Advertisement
Journal of Clinical Oncology  
Search for:
Limit by:
  Browse by Subject or Issue
Home Search or Browse JCO My JCO Subscriptions Customer Service Site Map

Originally published as JCO Early Release 10.1200/JCO.2006.06.1580 on September 5 2006

Journal of Clinical Oncology, Vol 24, No 29 (October 10), 2006: pp. 4714-4720
© 2006 American Society of Clinical Oncology.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Baldus, C. D.
Right arrow Articles by Hofmann, W. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Baldus, C. D.
Right arrow Articles by Hofmann, W. K.

High Expression of the ETS Transcription Factor ERG Predicts Adverse Outcome in Acute T-Lymphoblastic Leukemia in Adults

Claudia D. Baldus, Thomas Burmeister, Peter Martus, Stefan Schwartz, Nicola Gökbuget, Clara D. Bloomfield, Dieter Hoelzer, Eckhard Thiel, Wolf K. Hofmann

From the Department of Hematology, Oncology, and Transfusion Medicine; Department of Biostatistics and Clinical Epidemiology, Charité, Campus Benjamin Franklin Berlin, University Hospital, Berlin; Department of Hematology and Oncology, University of Frankfurt am Main, Frankfurt, Germany; and Ohio State University, Comprehensive Cancer Center, Columbus, OH

Address reprint requests to Claudia D. Baldus, MD, Department of Hematology, Oncology and Transfusion Medicine, Charité, Campus Benjamin Franklin, University Hospital Berlin, Hindenburgdamm 30, 12203 Berlin, Germany; e-mail: claudia.baldus{at}charite.de


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Appendix
 Authors' Disclosures of...
 Author Contributions
 GLOSSARY
 REFERENCES
 
PURPOSE: In adult T-lymphoblastic leukemia (T-ALL) disease-free survival remains limited to 32% to 46%. The adverse prognosis in T-ALL has not been attributed to cytogenetic or molecular aberrations. We have determined the prognostic impact of the oncogenic transcription factor ERG in T-ALL.

PATIENTS AND METHODS: ERG expression was analyzed by real-time polymerase chain reaction (PCR) in 105 adults with newly diagnosed T-ALL treated on the German ALL protocols. Patients were dichotomized at ERG's median expression into low (n = 52) and high (n = 53) expressers. Homeobox (HOX) 11 and HOX11L2 expression was determined by real-time PCR.

RESULTS: High ERG expressers compared with low ERG expressers had an inferior overall survival (OS, P = .02; 5-year OS: high ERG 26% v low ERG 58%) and relapse-free survival (RFS, P = .003; 5-year RFS: high ERG 34% v low ERG 72%). On multivariable analysis high ERG expression (P = .005), immunophenotypic subgroups (early v mature v thymic T-ALL; overall P = .04), HOX11L2 positivity (P = .055), and absence of HOX11 (P = .017) were independent adverse risk factors predicting RFS. Patients with high ERG expression had a hazard ratio (HR) for relapse of 3.2. Within the good prognostic subgroup of thymic T-ALL (n = 57), high ERG (HR, 4.1; P = .02) and presence of HOX11L2 (HR, 6.6; P = .008) were independent adverse factors for RFS.

CONCLUSION: High expression of ERG is an adverse risk factor in adult T-ALL. Within thymic T-ALL, otherwise classified as standard-risk, high ERG expression-identified patients that were four times more likely to fail long-term RFS. The prognostic impact of ERG may assist treatment stratification and suggest the need of alternative regimens.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Appendix
 Authors' Disclosures of...
 Author Contributions
 GLOSSARY
 REFERENCES
 
Acute T-lymphoblastic leukemia (T-ALL) accounts for 25% of adult ALL. Although the prognosis in T-ALL has improved in recent years as a result of an increased response rate using intensive chemotherapy, long-term disease-free survival remains limited to 32% to 46%.1,2

The varying clinical outcome of T-ALL patients implies the molecular heterogeneity of this disease. However, few molecular markers associated with clinical outcome have been identified.3 The molecular characterization of recurrent chromosomal translocations has provided insights into oncogenic pathways involved in leukemogenesis of T-ALL.4 Genes targeted by chromosomal translocations include oncogenic transcriptions factors as well as signal transduction members resulting in the disruption of normal hematopoietic proliferation and differentiation.5 Developmentally important transcriptions factors (ie, homeobox [HOX] genes) are frequently localized in the vicinity of the T-cell receptor genes resulting in high levels of oncogene expression.4,6 Moreover, it has been shown that even in the absence of chromosomal rearrangements aberrant activation of certain key transcription factor genes is a principal transforming event in ALL and may confer prognostic implications. In particular, ectopic expression of certain HOX genes may be of prognostic significance.7

