytic leukemia. The karyotype of the leukemia was 46,XY, 12p+, t(15;17)(q22;q11), which is typical of acute promyelocytic leukemia. He received two 2-week courses of dexamethasone, cytarabine 380 mg for 8 days, thioguanine 180 mg for 4 days, etoposide 180 mg for 8 days, daunorubicin 38 mg for 8 days, plus intrathecal cytarabine 70 mg for 4 days. He eventually developed chronic renal insufficiency believed to be due to drug toxicity. At age 16, the patient was found to have a 5-cm left renal mass, and underwent a nephrectomy. His tumor was described as a papillary RCC, and cytogenetic analysis showed a t(X;17)(p11;q25),t(1;2)(q23;q25), add (19)(q13.4), and monosomy 22. Two lymph nodes were reported to be involved by metastatic carcinoma. The patient showed no evidence of disease at 2 years follow-up, but died suddenly as a result of unknown causes at 2.5 years follow-up.

Because the tumor's karyotype contained a t(X;17)(p11;q25), as seen in patients with the ASPL-TFE3 fusion, we obtained histologic sections for review. Morphologically, the tumor demonstrated the classic features of the ASPL-TFE3 renal carcinomas; namely, the tumor cells had voluminous clear cytoplasm, well-defined cell borders, and a nested to pseudopapillary architecture. Psammoma bodies were abundant. IHC analysis revealed that the tumor cells were focally immunoreactive for cytokeratin AE1/3, and diffusely immunoreactive for CD10. Tumor cells demonstrated strong, specific nuclear labeling for TFE3, supporting the morphologic classification of the tumor as an Xp11 translocation carcinoma. Frozen tissue from this tumor was not available for molecular analysis (Fig 3).


Figure 3
View larger version (117K):
[in this window]
[in a new window]
 
Fig 3. ASPL-TFE3 renal carcinoma in a patient with prior acute promyelocytic leukemia (patient 2). (A) Hematoxylin and eosin; (B) TFE3 immunohistochemistry.

 
Patient 3. At 6 months of age, this girl with Hurler's syndrome underwent matched unrelated cord blood transplantation preceded by conditioning with high-dose cyclophosphamide (2 days), total-body irradiation (14 Gy, brain-sparing method with electron boost; seven fractions during 4 days), and antithymocyte globulin (four doses, twice daily on days 2 and 1 before transplantation). She was also given cyclosporine and methylprednisone post-transplantation for prophylaxis against graft-versus-host disease. On routine follow-up at age 6, a computed tomography scan of the abdomen revealed a left renal mass, believed clinically to be Wilms' tumor. Intraoperatively, the surgeon believed that the mass was well delineated and confined to the kidney. The contralateral kidney appeared normal, and there was no evidence of lymphadenopathy, liver lesions, or peritoneal involvement by tumor. At 3 months follow-up, there is no evidence of recurrent disease.

On gross examination, the tumor measured 5 cm in greatest dimension. It was well-circumscribed, and yellow-tan with septations, lobulation, and central cystification consistent with necrosis. Microscopically, the tumor was predominantly a papillary carcinoma composed of clear cells. A minor subpopulation of smaller cells clustered between the papillae and within larger acini, but rounded hyaline nodules were not well developed (Fig 4).


Figure 4
View larger version (107K):
[in this window]
[in a new window]
 
Fig 4. Alpha-TFEB renal carcinoma in a patient who had undergone bone marrow transplantation for Hurler's syndrome (patient 3). (A) Hematoxylin and eosin; (B) TFEB immunohistochemistry.

 
On IHC analysis, the tumor cells were diffusely and strongly immunoreactive for Melan A, immunoreactive for HMB45 in a patchy fashion, and focally immunoreactive for cytokeratin AE1/3. They showed diffuse, strong nuclear labeling for TFEB protein. Cytogenetics revealed a t(6;11)(p21;q12).

