Advertisement
Journal of Clinical Oncology  
Search for:
Limit by:
  Browse by Subject or Issue
Home Search or Browse JCO My JCO Subscriptions Customer Service Site Map

Originally published as JCO Early Release 10.1200/JCO.2005.03.8802 on April 24 2006

Journal of Clinical Oncology, Vol 24, No 15 (May 20), 2006: pp. 2261-2267
© 2006 American Society of Clinical Oncology.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Smid, M.
Right arrow Articles by Foekens, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Smid, M.
Right arrow Articles by Foekens, J. A.
Related Articles
Right arrowRelated Editorials
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Genes Associated With Breast Cancer Metastatic to Bone

Marcel Smid, Yixin Wang, Jan G.M. Klijn, Anieta M. Sieuwerts, Yi Zhang, David Atkins, John W.M. Martens, John A. Foekens

From the Department of Medical Oncology, Erasmus MC–Daniel den Hoed, Rotterdam, the Netherlands; and Veridex LLC, a Johnson & Johnson Company, San Diego, CA

Address reprint requests to John A. Foekens, PhD, Erasmus MC, Josephine Nefkens Institute, Rm BE-426, Dr Molewaterplein 50, 3015 GE Rotterdam, the Netherlands; e-mail: j.foekens{at}erasmusmc.nl


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Appendix Gene Ontology Analysis
 Authors' Disclosures of...
 Author Contributions
 REFERENCES
 
Purpose The biology of tumors relapsing to bone is poorly understood. In this study, we initiated a search for genes that are implicated in tumors relapsing to bone in breast cancer.

Patients and Methods We analyzed 107 primary breast tumors in patients who were all lymph node negative at the time of diagnosis and all had experienced relapse. Total RNA isolated from frozen tumor samples was used to gather gene expression data using oligo microarrays.

Results A panel of 69 genes was found significantly differentially expressed between patients who experienced relapse to bone versus those who experienced relapse elsewhere in the body. The most differentially expressed gene, TFF1, was confirmed by quantitative reverse transcriptase polymerase chain reaction in an independent cohort (n = 122; P = .0015). Our differentially expressed genes, combined with a recently reported gene set relevant to tumors relapsing to bone in an animal model system, pointed to the involvement of the fibroblast growth factor receptor signaling pathway in preference of tumor cells that relapse to bone. Given that patients who experience relapse to bone may benefit from bisphosphonate therapy, we developed a classifier of 31 genes, which in an independent validation set correctly predicts all tumors relapsing to bone with a specificity of 50%.

Conclusion Our study identifies a panel of genes relevant to bone metastasis in breast cancer. The subsequently developed classifier of tumors relapsing to bone could, after thorough confirmation on an extended number of independent samples, and in combination with our previously developed high-risk profile, provide a diagnostic tool for the recommendation of adjuvant bisphosphonate therapy in addition to endocrine therapy or chemotherapy.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Appendix Gene Ontology Analysis
 Authors' Disclosures of...
 Author Contributions
 REFERENCES
 
The most abundant site of a distant relapse in breast, prostate, thyroid, kidney, and lung cancer patients is the bone. Breast cancer mainly gives rise to osteolytic bone lesions and it is plausible that the bone microenvironment facilitates circulating cancer cells to home and proliferate. Many factors have been implicated in facilitating relapse of tumors to bone, including blood flow in red bone marrow, immobilized growth factors (transforming growth factors β, bone morphogenetic proteins, platelet-derived growth factor, insulin-like growth factors, and fibroblast growth factors [FGFs]) in the bone matrix, and adhesive molecules on the tumor cells.1-4 However, in breast cancer patients the genes in the cancer cells promoting the interactions with bone are largely unknown. From the analyzed biologic factors detectable in primary tumors, it is the estrogen receptor (ER) status that currently has the strongest association with metastasis to the bone.

We recently described a 76-gene signature able to identify lymph node–negative breast cancer patients at high risk of distant recurrence.5 The ability of a tumor to metastasize, however, is a different event than the tumor’s ability to home, adhere, extravasate, and proliferate in a certain organ. This is concluded from the fact that the site of relapse is not associated with metastasis-free survival time or with our 76-gene prognostic signature5 (unpublished observation). These observations in patients are further supported by in vivo experiments using human breast cancer xenographs in nude mice.6,7 Therefore, using microarray gene expression data (Affymetrix U133A, Santa Clara, CA), we examined 107 samples from which the site of relapse was known, assuming that differentially expressed genes between tumors relapsing to bone or elsewhere will give us insight into the biologic features present in the primary breast cancer cells to preferentially interact with the bone microenvironment. Finally, we extracted a predictor of tumors relapsing to bone that may have a clinical application. Based on the fact that the identified predictor assigns patients who will develop a relapse into a group that experiences relapse to bone or elsewhere, this bone profile is only applicable after patients have been identified as being at high risk for a relapse (eg, using our 76-gene profile). When the bone profile is properly validated in independent cohorts, it may be used to include bisphosphonates as an additional adjuvant systemic therapy in early breast cancer to prevent bone metastasis.8