ETS transcription factors are known to be key players in lineage specific regulation during commitment and differentiation of lymphocytes.8 In particular, the ETS transcription factor ERG has been shown to modulate the maturation of lymphoid cells. In early T-cell development, ERG expression is induced at the time of T-lineage specification and shut off once T-cell commitment is complete. ERG shows specificity to early T- and B-cell lineages as well as myeloid cells.9 In addition, ERG is involved in the rare t(16;21)(p11;q22) in acute myeloid leukemia (AML) leading to the chimeric FUS/ERG gene fusion.10 Furthermore, ERG is overexpressed in the prognostically inferior subgroup of AML with a complex karyotype.11 In AML lacking chromosomal aberrations, it was recently demonstrated that high level ERG expression was associated with an immature phenotype and was an independent risk factor predicting inferior outcome.12

We hypothesized that due to its specific involvement in T-cell development and its oncogenic potential, aberrant expression of ERG might play a role in T-ALL. To test this, we analyzed ERG mRNA expression levels in 105 adult patients with newly diagnosed T-ALL, enrolled on the multicenter treatment protocols of the German Acute Lymphoblastic Leukemia (GMALL) study group. Herein we show that high-level expression of ERG constitutes an independent adverse prognostic factor and identifies T-ALL patients with a high risk of relapse and inferior survival.


    PATIENTS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Appendix
 Authors' Disclosures of...
 Author Contributions
 GLOSSARY
 REFERENCES
 
Patients and Treatment
This study included adult patients with newly diagnosed T-ALL, who enrolled between 1993 and 2000 on the GMALL 05/93 and 06/99 multicenter protocols.13,14 These GMALL protocols included intensive chemotherapy and radiation (online-only Fig A1). For patients enrolled during this time period autologous or allogeneic stem-cell transplantation (SCT) was a treatment option based on physician discretion. All patients gave written informed consent to participate in the study according to the Declaration of Helsinki. This study was approved by the ethics board of the Johann Wolfgang Goethe-Universität Frankfurt am Main, Germany.

Morphological and Immunophenotypic Analyses
Morphologic analysis of bone marrow (BM) smear preparations was carried out at the central reference laboratory for cytomorphology of the GMALL study group at the University of Schleswig-Holstein, Kiel, Germany. Pretreatment BM samples were centrally collected and stored. Samples were enriched for the blast fraction by density-gradient centrifugation (Ficoll-Paque Plus; Amersham Biosciences, Uppsala, Sweden) and stored in liquid nitrogen.

Immunophenotyping of fresh samples was centrally performed in the GMALL reference laboratory at the Charité, University Hospital Berlin, Germany. Immunophenotyping was carried out using commercially available, fluorochrome-labeled monoclonal antibodies: CD7, CD5, CD2, CD3, CD4, CD8, CD1a, CD56, CD19, CD33, CD13, CD10, HLA-DR, CD117, CD34, and TdT. Immunophenotyping was performed as described using a FACScan and Cell Quest software (Becton Dickinson, Heidelberg, Germany).15,16 Cell-surface antigens were considered positive when 20% or more of cells showed fluorescence intensity, and cytoplasmic/intranuclear staining was considered positive when 10% or more of cells exhibited cytoplasmic/intranuclear fluorescence compared with negative controls. Patients were assigned to the following subtypes according to the European Group for Immunophenotyping of Leukemias classification.15 In this classification T-lineage leukemias were categorized based on the maturation status: pre-T-ALL (cyCD3+, CD7+, CD5–, CD2–, sCD3–, CD4–, CD8–, CD1a–); early T-ALL (cyCD3+, CD7+, CD5+/–, CD2+/–, sCD3–, CD4–/+, CD8–/+, CD1a–); thymic T-ALL (cyCD3+, CD7+, CD5+, CD2+, sCD3+/–, CD4+/–, CD8+/–, CD1a+); and mature T-ALL (cyCD3+, CD7+, CD5+, CD2+, sCD3+, CD4+/–, CD8+/–, CD1a–). The GMALL study group merges the immature subtypes of pre-T-ALL and early T-ALL to form a combined early T-ALL group.

RNA Isolation and Complementary DNA Synthesis
Pretreatment BM samples were available from 105 T-ALL patients. Isolation of total RNA from mononuclear cells was carried out using the RNeasy Mini Kit (QIAGEN, Hilden, Germany) following the manufacturer’s instructions. Complementary DNA (cDNA) was synthesized using 500 ng of total RNA and avian myeloblastosis virus reverse transcriptase at 50°C for 60 minutes in the presence of RNase inhibitor (RT-AMV; RNasin, Roche, Mannheim, Germany).