Patients Reported Previously
Patient 4. This patient was patient 4 in our initial report of the ASPL-TFE3 renal carcinomas.2,11 The patient was diagnosed with acute myeloid leukemia (AML-M5) bearing a t(9;11)(p22;q23) chromosome translocation (MLL-AF9 fusion), which was treated with etoposide, daunorubicin, thioguanine, and cytarabine. She was free of disease for 4 years, when she developed hematuria and was found to have a left renal mass. Nephrectomy revealed a 2.7-cm RCC with metastases to four perirenal lymph nodes. The tumor was composed of epithelioid cells with a nested to pseudopapillary architecture, with vesicular chromatin, prominent nucleoli, and voluminous clear cytoplasm. On IHC analysis, the tumor cells were only focally immunoreactive for epithelial markers, but showed strong nuclear labeling for TFE3 protein. Molecular analysis demonstrated the presence of a type 1 ASPL-TFE3 gene fusion, and re-evaluation of the karyotype suggested that it was best described as: 46,X,der(X)t(X;7)(p11;p11),del(1)(p34),add(1)(p34),+5,–6,add(7)(p11),del(16)(p11.2),add(17)(q24-25),add(20)(q13). Overall, this set of abnormal chromosomes could be explained by a complex nonreciprocal t(X;17)(p11;q25), with translocation of Xp11 to 17q25, but of 17q25 to another chromosome.

Patient 5. This patient was patient 6 in our recent series of t(6;11) renal carcinomas.6 This patient presented with bilateral Wilms' tumors in a background of nephroblastomatosis at age 2. Of note, one of this patient's Wilms' tumors demonstrated an unbalanced chromosome translocation, der(16)t(13;16)(q14;q24). Despite radical right nephrectomy and partial left nephrectomy, and multiple rounds of chemotherapy including cyclophosphamide, dactinomycin, vincristine, doxorubicin, etoposide, and carboplatin, the patient subsequently developed pulmonary metastases at age 7. At 9 years of age, the patient developed a 2.0-cm mass in her remaining left kidney, which was excised by partial nephrectomy. The tumor showed the typical morphology of a t(6;11) renal carcinoma, in that it was biphasic, with larger epithelioid cells and smaller cells associated with hyaline material. By IHC, the tumor cells demonstrated focal labeling for HMB45 and Melan A, and strong nuclear labeling for TFEB by IHC. Subsequent RT-PCR analysis confirmed the presence of an Alpha-TFEB gene fusion.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 REFERENCES
 
We report an association in children between a history of exposure to cytotoxic chemotherapy and the development of RCCs associated with specific chromosome translocations. These translocations result in gene fusions involving the related MiTF/TFE transcription factor genes, TFE3 and TFEB. Prompted by results from patient 1 of this series, who developed two genetically distinctive Xp11 translocation carcinomas in the setting of chronic exposure to cyclophosphamide, we searched our files for other molecularly or cytogenetically confirmed translocation RCCs that arose in children exposed to chemotherapy. This search yielded six patients (15%) of a total of 39 genetically confirmed patients known to us. Previous studies have demonstrated that children who are treated with chemotherapy and survive one malignancy are at increased risk of developing another cancer. The best characterized secondary malignancies are acute leukemias, soft tissue sarcomas, and malignant gliomas.12-14 Although we recognize the potential for bias inherent in consultation cases, our results suggest that MiTF-family renal translocation carcinomas should be added to this list.

RCCs developing after therapy have not been well studied in the literature. RCCs are known to arise in a background of Wilms' tumor15 (such as our patient 5), but the morphology of most reported cases has not been defined adequately. The best characterized secondary RCCs are those arising in long-term survivors of childhood neuroblastoma.16 These tumors are morphologically heterogeneous; a large proportion have a distinctive morphology characterized by extensive oncocytoid cytoplasm, solid to papillary architecture, and psammoma bodies, and these are recognized as a distinctive entity in the 2004 WHO renal tumor classification.17 Several of these RCCs have arisen in children who did not receive chemotherapy, suggesting that an underlying genetic predisposition (as opposed to the long-term effects of chemotherapy) may be at play. We have tested two oncocytoid renal carcinomas from patients who survived neuroblastomas (provided by L. J. Medeiros, MD), and found both to be nonreactive for TFE3 protein by IHC (P. Argani and M. Ladanyi, unpublished observations), suggesting that these two samples were unrelated to the translocation RCCs described in our series. However, other reported postneuroblastoma RCCs have had clear-cell or papillary morphology, instead of the classic oncocytoid appearance. It seems possible that some of these other RCCs are translocation carcinomas related to prior chemotherapy, as in the present series. This is supported by recent reports from Altinok et al18 and Fenton et al19 describing a child who had received chemotherapy for neuroblastoma and subsequently developed a papillary, nononcocytoid RCC, which was strongly immunoreactive for TFE3—a specific feature of Xp11 translocation carcinomas.