    PATIENTS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Appendix Gene Ontology Analysis
 Authors' Disclosures of...
 Author Contributions
 REFERENCES
 
Patient Data and Gene Expression Analysis
The study was performed in accordance to the Code of Conduct of the Federation of Medical Scientific Societies in the Netherlands (www.fmwv.nl). Relevant patient and tumor characteristics are presented in Table 1. The gene expression data (Affymetrix U133a GeneChip) used in this study were taken from our earlier study,5 using 17,819 probe sets that were designated as being present in two or more samples. For each probe set, the signal was expressed relative to the geometric mean of that probe set and was 2-log transformed. We included samples from those patients from which the site of relapse was known (n = 107). Samples were classified as bone when patients developed a tumor relapsing to bone, which included those who had additional metastases in other parts of the body. The remaining samples were labeled nonbone.


View this table:
[in this window]
[in a new window]

 
Table 1. Clinical and Tumor Characteristics of Patients

 
Data Analysis
Significance analysis of microarrays (SAM) analysis was used to identify differentially expressed genes.9 Three hundred permutations of the data were used to calculate a false discovery rate. Genes were considered significant when the false discovery rate was less than 5% and when a minimum of 1.7-fold difference in expression level was observed. To construct a diagnostic profile, samples were divided into a training set (n = 72; 46 with a relapse to bone and 26 with a relapse in a nonbone area) and a testing set (n = 35; 23 with a relapse to bone and 12 with a relapse to a nonbone area) stratified by site of relapse, ER protein level, and metastasis-free interval. A gene selection step using an optimal cutoff procedure was performed in the samples of the training set. All measured expression levels of a gene were used as the cut point to assign the gene expression as being high or low in a particular sample; a minimum of 20 samples were kept in one of the groups.

Because we knew the site of relapse of these samples, we counted the frequencies for the categories high bone, low bone, high nonbone, and low nonbone for each cutoff. The optimal cutoff was determined by using the {chi}2 distribution. Genes were included if the maximal {chi}2 score was 10.827 or higher (P < .001) for analysis in a prediction analysis of microarrays (PAM).10 Experiments to determine TFF1 mRNA levels by quantitative reverse transcriptase polymerase chain reaction (RT-PCR) were performed as described11 using the following primer pairs (TGGAGCAGAGAGGAGGCAAT and ACGAACGGTGTCGTCGAAAC). The samples selected for the RT-PCR study were matched for patient and tumor characteristics listed in Table 1. Gene expression levels were expressed relative to a panel of housekeeper genes and were 2-log transformed. The difference in gene expression levels of TFF1 was correlated to the two relapse groups and P values were calculated using the Kruskal-Wallis test with correction for ties.

TFF1 protein levels were assessed previously 12 in cytosols from tumor tissues and were measured as nanograms TFF1 per milligram of protein; these data were analyzed in a like manner as for the RT-PCR data. Unlike the patients from the microarray study, this cohort also contained node-positive patients but none received adjuvant hormonal or chemotherapy. Statistical analyses were performed using Analyze-it software (Analyze-it Software Ltd, Leeds, United Kingdom).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Appendix Gene Ontology Analysis
 Authors' Disclosures of...
 Author Contributions
 REFERENCES
 
Identification of Differentially Expressed Genes
We used previously retrieved gene expression data5 from 107 lymph node–negative primary breast tumors of patients who had developed distant metastasis. Samples were classified according to the site of relapse: 69 samples were labeled as bone and 38 samples were labeled as nonbone. Using SAM,9 we considered 73 probe-sets representing 69 unique genes as significantly differentially expressed between the bone and nonbone samples. The five highest ranking genes were TFF1, TFF3, AGR2, NAT1, and CRIP1, all of which are more highly expressed in the samples from patients with relapse to bone (Table 2). The highest ranked gene, TFF1, was studied in 122 independent breast tumors from node-negative patients with comparable clinical characteristics by quantitative RT-PCR. TFF1 expression was associated significantly with the site of relapse (P = .0015), with relative median expression level for TFF1 2-log scale of 3.02 (95% CI, 1.41 to 4.66) and –1.63 (95% CI, –5.44 to 2.49) for the group with relapse to bone and nonbone areas, respectively. In addition, the protein levels measured previously in 610 tumors from node-negative and node-positive patients12 showed a higher TFF1 protein content in the patients who experienced relapse to bone (P = .012). Median level and 95% CI was 46.18 (37.33 to 55.03) for the group with relapse to bone and 38.33 (27.11 to 49.56) for the group with relapse to a nonbone area.