Real-Time Reverse Transcriptase Polymerase Chain Reaction
ERG. Quantitative real-time reverse transcriptase polymerase chain reaction (RT-PCR) assays were performed for each sample in duplicate. Glucose-phosphate isomerase (GPI) and ERG were coamplified in the same tube using 1 µL cDNA, 1x master mix (IQ Mix, BioRad, Munich, Germany), GPI probe (5'-HEX-TTCAGCTTGACCCTCAACACCAAC-TAMRA) with GPI forward (5'TCTTCGATGCCAACAAGGAC) and reverse (5'GCATCACGTCCTCCGTCAC) primers, and ERG probe (6-FAM-CGTGCCAGCAGATCCTACGCTATGG-TAMRA) with ERG forward (5'CACGAACGAGCGCAGAGTTA) and reverse (5'CTGCCGCACATGGTCTGTAC) primers. Primers for GPI and ERG were intron spanning. Amplification was carried out at 50°C for 2 minutes, 95°C for 10 minutes, followed by 40 PCR cycles at 95°C for 15 seconds, and 60°C for 1 minute. Reactions were carried out using the rotor gene real-time PCR 3000 system (Corbett Research, Wasserburg, Germany). The comparative cycle threshold (CT) method was used to determine the relative expression levels of ERG, and the cycle number difference ({Delta}CT = GPI-ERG) was calculated for each replicate. Relative ERG expression values were calculated using the mean of {Delta}CT from the two replicates, that is µ({Delta}CT) = ({Sigma}{Delta}CT)/2, and expressed as 2µ({Delta}CT). In all samples, amplification of GPI reached the threshold within 30 cycles. Positive and negative controls were included in all assays.

HOX11 and HOX11L2. Real-time RT-PCR was used to determine HOX11 and HOX11L2 expression levels. Patients were classified positive or negative for HOX11 and HOX11L2 based on the presence or absence of amplification of the target genes HOX11 and HOX11L2.17 The following primers and probes were used for HOX11 and HOX11L2: HOX11-F GATGGAGAGTAACCGCAGATACAC, HOX11-R TGCGCGGCTTCTTCTTCTT, HOX11-FAM FAM-AGGACAGGTTCACAGGTCACCCCTATCAGA-BHQ1, and HOX11L2-F CAAGACCTGGTTCCAAAACCG, HOX11L2-R AGGCTGGATGGAGTCGTTGA, and HOX11L2-FAM FAM-CAGCTGCAACACGACGCCTTCCAA-BHQ1. The ABsolute QPCR Mix (ABGene, Hamburg, Germany) containing the hot start enzyme Thermo-Start DNA polymerase was used with the following cycler program: 15 minutes at 95°C, 55 cycles (15 seconds at 95°C, 60 seconds at 60°C), and 10 minutes at 25°C. RNA from the ALL-SIL and HPB-ALL cell lines were used as positive controls.

Statistical Analysis
Comparisons of baseline clinical variables across groups were made using the {chi}2 or a two-sided Fisher’s exact test for categoric data; the nonparametric Mann-Whitney U test was applied for continuous variables. A P value of .05 or less (two sided) was considered significant. ERG expression levels were dichotomized at their median due to the outcome analyses of ERG quartiles (online-only Fig A2), and patients were classified as having low ERG if they had expression values within the lower 50% and as high ERG if they had ERG expression values within the upper 50% of all measured values.

Achievement of complete remission (CR) was assessed after completion of induction chemotherapy and required granulocytes 1,500/µL or higher, platelets 100,000/µL or higher, no peripheral blood blasts, BM cellularity greater than 20% with maturation of all cell lines, less than 5% BM blasts, and no extramedullary leukemia. Primary resistance to chemotherapy was defined as higher than 25% blasts in the BM or persistence of peripheral blood blasts after induction. Relapse was defined as the reappearance of circulating blasts, higher than 5% BM blasts, or development of extramedullary leukemia.

Median follow-up for living patients was 59 months (range, 2.4 months to 110 months). After exclusion of 15 patients that received SCT as consolidation treatment, 90 T-ALL patients were included for analyses of overall survival (OS) and 74 for relapse-free survival (RFS).

OS was calculated using the Kaplan-Meier method and the log-rank test was used to compare differences between survival curves. OS was measured from the protocol on-study date until the date of death regardless of cause, censoring for patients alive at last follow-up. RFS was defined only for patients who achieved CR, and was measured from the date of attaining CR until the date of relapse, censoring for death in CR (in one patient).

Cox proportional hazards models were constructed for RFS and OS. The following covariates were included in the full model: ERG expression (low v high), presence or absence of HOX11 and HOX11L2 expression, treatment protocol (GMALL 05/93 v GMALL 06/99), sex, white blood count (WBC; < 100,000/µL v ≥ 100,000/µL), age (< median of 29 years v ≥ 29 years), immunophenotype (early, thymic, mature), mediastinal mass (presence v absence), CNS involvement (presence v absence). Stepwise forward selection was performed. All calculations were performed using the SPSS software package, version 12 for Windows (SPSS Inc, Chicago, IL).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Appendix
 Authors' Disclosures of...
 Author Contributions
 GLOSSARY
 REFERENCES
 
ERG Expression in T-ALL Patients and Association With Clinical and Molecular Features
ERG expression was analyzed in pretreatment samples of 105 newly diagnosed T-ALL patients. Low ERG (n = 52) and high ERG (n = 53) were defined as described in the Statistical Methods section. There were no significant differences between patients with low and high ERG expression with respect to sex, pretreatment WBC, age, positivity for HOX11 and HOX11L2 expression, nor immunophenotype (Table 1).