How cytotoxic chemotherapy predisposes patients to translocation carcinomas is not clear. Review of these patients' chemotherapeutic regimens reveals no one common agent or class of agent. However, all patients received either a DNA topoisomerase II inhibitor or cyclophosphamide (an alkylating agent). Both of these agents are known to break DNA and predispose to malignancy, albeit by different mechanisms. Topoisomerase II inhibitors, including epipodophyllotoxins (such as etoposide) and anthracyclines (such as doxorubicin and daunorubicin), inhibit DNA joining after topoisomerase II has catalyzed a transient double-stranded DNA cleavage. These chromosome breaks may then be resolved by balanced chromosome translocations, as is well described for the MLL gene on chromosome 11q23, leading to acute leukemias.20-23 Alkylating agents crosslink and depurinate DNA, and may result in leukemias (preceded by myelodysplasia) or urothelial carcinomas of the bladder.20

Our data raise the question of whether the highly homologous TFE3 and TFEB loci are specifically susceptible to damage by these drugs and subsequent rearrangement, much as the MLL gene appears to be predisposed to breakage and subsequent rearrangement by topoisomerase II inhibitors in hematopoietic cells. It would be of interest to know if there are topoisomerase II binding sites in the introns of the TFE3 or TFEB genes that are rearranged in these translocations. Of note, alveolar soft part sarcoma (ASPS) is characterized in all cases by the identical ASPL-TFE3 gene fusion as is seen in the t(X;17) renal carcinomas.24 Interestingly, a case of ASPS has been reported after radiation therapy, implicating DNA damage as a mechanism for the translocation in at least one patient.25 We have recently shown that the t(X;17) of ASPS occurs preferentially in the G2 phase of the cycle26; whether this is also the case for TFE3 rearrangements in translocation RCCs and how this might be affected by exposure to cytotoxic drugs remains unclear.

The apparent predilection of these tumors for children raises the possibility that the relatively increased proliferation that occurs in the growing pediatric kidney may render it more sensitive to the mutagenic effects of several chemotherapies. Along these lines, patients 1, 2, and 5 in our series developed their translocation RCC in the setting of significant renal insufficiency, which is associated with increased tubular proliferation in response to damage. Finally, we note that four of the five patients in this study developed two distinctive cancers characterized by different chromosome translocations.

In summary, we report an association between MiTF/TFE translocation renal carcinomas and exposure to prior cytotoxic chemotherapy. RCCs, specifically those with MiTF/TFE-family translocations, should be added to the list of possible chemotherapy-associated secondary malignancies in children.


    Authors' Disclosures of Potential Conflicts of Interest
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 REFERENCES
 
The authors indicated no potential conflicts of interest.


    Author Contributions
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 REFERENCES
 

Conception and design: Pedram Argani, Marc Ladanyi

Provision of study materials or patients: Pedram Argani, Marick Laé, Edgar T. Ballard, Mahul Amin, Carlos Manivel, Victor E. Reuter

Collection and assembly of data: Pedram Argani, Marick Laé, Brian Hutchinson, Victor E. Reuter, Marc Ladanyi

Data analysis and interpretation: Pedram Argani, Victor E. Reuter, Marc Ladanyi

Manuscript writing: Pedram Argani, Marc Ladanyi

Final approval of manuscript: Pedram Argani, Marick Laé, Edgar T. Ballard, Mahul Amin, Carlos Manivel, Brian Hutchinson, Victor E. Reuter, Marc Ladanyi

Other: Brian Hutchinson [TFE3 and TFEB immunohistochemical assay: development and application]

 


    Acknowledgment
 
We thank Mary Owens for outstanding secretarial support, and Dhananjay A. Chitale, MD (Memorial Sloan-Kettering Cancer Center), for providing clinical follow-up information, and Suresh C. Jhanwar, PhD (Memorial Sloan-Kettering Cancer Center), for providing cytogenetic data for patient 1.


    NOTES
 
Supported in part by National Institutes of Health Grant No. RO1 CA95785 (M.L.).

Presented in part at the 2005 United States and Canadian Academy of Pathology Annual Meeting, San Antonio, TX, March 1, 2005.