View this table:
[in this window]
[in a new window]

 
Table 2. Genes Involved in Bone Metastasis of Breast Cancer

 
Development of a Predictor of Tumor Relapse to Bone
Given that the results indicate that the gene expression profile from primary tumors relapsing to bone is considerably different from that of tumors relapsing elsewhere in the body, we explored whether it is possible to predict tumor relapse to bone using these gene expression data. To study this, the samples were divided into a training set (n = 72) and a testing set (n = 35) stratified by site of relapse, ER protein level, and metastasis-free interval. Using the optimal cutoff procedure, we selected 588 informative genes for input in a PAM analysis.10 A 31-gene predictor was selected after 10-fold cross validation in the training set that could identify the samples with tumor relapse to bone in the testing set with 100% sensitivity and 50% specificity. The predictor showed a 79.3% positive predictive value and misclassified 17.1% of the samples. 17 genes in the profile, including TFF1, were also present in the SAM gene list (all 31 genes are referenced in the PAM column in Table 2).

To ascertain the validity of our gene set, we analyzed 50 sets of 100 randomly chosen genes. These random gene sets were used for input in a PAM analysis using the same training and testing set. Twenty-nine of the 50 random gene sets showed 100% sensitivity. Of these 29 sets, the average specificity is 13.2% (standard deviation, 14.2%), which indicates that the 50% specificity found by our gene list is significantly higher (z value, 2.59; two-tailed P = .0096) than that of the random data sets. Finally, because ER status has also been associated with tumor relapse to bone,1 we analyzed the performance of ER status to predict tumor relapse to bone in our test set. Of the 27 ER-positive tumors, 20 relapsed to the bone; of eight ER-negative tumors, three relapsed to the bone (74% sensitivity and 63% specificity). Thus, ER status performs less well compared with the bone signature to predict a tumor relapse to bone.

Annotation of Biologic Processes and Pathways to Bone Metastasis
To provide an impression of the biologic processes involved in the site of relapse, we mapped our differentially expressed genes to the Gene Ontology and Kyoto Encyclopedia of Genes and Genomes (KEGG) databases.13,14 Given that there were only eight genes from our SAM list annotated in the KEGG database, we extended our list with a recently published bone metastasis profile.6 In that study, Kang et al6 generated gene expression profiles from subclones of the ER-negative breast cancer cell line MDA-MB-231, which when injected into mice, poorly or efficiently relapsed to bone. Differentially expressed genes between those two subtypes were considered as the signature for tumor relapse to bone. Because Kang et al6 used the same gene expression chips as we did, we merged their 127 probe set list (122 unique genes) with our SAM gene list (n = 69). Even though our list and the list of Kang et al share only one gene (BENE), we expect the lists to pinpoint common pathways. Mapping the combined lists on the KEGG database14 revealed that of the total of 20 KEGG-annotated genes, five (FGF5, SOS1 and DUSP1 [Kang list] and FGFR3 and DUSP4 [SAM list]) were located in the fibroblast growth factor receptor (FGFR)-p42/44 mitogen-activated protein kinase (MAPK) pathway; all five genes were upregulated in the bone-metastasizing cells/tumors (Fig 1). To evaluate the number of mapped genes statistically, we selected all genes from the microarray annotated to KEGG (n = 3,428) and created 1,000 sets of 20 randomly chosen genes. We defined the FGF signaling pathway as all genes displayed in Figure 1, except the non–FGF ligand-receptor pairs. The mean and standard deviation of the number of genes that mapped to the FGF signaling pathway in the random datasets was 0.92 ± 0.92. A z value of 4.43 indicates that the observed number of five genes is significantly higher (P < .0001) than the number of genes found in the random selected sets.


Figure 1
View larger version (12K):
[in this window]
[in a new window]
[PowerPoint Slide for Teaching]
 
Fig 1. Graphical representation of the classical mitogen-activated protein kinase pathway adapted from Kyoto Encyclopedia of Genes and Genomes (KEGG).14 Denoted in blue are the genes we identified by significance analysis of microarrays, FGFR3 and DUSP4 (the latter listed in KEGG as MKP). In red are the genes reported by Kang et al,6 FGF5, SOS1, and DUSP1. All genes are more highly expressed in samples from tumors relapsing to bone.