View this table:
[in this window]
[in a new window]
 
Table 1. ERG Expression in T-ALL (n = 105)

 
Outcome and Survival in T-ALL Patients With Respect to ERG Expression
No difference was seen in the CR rate between the low and the high ERG group. High ERG was associated with a higher relapse rate (46%) compared with patients with low ERG expression (20%; P = .01; Table 1). Patients with high level ERG expression had a significantly shorter OS (P = .02; 5-year OS: high ERG 26% v low ERG 58%) and RFS (P = .003; 5-year RFS: high ERG 34% v low ERG 72%; Table 2, Fig 1). On multivariable analysis, high expression of ERG was of independent adverse prognostic significance for RFS with a hazard ratio (HR) of 3.2 (95% CI, 1.4 to 7.3; P = .005). Significant adverse cofactors included the immunophenotype with inferior outcome for patients with early and mature T-ALL compared with thymic T-ALL, as well as absence of HOX11 and positivity of HOX11L2 (Table 3). In the multivariable analysis for OS the only factor in the final model predicting outcome was the immunophenotype (P < .001).


View this table:
[in this window]
[in a new window]
 
Table 2. Impact of ERG Expression on Survival in T-ALL (n = 90)

 

Figure 1
View larger version (12K):
[in this window]
[in a new window]
 
Fig 1. Kaplan-Meier analysis of (A) overall survival and (B) relapse-free survival showing a significantly inferior outcome within adult T-ALL for patients with high ERG expression compared with patients with low ERG expression.

 

View this table:
[in this window]
[in a new window]
 
Table 3. Multivariable Analysis of ERG Expression for RFS (n = 72)*

 
ERG Expression and Survival in Thymic Differentiated T-ALL
As reported previously,13 T-ALL patients with an early or mature immunophenotype showed an adverse outcome compared with patients with thymic differentiated CD1a positive T-ALL (Fig 2). ERG expression levels (when used as a continuous variable) were significantly correlated with the immunophenotype (overall P value, P = .038; Table 1) with higher expression levels in early compared with thymic (P = .01) and to mature T-ALL (P = .18).


Figure 2
View larger version (14K):
[in this window]
[in a new window]
 
Fig 2. Kaplan-Meier analysis of relapse-free survival for T-ALL patients with respect to the immunophenotype.

 
Due to the difference in outcome among immunophenotypic subgroups and the association between ERG expression levels and immunophenotypic subgroups, we analyzed the prognostic relevance of ERG within these three T-ALL subgroups. There was no difference in OS or RFS between high and low ERG expressers within the small subgroups of early (n = 21) and mature T-ALL (n = 23; data not shown). Within the largest subgroup, thymic T-ALL patients (n = 61), 34 patients were classified as low ERG expressers and 27 patients were classified as high ERG expressers. There were no significant differences in age, WBC, HOX11 or HOX11L2 expression between these two groups. For patients with thymic T-ALL high ERG expression was associated with a significantly higher relapse rate (42% v 13%; P = .03; Table 4). Among 57 patients included in the survival analyses, high ERG expression resulted in a shorter OS (P = .48; 5-year OS: high ERG, 35% v low ERG, 72%) and inferior RFS with a 5-year RFS of 46% for patients with high versus 82% for patients with low ERG expression (P = .01; Table 4, Fig 3). When the analysis was restricted to HOX11L2 negative patients ERG expression remained a significant prognostic factor (OS P = .04; RFS P = .02). In the multivariable analyses including all thymic T-ALL patients, patients with high ERG expression were four times more likely to relapse than those with low ERG expression (HR, 4.1; 95% CI, 1.2 to 13.7; P = .02; Table 5). The only other significant factor predictive for inferior RFS was HOX11L2 positivity. For OS HOX11L2 positivity was the only significant risk factor predicting inferior survival in thymic T-ALL with a HR for death of 3.6 (95% CI, 1.1 to 11.3; P = .03); high ERG expression was also in included in the final model, but failed to be of statistical significance (HR, 2.3; 95% CI, 0.9 to 5.9; P = .08).


View this table:
[in this window]
[in a new window]
 
Table 4. ERG Expression in Thymic T-ALL

 

Figure 3
View larger version (12K):
[in this window]
[in a new window]
 
Fig 3. Kaplan-Meier analysis of (A) overall survival and (B) relapse-free survival showing a significantly inferior outcome for patients with high ERG expression compared with patients with low ERG expression within the subgroup of patients with thymic T-ALL.

 

View this table:
[in this window]
[in a new window]
 
Table 5. Multivariable Analysis of ERG Expression in Thymic T-ALL for RFS (N = 51)

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Appendix
 Authors' Disclosures of...
 Author Contributions
 GLOSSARY
 REFERENCES
 
The distinct expression of the ETS transcription factor ERG during normal T-cell development as well as its oncogenic potential prompted us to determine the prognostic impact of ERG expression in T-ALL. Studies in normal hematopoiesis have examined the regulation of ERG and shown a marked upregulation of ERG in early T-cell precursors at the time of specification to the T-lineage and silencing just after T-lineage commitment.9 However, no studies have previously investigated the role of ERG expression in lymphoblastic leukemia. In patients with AML with normal cytogenetics high expression levels of ERG were recently reported to be predictive for inferior outcome.12 We now have explored the prognostic impact of ERG expression levels in adult patients diagnosed with T-ALL and show for the first time that high mRNA expression of ERG is an independent risk factor in T-ALL predicting inferior RFS.