Authors' disclosures of potential conflicts of interest and author contributions are found at the end of this article.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 REFERENCES
 
1. Argani P, Ladanyi M: Renal carcinomas associated with Xp11.2 translocations/TFE3 gene fusions, in Eble JN, Sauter G, Epstein J, et al (eds): Pathology and Genetics of Tumors of the Urinary System & Male Genital Organs. Lyon, France, IARC Press, 2004, pp 37-38

2. Argani P, Antonescu CR, Illei PB, et al: Primary renal neoplasms with the ASPL-TFE3 gene fusion of alveolar soft part sarcoma: A distinctive tumor entity previously included among renal cell carcinomas of children and adolescents. Am J Pathol 159:179-192, 2001[Abstract/Free Full Text]

3. Argani P, Antonescu CR, Couturier J, et al: PRCC-TFE3 renal carcinomas: Morphologic, immunohistochemical, ultrastructural, and molecular analysis of an entity associated with the t(X;1)(p11.2;q21). Am J Surg Pathol 26:1553-1566, 2002[CrossRef][Medline]

4. Argani P, Ladanyi M: Distinctive neoplasms characterized by specific chromosome translocations comprise a significant proportion of pediatric renal cell carcinomas. Pathology 35:492-498, 2003[CrossRef][Medline]

5. Argani P, Hawkins A, Griffin CA, et al: A distinctive pediatric renal neoplasm characterized by epithelioid morphology, basement membrane production, focal HMB45 immunoreactivity, and t(6; 11)(p21.1; q12) chromosome translocation. Am J Pathol 158:2089-2096, 2001[Abstract/Free Full Text]

6. Argani P, Laé M, Hutchinson B, et al: Renal carcinomas with the t(6;11)(p21;q12): Clinicopathologic features and demonstration of the specific Alpha-TFEB gene fusion by immunohistochemistry, RT-PCR, and DNA-PCR. Am J Surg Pathol 29:230-240, 2005[CrossRef][Medline]

7. Davis IJ, His B-L, Arroyo JD, et al: Cloning of a novel Alpha-TFEB fusion in renal tumors harboring the t(6;11)(p21;q12) chromosome translocation. Proc Natl Acad Sci U S A 100:6051-6056, 2003[Abstract/Free Full Text]

8. Kuiper RP, Schepens M, Thijssen J, et al: Upregulation of the transcription factor TFEB in t(6;11)(p21;q13)-positive renal cell carcinomas due to promoter substitution. Hum Mol Genet 12:1661-1669, 2003[Abstract/Free Full Text]

9. Argani P, Lal P, Hutchinson B, et al: Aberrant nuclear immunoreactivity for TFE3 in neoplasms with TFE3 gene fusions: A sensitive and specific immunohistochemical assay. Am J Surg Pathol 27:750-761, 2003[CrossRef][Medline]

10. Huang FS, Zwerdling T, Stern LE, et al: Renal cell carcinoma as a secondary malignancy after treatment of acute promyelocytic leukemia. J Ped Hematol Oncol 23:609-611, 2001[CrossRef][Medline]

11. Renshaw AA, Granter SR, Fletcher JA, et al: Renal cell carcinomas in children and young adults: Increased incidence of papillary architecture and unique subtypes. Am J Surg Pathol 23:795-802, 1999[CrossRef][Medline]

12. Mertens AC, Yasui Y, Neglia JP, et al: Late mortality experience in five-year survivors of childhood and adolescent cancer: The Childhood Cancer Survivor Study. J Clin Oncol 19:3163-3172, 2001[Abstract/Free Full Text]

13. Robison LL, Mertens A: Second tumors after treatment of childhood malignancies. Hematol Oncol Clin North Am 7:401-415, 1993[Medline]

14. Meadows AT, Baum E, Fossatti-Bellani F, et al: Second malignant neoplasms in children: An update from the late effects study group. J Clin Oncol 3:532-538, 1985[Abstract]

15. Allsbrook WC, Boswell WC, Takahashi H, et al: Renal cell carcinoma arising in Wilms tumor. Cancer 67:690-695, 1991[CrossRef][Medline]

16. Medeiros LJ, Palmedo G, Krigman HR, et al: Oncocytoid renal cell carcinoma after neuroblastoma: A report of four cases of a distinct clinicopathologic entity. Am J Surg Pathol 23:772-780, 1999[CrossRef][Medline]

17. Medeiros LJ: Renal cell carcinoma associated with neuroblastoma, in: Eble JN, Sauter G, Epstein J, et al (eds): Pathology and Genetics of Tumors of the Urinary System & Male Genital Organs. Lyon, France, IARC Press, 2004, pp 39