 
We next studied the 142 genes from the combined list that were annotated in Gene Ontology and determined whether certain Gene Ontology descriptions were over-represented in the merged SAM/Kang list compared with all genes present on the U133a chip.13,15 Over-represented annotations point to biological processes, which potentially are linked to the site of relapse. For example, the description "extracellular" was linked to 21 of the 142 (14.8%) genes from the bone marker list, whereas 1,350 of 16,367 genes (8.2%) of the U133a chip were annotated to this description. This means "extracellular" is 1.8 times over-represented (P = .004; {chi}2 distribution) in the bone relapse list. Other examples are "cell adhesion" (17 genes; P = .0005) and "cell organization and biogenesis" (22 genes; P = 1.4 x 10–5), which were found to be 2.2 and 2.4 times over-represented, respectively. In addition, "immune response" was significant (P = 6.9 x 10–5), but in contrast to the above-mentioned descriptions, the genes linked to "immune response" originated predominantly from the Kang list.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Appendix Gene Ontology Analysis
 Authors' Disclosures of...
 Author Contributions
 REFERENCES
 
The biology of organ-specific metastasis is poorly understood. In this study we have searched for genes expressed in the primary tumors that preferentially relapse to bone. The SAM analysis yielded 69 differentially expressed genes between tumors relapsing to bone versus tumors relapsing elsewhere in the body. The trefoil protein encoding genes TFF1 and TFF3 were the highest ranking genes in the SAM analysis and validation of TFF1 by quantitative RT-PCR in a completely independent cohort confirmed that TFF1 expression was positively correlated with a tumor relapse to bone, suggesting the importance of these proteins in this process. TFF3 is found overexpressed in some primary and metastatic prostate cancers,16 whereas recent publications indicate that TFF1 induces cellular invasion of kidney and colon cancer cells.17,18 Thus, it is possible that in breast cancer, TFF1, using a similar mechanism, contributes selectively to invasion of bone.

The fact that TFF1 may contribute to tumor relapse to bone is underscored by its abundant presence in breast cancer micrometastases.19 However, because the TFF1 protein expression is usually lost during progression of some GI tract adenocarcinomas,20 it is intriguing to ascertain if TFF3 is of importance to consolidate breast cancer metastasis. Other data suggest that TFF peptides can dimerize with cysteine-rich molecules,20 and it is interesting in this regard that we identified cysteine-rich intestinal protein 1 (CRIP1) as one of the top five genes in our SAM analysis, which thus might be an interacting partner for TFF1 required for preferential relapse to bone. The expression of these two genes is highly correlated in the expression array samples (n = 286; Pearson r = 0.59; P < 10–10), suggesting common regulation or biology.

As hypothesized in the seed and soil theory of Paget,21 the molecular interaction of circulating cancer cells with the microenvironment of the bone matrix plays an important role in bone metastasis and depends on cell-to-cell interactions involving cell adhesion proteins between marrow stromal cells and cancer cells, and other types of communication between bone and cancer cells.22 In line with this view, we indeed found through our Gene Ontology analysis an over-representation of genes linked to "cell adhesion." Of the 17 genes linked to this description, six genes were found to be more highly expressed in bone-metastasizing cells/tumors: MCAM, PTK7, CTGF (Kang list), RND1, TSPAN1, and ANXA9 (SAM). These genes may thus participate in adhesion processes required for the colonization of bone. In addition, we identified through the KEGG pathway analysis that the FGFR-MAPK signaling pathway is over-represented in tumors spreading to bone. To have enough power in this analysis, we included the bone metastasis gene list of Kang et al6 derived from an in vitro cell model preferentially relapsing to bone in nude mice. With the exception of the BENE gene, these two lists of significant genes had no overlap. This may be due to the obvious differences in samples used (ie, tumors including stromal components from a mixed ER population versus an ER-negative cell line without stroma). However, it is reassuring that the clinical and in vitro studies point to a common pathway.

The exact effect of the FGF signaling pathway with respect to bone metastasis remains to be elucidated. However, it is intriguing that the growth factors FGF-1 and FGF-2 are stored in mineralized bone matrices,23 which is reminiscent of the chemoattraction displayed by some organs (including bone) that stimulates circulating cancer cells to colonize these organs. Heparanase, recently linked to bone metastasis of myeloma cells,24 may participate in this process, given that it can degrade and thereby release heparan sulfate–immobilized FGF. It is obvious that additional research using specific inhibitors or RNA interference–mediated knock-down experiments are needed to substantiate the role of the identified pathway on the ability to form bone metastasis in breast cancer.

The PAM analysis identified a 31-gene profile that was able to identify all samples with tumor relapse to bone in the testing set with a 50% specificity. The bone profile performed better than randomly chosen gene sets, but we are prudent in presenting our PAM list as a diagnostic profile for therapy decisions; we realize that a much larger confirmatory study is essential to validate its performance. If the bone profile is sufficiently validated, the use of a high-risk profile (eg, our 76-gene profile5 to identify patients at high risk for a distant recurrence), in combination with the bone profile would identify patients eligible for therapy with bisphosphonates. At present, the bone profile leads to overtreatment of 50% of the patients who will not experience a relapse to bone. Although it is advantageous to avoid overtreatment (ie, to increase the profile’s specificity), the undesired overtreatment of patients is probably outweighed by the fact that bisphosphonate therapy is well tolerated.25

Kang et al6 also analyzed their bone profile in 25 primary breast tumors.7 Using hierarchical clustering, two groups could be distinguished. One of the groups had 10 of 15 samples with a tumor relapse to bone (67% sensitivity), whereas the other group showed eight of 10 samples from areas with nonbone relapse (80% specificity). An analogous study describing a lung metastasis profile for breast cancer showed promising results in clinical samples.26 Future validation studies are needed to confirm these important findings.