The prognosis of T-ALL in adults remains limited with 5-year survival rates of 32% to 46%. In B-lineage ALL and myeloid leukemia, the prognosis can be attributed to specific cytogenetic or molecular aberrations.3,18 Cellular and molecular aberrations have been identified by immunophenotypic analyses and by molecular genetic techniques such as RT-PCR, global gene expression, direct sequencing, and analyses of epigenetic changes.19-26 However, only a few abnormalities have recently proven to be of prognostic significance in adult T-ALL.19-21,23,25

The most relevant molecular risk factors include the transcription factors HOX11 and HOX11L2, which belong to developmentally important genes that when aberrantly expressed promote malignant transformation. Their prognostic relevance however, in both childhood and in adult T-ALL, is controversial. In childhood T-ALL, HOX11 expression was associated with favorable outcome, most likely reflecting an arrest of the leukemic cells at an early cortical stage of T-cell maturation.20,27 Another study however, showed no difference in survival according to the HOX11 status.28 Differences in prognosis have also been observed with respect to HOX11L2, which was associated with favorable28 as well as inferior outcome in different studies.7 In adult T-ALL the prognostic relevance of HOX11 is also controversial, showing superior outcome for patients expressing HOX1121 as well as no difference in outcome with respect to the HOX11 status.4,17,24 Overexpression of HOX11L2 has been associated with inferior outcome in various studies.4,17,24 The identification of molecular risk factors is needed to guide treatment stratification in future trials.

Genes of the ETS transcription factor family are involved in signal transduction pathways that regulate and promote cell differentiation, proliferation, and tissue invasion. Dysregulation of such genes may have significant impact on normal cell growth. While our data suggest that expression of ERG is a potential risk factor and may guide treatment stratification in adult T-ALL, the molecular mechanism of aberrant ERG expression contributing to leukemogenesis is unknown. In normal T-cell development, ERG expression is downregulated at initiation of T-cell commitment. In adult T-ALL higher ERG expression levels were found in the immature subtype of early T-ALL resembling the physiological expression pattern of normal T-cell development. A similar finding was observed in AML, where high expression of ERG was significantly correlated with the immature subtypes.12 We propose that aberrant overexpression of ERG in thymic differentiated T-ALL may specify a hitherto obscured molecular immature cell origin. High level expression in the more immature subtypes of T-ALL and aberrant overexpression of ERG in thymic differentiated T-ALL may be responsible for more aggressive disease resulting in an adverse outcome. In our study overexpression of ERG in patients within thymic differentiated CD1a positive T-ALL—currently regarded as a standard risk group—emerged as an independent adverse factor for RFS.

In this study, we have for the first time identified high ERG expression as an independent adverse prognostic factor in adult patients with T-ALL. In addition, we have characterized the presence of HOX11L2 as an adverse risk factor and confirmed the adverse impact of the absence of HOX11 expression.21 Moreover, within the largest immunophenotypic subgroup, thymic T-ALL, high ERG expression, and positivity of HOX11L2 independently identified patients that were at high risk to fail to achieve long-term RFS. These analyses in thymic T-ALL are based on small numbers and a prospective trial will be necessary to confirm these results. However, the fact that HOX11L2 and ERG expression independently impact the clinical course suggests the involvement of different molecular pathways in T-ALL.

Importantly, high ERG expression identified high-risk patients within the relatively good prognostic group of thymic T-ALL with an inferior outcome (projected OS at 5 years, 35%) similar to patients with mature T-ALL (5 years OS, 27%). These high-risk patients characterized by a high CR rate and a high relapse rate might benefit from alternative consolidation regimens including SCT. Encouraging results of allogeneic SCT in first CR in T-ALL have already been reported with a RFS of 74% at 3 years.29 In contrast, low ERG expression was predictive for favorable outcome with 82% of thymic T-ALL patients remaining relapse-free at 5 years, thus identifying patients for whom more intensive consolidation regimens may become unnecessary.

Increasing understanding about the molecular aberrations in leukemogenesis allows treatment optimization for patients with leukemia. Prognostically relevant molecular markers can guide risk-adapted treatment strategies and will also be the basis for the development of new targeted therapies. In this perspective, insights into the transcriptional regulation of ERG and its oncogenic pathways, as well as the prognostic relevance of ERG, emerge as critical steps for treatment stratification and the design of novel therapeutic approaches. If further prospective studies confirm our results ERG expression may routinely serve as a risk factor for treatment stratification in adult T-ALL.