18. Altinok G, Kattar MM, Mohamed A, et al: Pediatric renal carcinoma associated with Xp11.2 translocations/TFE3 gene fusions and clinicopathologic associations. Pediatr Dev Pathol 8:168-180, 2005[CrossRef][Medline]

19. Fenton DS, Taub JW, Amundson GM, et al: Renal cell carcinoma occurring in a child 2 years after chemotherapy for neuroblastoma. AJR Am J Roentgenol 161:161-166, 1993[Free Full Text]

20. Felix CA: Secondary leukemias induced by topoisomerase-targeted drugs. Biochim Biophys Acta 1400:233-255, 1998[Medline]

21. Andersen MK, Christiansem DH, Jensen BA, et al: Therapy-related acute lymphoblastic leukemia with MLL rearrangements following DNA topoisomerase II inhibitors, an increasing problem: Report on two new cases and review of the literature since 1992. Br J Haematol 114:539-543, 2001[CrossRef][Medline]

22. Allan JM, Travis LB: Mechanisms of therapy-related carcinogenesis. Nat Rev Cancer 5:943-955, 2005[CrossRef][Medline]

23. Gill Super HJ, McCabe NR, Thirman MJ, et al: Rearrangements of the MLL gene in therapy-related acute myeloid leukemia in patients previously treated with agents targeting DNA-topoisomerase II. Blood 82:3705-3711, 1993[Abstract/Free Full Text]

24. Ladanyi M, Lui MY, Antonescu CR, et al: The der(17)t(X;17)(p11;q25) of human alveolar soft part sarcoma fuses the TFE3 transcription factor gene to ASPL, a novel gene at 17q25. Oncogene 20:48-57, 2001[CrossRef][Medline]

25. Wang S, Mirra J, Bhuta S: Alveolar soft part sarcoma following radiation therapy for spinal hemangioma: A case report. Cancer 53:2655-2660, 1984[CrossRef][Medline]

26. Huang HY, Lui MY, Ladanyi M: Non-random cell cycle timing of a somatic chromosome translocation: The t(X;17) of alveolar soft part sarcoma occurs in G2. Genes Chromosomes Cancer 44:170-176, 2005[CrossRef][Medline]

Submitted October 4, 2005; accepted January 30, 2006.


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Facebook Facebook   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
JNCI J Natl Cancer InstHome page
C. Laverdiere, Q. Liu, Y. Yasui, P. C. Nathan, J. G. Gurney, M. Stovall, L. R. Diller, N.-K. Cheung, S. Wolden, L. L. Robison, et al.
Long-term Outcomes in Survivors of Neuroblastoma: A Report From the Childhood Cancer Survivor Study
J Natl Cancer Inst, August 19, 2009; 101(16): 1131 - 1140.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
Y. Komai, M. Fujiwara, Y. Fujii, H. Mukai, J. Yonese, S. Kawakami, S. Yamamoto, T. Migita, Y. Ishikawa, M. Kurata, et al.
Adult Xp11 Translocation Renal Cell Carcinoma Diagnosed by Cytogenetics and Immunohistochemistry
Clin. Cancer Res., February 15, 2009; 15(4): 1170 - 1176.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. A. Furge, J. Chen, J. Koeman, P. Swiatek, K. Dykema, K. Lucin, R. Kahnoski, X. J. Yang, and B. T. Teh
Detection of DNA Copy Number Changes and Oncogenic Signaling Abnormalities from Gene Expression Data Reveals MYC Activation in High-Grade Papillary Renal Cell Carcinoma
Cancer Res., April 1, 2007; 67(7): 3171 - 3176.
[Abstract] [Full Text] [PDF]


Home page
PediatricsHome page
J. D. Dickerman
The Late Effects of Childhood Cancer Therapy
Pediatrics, March 1, 2007; 119(3): 554 - 568.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Argani, P.
Right arrow Articles by Ladanyi, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Argani, P.
Right arrow Articles by Ladanyi, M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

About
JCO
 Editorial
Roster
 Advertising
Information
 Librarians &
Institutions
 Rights &
Permissions
 PDA Services

Copyright © 2006 by the American Society of Clinical Oncology, Online ISSN: 1527-7755. Print ISSN: 0732-183X
Terms and Conditions of Use
  HighWire Press HighWire Press™ assists in the publication of JCO Online