We recently published a 76-gene profile5 that can identify breast cancer patients at high risk for a distant metastasis within 5 years. We were not able to correlate this high-risk profile to the site of relapse, nor did we find an association between the time until distant metastasis and site of relapse in our extensive patient database. Translating the high-risk profile and the bone profile to the general characteristics of a tumor, we conclude that aggressiveness of a tumor (ability to metastasize) is distinct from the tumor’s ability to home and proliferate in an organ-specific manner. In this respect, our study performed on human tumor specimens is completely in line with observations on human cell line subclones xenographed in animal models.6,7

We envision the use of the 76-gene profile5 to identify patients at high risk for a recurrence, whereas the bone profile can further subgroup the patients who will develop a tumor relapse to bone. This subgroup is clinically relevant because these patients may benefit from additional therapy with bisphosphonates.8

In conclusion, we have identified a set of genes including the trefoil protein encoding genes TFF1 and TFF3, a biological property (cell adhesion), and a signaling pathway (FGFR-MAPK) over-represented in primary breast cancers that preferentially relapse to the bone. We hypothesize that the indicated biologic features have an important role in bone metastasis, and establishment of the modus operandi may greatly benefit the large group of breast cancer patients with a relapse to the bone.


    Appendix Gene Ontology Analysis
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Appendix Gene Ontology Analysis
 Authors' Disclosures of...
 Author Contributions
 REFERENCES
 
The gene list of interest as well as the complete Affymetrix U133 gene list was linked to the Gene Ontology (GO) data using the Unigene cluster number as a linking pin. See Smid and Dorssers (Smid M, Dorssers LC: GO-Mapper: Functional analysis of gene expression data using the expression level as a score to evaluate GO terms. Bioinformatics 20:2618-2625, 2004) for details about the linking procedure. The Perl scripts described therein were modified so that an output file is generated that contains the number and identity of genes linked to a specific GO description. By merging the data from both the gene list of interest and complete array list, the relative frequencies can be calculated. For example, the description "extracellular" was linked to 21 of the 142 (14.8%) genes from the bone marker list, whereas 1,350 of 16,367 genes (8.2%) of the complete U133A chip were annotated to this description. This means "extracellular" is 1.8 times over-represented.

For the statistical evaluation we made use of the {chi}2 distribution. The above-mentioned example transformed in a 2 x 2 frequency table, making the genes mutually exclusive to each category (Table A1).


View this table:
[in this window]
[in a new window]

 
Table A1. Frequency Table for Description: Extracellular

 
All descriptions listed in the table below comply with the minimum parameters regarding expected frequencies when using the {chi}2 distribution. Over-represented descriptions were selected when P < .01 (Table A2).


View this table:
[in this window]
[in a new window]

 
Table A2. Gene Oncology Description Associated With Relapse to Bone

 
Figure A1 (parts A and B) gives the GO hierarchy of GO descriptions associated with bone relapse (descriptions that were not significant are grayed out; Fig A1).


Figure 1
View larger version (11K):
[in this window]
[in a new window]
[PowerPoint Slide for Teaching]
 
Fig A1. Gene Ontology (GO) hierarchy of GO description associated with relapse of bone.

 
We chose the low-level descriptions as the most informative (ie, least generic) annotation. Thus, we considered "immune response," "cell adhesion," "cell organization and biogenesis," and "extracellular" as significantly over-represented descriptions.

The genes that belong to the descriptions mentioned in the main text are listed in Tables A3GoGo to A6. (For significance analysis of microarrays [SAM] list, see Table 2; for Kang list, see reference 6.)