    Appendix
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Appendix
 Authors' Disclosures of...
 Author Contributions
 GLOSSARY
 REFERENCES
 
Go


Figure 4
View larger version (14K):
[in this window]
[in a new window]
 
Fig A1. The differences between the two treatment protocols (GMALL 05/93 and GMALL 06/99) are indicated by the blue boxes. The two induction therapies (IT I and IT II) were the same in the two studies consisting of steroids, asparaginase (ASP), vincristine, and daunorubicin as well as intrathecal methotrexate (MTX). Consolidation (C I and C II) included high-dose (HD) cytarabine (AraC) and high-dose MTX cycles. The two cycles of reinduction therapy (Re-IT I and Re-IT II) were the same in both protocols. Final consolidation therapy consisted of cycles of AraC, cyclophosphamide (Cyclo), VM26, high-dose MTX, and ASP. No significant differences in the clinical outcome were observed for patients treated in the two different treatment protocols 05/93 and 06/99 (OS P = .7 and EFS P = .2). The treatment protocol was included as a variable in the multivariate analyses, where it was of no significant prognostic impact in any of the models.

 
Go


Figure 5
View larger version (14K):
[in this window]
[in a new window]
 
Fig A2. Kaplan-Meier analysis of relapse-free survival (RFS) according to ERG expression categorized in quartiles (Q) 1 to 4 (based on the expression levels of 105 adults with T-ALL). Differences between Q1 and to Q2, as well as between Q3 and Q4 were not statistically significant. In contrast, comparing Q1 with Q3 (P = .049), and Q1 with Q4 (P = .001), as well as Q2 with Q4 (P = .02), Kaplan-Meier analyses detected significantly inferior RFS of the latter. In addition, compared with patients in Q1 a steady increase of the relapse risk was seen in the following Q with a relative risk of 1.94 for Q2, 3.34 for Q3, and 6.04 for Q4. Due to the uniform and nearly equidistant increase in risk we used the median of ERG expression for our analysis. There were no differences with respect to the clinical characteristics (WBC, sex, age, HOX11, HOX11L2, immunophenotype) among the quartiles.

 

    Authors’ Disclosures of Potential Conflicts of Interest
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Appendix
 Authors' Disclosures of...
 Author Contributions
 GLOSSARY
 REFERENCES
 
The authors indicated no potential conflicts of interest.


    Author Contributions
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Appendix
 Authors' Disclosures of...
 Author Contributions
 GLOSSARY
 REFERENCES
 

Conception and design: Claudia D. Baldus, Thomas Burmeister, Wolf K. Hofmann

Financial support: Claudia D. Baldus, Eckhard Thiel, Wolf K. Hofmann

Administrative support: Dieter Hoelzer, Eckhard Thiel, Wolf K. Hofmann

Provision of study materials or patients: Thomas Burmeister, Stefan Schwartz, Nicola Gökbuget, Dieter Hoelzer

Collection and assembly of data: Claudia D. Baldus, Thomas Burmeister, Peter Martus, Stefan Schwartz, Nicola Gökbuget, Wolf K. Hofmann

Data analysis and interpretation: Claudia D. Baldus, Peter Martus, Clara D. Bloomfield, Wolf K. Hofmann

Manuscript writing: Claudia D. Baldus, Clara D. Bloomfield, Wolf K. Hofmann

Final approval of manuscript: Claudia D. Baldus, Thomas Burmeister, Peter Martus, Stefan Schwartz, Nicola Gökbuget, Clara D. Bloomfield, Dieter Hoelzer, Eckhard Thiel, Wolf K. Hofmann

 


    GLOSSARY
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Appendix
 Authors' Disclosures of...
 Author Contributions
 GLOSSARY
 REFERENCES
 

ETS transcription factors:
The ETS family of transcription factors, characterized by an evolutionarily conserved DNA-binding domain, regulates expression of more than 300 target genes by binding to a purine-rich GGAA/T core sequence. At present, nearly 30 mammalian family members have been isolated. ETS signal transduction is implicated in hematopoiesis and angiogenesis at the earliest stages of embryogenesis, and is later involved in tissue development. Deregulated expression and/or formation of chimeric fusion proteins of the ETS family due to proviral insertion or chromosome translocation is associated with leukemias and with specific types of solid tumors.

ERG (ETS-related gene):
ERG, located on chromosome 21q22, encodes a transforming proto-oncogene that is expressed in hematopoietic progenitor and endothelial cells. Furthermore, ERG is expressed in early thymocytes and becomes downregulated as cells develop toward the T-cell lineage. ERG and other members of the ETS family are downstream effectors of mitogenic signaling transduction pathways and are involved in key steps regulating cell proliferation, differentiation, and apoptosis.

HOX (homeobox) genes:
The proteins encoded by these genes, the homeodomain proteins, play important roles in the developmental processes. HOX genes encode DNA-binding nuclear transcription factors. The members of the HOX11 gene family are characterized by a threonine-47 replacing cytosine in the highly conserved homeodomain.

Quantitative RT-PCR (real-time polymerase chain reaction):
Quantitative RT-PCR consists of detecting PCR products as they accumulate. It can be applied to gene expressionquantification by reverse transcription of RNA into cDNA, thus receiving the name of quantitative reverse transcriptase polymerase chain reaction. In spite of its name, quantitative, results are usually normalized to an endogenous reference. Current devices allow the simultaneous assessment of many RNA sequences.

Immunophenotyping:
A way to identify cells based on their surface antigens. This assay, applying a panel of different fluorochrome-conjugated antibodies, is used to diagnose specific types of leukemia and lymphoma.


    ACKNOWLEDGMENTS
 
We thank Alexandra Bittroff-Leben, Verena Serbent, Ulrike Baak, Regina Reutzel, and Barbara Komischke for their excellent technical assistance.


    NOTES
 
published online ahead of print at www.jco.org on September 5, 2006.

Supported by grants from the Deutsche Krebshilfe (Max Eder Nachwuchsförderung) and the German Kompetenznetzwerk Akute und chronische Leukämien (C.D. Baldus). The funding sources had no involvement in the study.

Terms in blue are defined in the glossary, found at the end of this article and online at www.jco.org.

Authors’ disclosures of potential conflicts of interest and author contributions are found at the end of this article.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Appendix
 Authors' Disclosures of...
 Author Contributions
 GLOSSARY
 REFERENCES
 
1. Thomas X, Boiron JM, Huguet F, et al: Outcome of treatment in adults with acute lymphoblastic leukemia: Analysis of the LALA-94 trial. J Clin Oncol 22:4075-4086, 2004[Abstract/Free Full Text]

2. Hoelzer D, Goekbuget N, Ottmann O, et al: Acute lymphoblastic leukemia. Am Soc Hematol Educ Program 1:162-192, 2002

3. Goekbuget N, Hoelzer D: Recent approaches in acute lymphoblastic leukemia in adults. Rev Clin Exp Hematol 6:114-141, 2002[CrossRef][Medline]

4. Armstrong SA, Look AT: Molecular genetics of acute lymphoblastic leukemia. J Clin Oncol 23:6306-6315, 2005[Abstract/Free Full Text]

5. Look AT: Oncogenic transcription factors in the human acute leukemias. Science 278:1059-1064, 1997[Abstract/Free Full Text]

6. Soulier J, Clappier E, Cayuela JM, et al: HOXA genes are included in genetic and biologic networks defining human acute T-cell leukemia (T-ALL). Blood 106:274-286, 2005[Abstract/Free Full Text]

7. Ballerini P, Blaise A, Busson-Le Coniat M, et al: HOX11L2 expression defines a clinical subtype of pediatric T-ALL associated with poor prognosis. Blood 100:991-997, 2002[Abstract/Free Full Text]

8. Maroulakou IG, Bowe DB: Expression and function of Ets transcription factors in mammalian development: A regulatory network. Oncogene 19:6432-6442, 2000[CrossRef][Medline]

9. Anderson MK, Hernandez-Hoyos G, Diamond RA, et al: Precise developmental regulation of ETS family transcription factors during specification and commitment to the T cell lineage. Development 126:3131-3148, 1999[Abstract]

10. Kong XT, Ida K, Ichikawa H, et al: Consistent detection of TLS/FUS-ERG chimeric transcripts in acute myeloid leukemia with t(16;21)(p11;q22) and identification of a novel transcript. Blood 90:1192-1199, 1997[Abstract/Free Full Text]

11. Baldus CD, Liyanarachchi S, Mrozek K, et al: Acute myeloid leukemia with complex karyotypes and abnormal chromosome 21: Amplification discloses overexpression of APP, ETS2, and ERG genes. Proc Natl Acad Sci U S A 101:3915-3920, 2004[Abstract/Free Full Text]

12. Marcucci G, Baldus CD, Ruppert AS, et al: Overexpression of the ETS-related gene, ERG, predicts a worse outcome in acute myeloid leukemia with normal karyotype: A Cancer and Leukemia Group B study. J Clin Oncol 23:9234-9242, 2005[Abstract/Free Full Text]

13. Hoelzer D, Arnold R, Buechner T, et al: Characteristics, outcome and risk factors in adult T-lineage acute lymphoblastic leukemia (ALL). Blood 94:659a, 1999 (abstr 2926)

14. Bruggemann M, Raff T, Flohr T, et al: Clinical significance of minimal residual disease quantification in adult patients with standard risk acute lymphoblastic leukemia. Blood 107:1116-1123, 2006[Abstract/Free Full Text]

15. Bene MC, Castoldi G, Knapp W, et al: Proposals for the immunological classification of acute leukemias. Leukemia 9:1783-1786, 1995[Medline]

16. Schwartz S, Rieder H, Schläger B, et al: Expression of the human homologue of rat NG2 in adult acute lymphoblastic leukemia: Close association with MLL rearrangement and a CD10(-)/CD24(-) /CD65s(+)/CD15(+) B-cell phenotype. Leukemia 17:1589-1595, 2003[CrossRef][Medline]

17. Baak U, Goekbuget N, Burmeister T, et al: HOX11L2 genotyping identifies subset of adult thymic T-ALL with inferior outcome. Blood 106:70, 2005 (abstr 228)

18. Marcucci G, Mrozek K, Bloomfield CD: Molecular heterogeneity and prognostic biomarkers in adults with acute myeloid leukemia and normal cytogenetics. Curr Opin Hematol 12:68-75, 2005[CrossRef][Medline]