View this table:
[in this window]
[in a new window]

 
Table A3. Genes Linked to Gene Ontology Description: Cell Adhesion

 

View this table:
[in this window]
[in a new window]

 
Table A4. Genes Linked to Gene Ontology Description: Cell Organization and Biogenesis

 

View this table:
[in this window]
[in a new window]

 
Table A5. Genes Linked to Gene Ontology Description: Extracellular

 

View this table:
[in this window]
[in a new window]

 
Table A6. Genes Linked to Gene Ontology Description: Immune Response

 

    Authors' Disclosures of Potential Conflicts of Interest
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Appendix Gene Ontology Analysis
 Authors' Disclosures of...
 Author Contributions
 REFERENCES
 
Although all authors completed the disclosure declaration, the following authors or their immediate family members indicated a financial interest. No conflict exists for drugs or devices used in a study if they are not being evaluated as part of the investigation. For a detailed description of the disclosure categories, or for more information about ASCO’s conflict of interest policy, please refer to the Author Disclosure Declaration and the Disclosures of Potential Conflicts of Interest section in Information for Contributors.
Authors Employment Leadership Consultant Stock Honoraria Research Funds Testimony Other

Yixin Wang Veridex LLC, a Johnson & Johnson Company (N/R) Veridex LLC, a Johnson & Johnson Company (A)
Yi Zhang Veridex LLC, a Johnson & Johnson Company (N/R) Veridex LLC, a Johnson & Johnson Company (A)
David Atkins Johnson & Johnson (N/R) Johnson & Johnson (B)
John A. Foekens Veridex LLC, a Johnson & Johnson Company (C)

Dollar Amount Codes (A) < $10,000 (B) $10,000-99,999 (C) ≥ $100,000 (N/R) Not Required


    Author Contributions
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Appendix Gene Ontology Analysis
 Authors' Disclosures of...
 Author Contributions
 REFERENCES
 

Conception and design: Marcel Smid, Yixin Wang, Jan G.M. Klijn, David Atkins, John W.M. Martens, John A. Foekens

Collection and assembly of data: Anieta M. Sieuwerts, Yi Zhang

Data analysis and interpretation: Marcel Smid, Yixin Wang, Jan G.M. Klijn, Anieta M. Sieuwerts, Yi Zhang, David Atkins, John W.M. Martens, John A. Foekens

Manuscript writing: Marcel Smid, Yixin Wang, John W.M. Martens, John A. Foekens

Final approval of manuscript: Marcel Smid, Yixin Wang, Jan G.M. Klijn, Anieta M. Sieuwerts, Yi Zhang, David Atkins, John W.M. Martens, John A. Foekens

 


    NOTES
 
Supported in part by the Netherlands Genomics Initiative/Netherlands Organisation for Scientific Research. This organization had no role in study design, the collection or analysis of data, writing the article, or in decisions relating to publication.

Authors' disclosures of potential conflicts of interest and author contributions are found at the end of this article.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Appendix Gene Ontology Analysis
 Authors' Disclosures of...
 Author Contributions
 REFERENCES
 
1. James JJ, Evans AJ, Pinder SE, et al: Bone metastases from breast carcinoma: Histopathological-radiological correlations and prognostic features. Br J Cancer 89:660-665, 2003[CrossRef][Medline]

2. Coleman RE: Skeletal complications of malignancy. Cancer 80:1588-1594, 1997[CrossRef][Medline]

3. Koenders PG, Beex LV, Langens R, et al: Steroid hormone receptor activity of primary human breast cancer and pattern of first metastasis: The Breast Cancer Study Group. Breast Cancer Res Treat 18:27-32, 1991[CrossRef][Medline]

4. Roodman GD: Mechanisms of bone metastasis. N Engl J Med 350:1655-1664, 2004[Free Full Text]

5. Wang Y, Klijn JG, Zhang Y, et al: Gene-expression profiles to predict distant metastasis of lymph-node-negative primary breast cancer. Lancet 365:671-679, 2005[Medline]

6. Kang Y, Siegel PM, Shu W, et al: A multigenic program mediating breast cancer metastasis to bone. Cancer Cell 3:537-549, 2003[CrossRef][Medline]

7. Minn AJ, Kang Y, Serganova I, et al: Distinct organ-specific metastatic potential of individual breast cancer cells and primary tumors. J Clin Invest 115:44-55, 2005[CrossRef][Medline]

8. Lipton A: Management of bone metastases in breast cancer. Curr Treat Options Oncol 6:161-171, 2005[Medline]

9. Tusher VG, Tibshirani R, Chu G: Significance analysis of microarrays applied to the ionizing radiation response. Proc Natl Acad Sci U S A 98:5116-5121, 2001[Abstract/Free Full Text]

10. Tibshirani R, Hastie T, Narasimhan B, et al: Diagnosis of multiple cancer types by shrunken centroids of gene expression. Proc Natl Acad Sci U S A 99:6567-6572, 2002[Abstract/Free Full Text]

11. Martens JW, Nimmrich I, Koenig T, et al: Association of DNA methylation of phosphoserine aminotransferase with response to endocrine therapy in patients with recurrent breast cancer. Cancer Res 65:4101-4117, 2005[Abstract/Free Full Text]

12. Foekens JA, van Putten WL, Portengen H, et al: Prognostic value of PS2 and cathepsin D in 710 human primary breast tumors: Multivariate analysis. J Clin Oncol 11:899-908, 1993[Abstract/Free Full Text]