19. Thiel E, Kranz BR, Raghavachar A, et al: Prethymic phenotype and genotype of pre-T (CD7+/ER-)-cell leukemia and its clinical significance within adult acute lymphoblastic leukemia. Blood 73:1247-1258, 1989[Abstract/Free Full Text]

20. Ferrando AA, Neuberg DS, Staunton J, et al: Gene expression signatures define novel oncogenic pathways in T cell acute lymphoblastic leukemia. Cancer Cell 1:75-87, 2002[CrossRef][Medline]

21. Ferrando AA, Neuberg DS, Dodge RK, et al: Prognostic importance of TLX1 (HOX11) oncogene expression in adults with T-cell acute lymphoblastic leukaemia. Lancet 363:535-536, 2004[CrossRef][Medline]

22. Pear WS, Aster JC: T cell acute lymphoblastic leukemia/lymphoma: A human cancer commonly associated with aberrant NOTCH1 signaling. Curr Opin Hematol 11:426-433, 2004[CrossRef][Medline]

23. Weng AP, Ferrando AA, Lee W, et al: Activating mutations of NOTCH1 in human T cell acute lymphoblastic leukemia. Science 306:269-271, 2004[Abstract/Free Full Text]

24. Asnafi V, Buzyn A, Thomas X, et al: Impact of TCR status and genotype on outcome in adult T-cell acute lymphoblastic leukemia: A LALA-94 study. Blood 105:3072-3078, 2005[Abstract/Free Full Text]

25. Roman-Gomez J, Jimenez-Velasco A, Agirre X, et al: Lack of CpG island methylator phenotype defines a clinical subtype of T-cell acute lymphoblastic leukemia associated with good prognosis. J Clin Oncol 23:7043-7049, 2005[Abstract/Free Full Text]

26. Chiaretti S, Li X, Gentleman R, et al: Gene expression profile of adult T-cell acute lymphocytic leukemia identifies distinct subsets of patients with different response to therapy and survival. Blood 103:2771-2778, 2004[Abstract/Free Full Text]

27. Cave H, Suciu S, Preudhomme C, et al: Clinical significance of HOX11L2 expression linked to t(5;14)(q35;q32), of HOX11 expression, and of SIL-TAL fusion in childhood T-cell malignancies: Results of EORTC studies 58881 and 58951. Blood 103:442-450, 2004[Abstract/Free Full Text]

28. Gottardo NG, Jacoby PA, Sather HN, et al: Significance of HOX11L2/TLX3 expression in children with T-cell acute lymphoblastic leukemia treated on Children’s Cancer Group protocols. Leukemia 19:1705-1708, 2005[CrossRef][Medline]

29. Thomas X, Danaila C, Le QH, et al: Long-term follow-up of patients with newly diagnosed adult acute lymphoblastic leukemia: A single institution experience of 378 consecutive patients over a 21-year period. Leukemia 15:1811-1822, 2001[Medline]

Submitted February 12, 2006; accepted June 12, 2006.




This article has been cited by other articles:


Home page
J. Exp. Med.Home page
E. Flex, V. Petrangeli, L. Stella, S. Chiaretti, T. Hornakova, L. Knoops, C. Ariola, V. Fodale, E. Clappier, F. Paoloni, et al.
Somatically acquired JAK1 mutations in adult acute lymphoblastic leukemia
J. Exp. Med., April 14, 2008; 205(4): 751 - 758.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. Bergeron, E. Clappier, I. Radford, A. Buzyn, C. Millien, G. Soler, P. Ballerini, X. Thomas, J. Soulier, H. Dombret, et al.
Prognostic and oncogenic relevance of TLX1/HOX11 expression level in T-ALLs
Blood, October 1, 2007; 110(7): 2324 - 2330.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
C. D. Baldus, P. Martus, T. Burmeister, S. Schwartz, N. Gokbuget, C. D. Bloomfield, D. Hoelzer, E. Thiel, and W. K. Hofmann
Low ERG and BAALC Expression Identifies a New Subgroup of Adult Acute T-Lymphoblastic Leukemia With a Highly Favorable Outcome
J. Clin. Oncol., August 20, 2007; 25(24): 3739 - 3745.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
G. Marcucci, K. Maharry, S. P. Whitman, T. Vukosavljevic, P. Paschka, C. Langer, K. Mrozek, C. D. Baldus, A. J. Carroll, B. L. Powell, et al.
High Expression Levels of the ETS-Related Gene, ERG, Predict Adverse Outcome and Improve Molecular Risk-Based Classification of Cytogenetically Normal Acute Myeloid Leukemia: A Cancer and Leukemia Group B Study
J. Clin. Oncol., August 1, 2007; 25(22): 3337 - 3343.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Baldus, C. D.
Right arrow Articles by Hofmann, W. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Baldus, C. D.
Right arrow Articles by Hofmann, W. K.

About
JCO
 Editorial
Roster
 Advertising
Information
 Librarians &
Institutions
 Rights &
Permissions
 PDA Services

Copyright © 2006 by the American Society of Clinical Oncology, Online ISSN: 1527-7755. Print ISSN: 0732-183X
Terms and Conditions of Use
  HighWire Press HighWire Press™ assists in the publication of JCO Online