13. Ashburner M, Ball CA, Blake JA, et al: Gene ontology: Tool for the unification of biology—The Gene Ontology Consortium. Nat Genet 25:25-29, 2000[CrossRef][Medline]

14. Kanehisa M, Goto S: KEGG: Kyoto Encyclopedia of Genes and Genomes. Nucleic Acids Res 28:27-30, 2000[Abstract/Free Full Text]

15. Smid M, Dorssers LC: GO-Mapper: Functional analysis of gene expression data using the expression level as a score to evaluate Gene Ontology terms. Bioinformatics 20:2618-2625, 2004[Abstract/Free Full Text]

16. Garraway IP, Seligson D, Said J, et al: Trefoil factor 3 is overexpressed in human prostate cancer. Prostate 61:209-214, 2004[CrossRef][Medline]

17. Rodrigues S, Nguyen QD, Faivre S, et al: Activation of cellular invasion by trefoil peptides and src is mediated by cyclooxygenase- and thromboxane A2 receptor-dependent signaling pathways. FASEB J 15:1517-1528, 2001[Abstract/Free Full Text]

18. Rodrigues S, Attoub S, Nguyen QD, et al: Selective abrogation of the proinvasive activity of the trefoil peptides pS2 and spasmolytic polypeptide by disruption of the EGF receptor signaling pathways in kidney and colonic cancer cells. Oncogene 22:4488-4497, 2003[CrossRef][Medline]

19. Mikhitarian K, Gillanders WE, Almeida JS, et al: An innovative microarray strategy identities informative molecular markers for the detection of micrometastatic breast cancer. Clin Cancer Res 11:3697-3704, 2005[Abstract/Free Full Text]

20. Emami S, Rodrigues S, Rodrigue CM, et al: Trefoil factor family (TFF) peptides and cancer progression. Peptides 25:885-898, 2004[CrossRef][Medline]

21. Paget S: The distribution of secondary growths in cancer of the breast. 1889. Cancer Metastasis Rev 8:98-101, 1989[Medline]

22. Yoneda T, Hiraga T: Crosstalk between cancer cells and bone microenvironment in bone metastasis. Biochem Biophys Res Commun 328:679-687, 2005[CrossRef][Medline]

23. Hauschka PV, Mavrakos AE, Iafrati MD, et al: Growth factors in bone matrix: Isolation of multiple types by affinity chromatography on heparin-Sepharose. J Biol Chem 261:12665-12674, 1986[Abstract/Free Full Text]

24. Yang Y, Macleod V, Bendre M, et al: Heparanase promotes the spontaneous metastasis of myeloma cells to bone. Blood 105:1303-1309, 2005[Abstract/Free Full Text]

25. Li EC, Davis LE: Zoledronic acid: A new parenteral bisphosphonate. Clin Ther 25:2669-2708, 2003[CrossRef][Medline]

26. Minn AJ, Gupta GP, Siegel PM, et al: Genes that mediate breast cancer metastasis to lung. Nature 436:518-524, 2005[CrossRef][Medline]

Submitted August 18, 2005; accepted December 28, 2005.


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Facebook Facebook   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?

Related Editorials

  • A "Bone" Fide Predictor of Metastasis? Predicting Breast Cancer Metastasis to Bone
    Scott L. Kominsky and Nancy E. Davidson
    JCO 2006 24: 2227-2229 [Full Text]
  • A "Bone" Fide Predictor of Metastasis? Predicting Breast Cancer Metastasis to Bone
    Scott L. Kominsky and Nancy E. Davidson
    JCO 2006 24: 2227-2229 [Full Text]


This article has been cited by other articles:


Home page
Mol. Cell. ProteomicsHome page
A. Umar, H. Kang, A. M. Timmermans, M. P. Look, M. E. Meijer-van Gelder, M. A. den Bakker, N. Jaitly, J. W. M. Martens, T. M. Luider, J. A. Foekens, et al.
Identification of a Putative Protein Profile Associated with Tamoxifen Therapy Resistance in Breast Cancer
Mol. Cell. Proteomics, June 1, 2009; 8(6): 1278 - 1294.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
G. Bonuccelli, M. C. Casimiro, F. Sotgia, C. Wang, M. Liu, S. Katiyar, J. Zhou, E. Dew, F. Capozza, K. M. Daumer, et al.
Caveolin-1 (P132L), a Common Breast Cancer Mutation, Confers Mammary Cell Invasiveness and Defines a Novel Stem Cell/Metastasis-Associated Gene Signature
Am. J. Pathol., May 1, 2009; 174(5): 1650 - 1662.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
L. Lukes, N. P.S. Crawford, R. Walker, and K. W. Hunter
The Origins of Breast Cancer Prognostic Gene Expression Profiles
Cancer Res., January 1, 2009; 69(1): 310 - 318.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. Garcia-Closas and S. Chanock
Genetic Susceptibility Loci for Breast Cancer by Estrogen Receptor Status
Clin. Cancer Res., December 15, 2008; 14(24): 8000 - 8009.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
R. E. Coleman, T. A. Guise, A. Lipton, G. D. Roodman, J. R. Berenson, J.-J. Body, B. F. Boyce, L. M. Calvi, P. Hadji, E. V. McCloskey, et al.
Advancing Treatment for Metastatic Bone Cancer: Consensus Recommendations from the Second Cambridge Conference
Clin. Cancer Res., October 15, 2008; 14(20): 6387 - 6395.
[Abstract] [Full Text] [PDF]


Home page
Ann OncolHome page
R. S. Finn
Targeting Src in breast cancer
Ann. Onc., August 1, 2008; 19(8): 1379 - 1386.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
L. D. Moore, T. Isayeva, G. P. Siegal, and S. Ponnazhagan
Silencing of Transforming Growth Factor-{beta}1 In situ by RNA Interference for Breast Cancer: Implications for Proliferation and Migration In vitro and Metastasis In vivo
Clin. Cancer Res., August 1, 2008; 14(15): 4961 - 4970.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Smid, Y. Wang, Y. Zhang, A. M. Sieuwerts, J. Yu, J. G.M. Klijn, J. A. Foekens, and J. W.M. Martens
Subtypes of Breast Cancer Show Preferential Site of Relapse
Cancer Res., May 1, 2008; 68(9): 3108 - 3114.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. Chanrion, V. Negre, H. Fontaine, N. Salvetat, F. Bibeau, G. M. Grogan, L. Mauriac, D. Katsaros, F. Molina, C. Theillet, et al.
A Gene Expression Signature that Can Predict the Recurrence of Tamoxifen-Treated Primary Breast Cancer
Clin. Cancer Res., March 15, 2008; 14(6): 1744 - 1752.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
D. Meijer, A. M Sieuwerts, M. P Look, T. van Agthoven, J. A Foekens, and L. C J Dorssers
Fibroblast growth factor receptor 4 predicts failure on tamoxifen therapy in patients with recurrent breast cancer
Endocr. Relat. Cancer, March 1, 2008; 15(1): 101 - 111.
[Abstract] [Full Text] [PDF]


Home page
Ann OncolHome page
F.-C. Bidard, A. Vincent-Salomon, B. Sigal-Zafrani, V. Dieras, C. Mathiot, L. Mignot, J.-P. Thiery, X. Sastre-Garau, and J.-Y. Pierga
Prognosis of women with stage IV breast cancer depends on detection of circulating tumor cells rather than disseminated tumor cells
Ann. Onc., March 1, 2008; 19(3): 496 - 500.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
L. Li, A. Chaudhuri, J. Chant, and Z. Tang
PADGE: analysis of heterogeneous patterns of differential gene expression
Physiol Genomics, December 19, 2007; 32(1): 154 - 159.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
A. A.N. Rose, F. Pepin, C. Russo, J. E. Abou Khalil, M. Hallett, and P. M. Siegel
Osteoactivin Promotes Breast Cancer Metastasis to Bone
Mol. Cancer Res., October 1, 2007; 5(10): 1001 - 1014.
[Abstract] [Full Text] [PDF]


Home page
Ann OncolHome page
P. Lonning, S Knappskog, V Staalesen, R Chrisanthar, and J. Lillehaug
Breast cancer prognostication and prediction in the postgenomic era
Ann. Onc., August 1, 2007; 18(8): 1293 - 1306.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. J. Minn, G. P. Gupta, D. Padua, P. Bos, D. X. Nguyen, D. Nuyten, B. Kreike, Y. Zhang, Y. Wang, H. Ishwaran, et al.
Lung metastasis genes couple breast tumor size and metastatic spread
PNAS, April 17, 2007; 104(16): 6740 - 6745.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
S. L. Kominsky and N. E. Davidson
A "Bone" Fide Predictor of Metastasis? Predicting Breast Cancer Metastasis to Bone
J. Clin. Oncol., May 20, 2006; 24(15): 2227 - 2229.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Smid, M.
Right arrow Articles by Foekens, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Smid, M.
Right arrow Articles by Foekens, J. A.
Related Articles
Right arrowRelated Editorials
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

About
JCO
 Editorial
Roster
 Advertising
Information
 Librarians &
Institutions
 Rights &
Permissions
 PDA Services

Copyright © 2006 by the American Society of Clinical Oncology, Online ISSN: 1527-7755. Print ISSN: 0732-183X
Terms and Conditions of Use
  HighWire Press HighWire Press™ assists in the publication of JCO Online