|
|||||
|
|
||||||
Originally published as JCO Early Release 10.1200/JCO.2006.06.1580 on September 5 2006 © 2006 American Society of Clinical Oncology. High Expression of the ETS Transcription Factor ERG Predicts Adverse Outcome in Acute T-Lymphoblastic Leukemia in Adults
From the Department of Hematology, Oncology, and Transfusion Medicine; Department of Biostatistics and Clinical Epidemiology, Charité, Campus Benjamin Franklin Berlin, University Hospital, Berlin; Department of Hematology and Oncology, University of Frankfurt am Main, Frankfurt, Germany; and Ohio State University, Comprehensive Cancer Center, Columbus, OH Address reprint requests to Claudia D. Baldus, MD, Department of Hematology, Oncology and Transfusion Medicine, Charité, Campus Benjamin Franklin, University Hospital Berlin, Hindenburgdamm 30, 12203 Berlin, Germany; e-mail: claudia.baldus{at}charite.de
PURPOSE: In adult T-lymphoblastic leukemia (T-ALL) disease-free survival remains limited to 32% to 46%. The adverse prognosis in T-ALL has not been attributed to cytogenetic or molecular aberrations. We have determined the prognostic impact of the oncogenic transcription factor ERG in T-ALL. PATIENTS AND METHODS: ERG expression was analyzed by real-time polymerase chain reaction (PCR) in 105 adults with newly diagnosed T-ALL treated on the German ALL protocols. Patients were dichotomized at ERG's median expression into low (n = 52) and high (n = 53) expressers. Homeobox (HOX) 11 and HOX11L2 expression was determined by real-time PCR. RESULTS: High ERG expressers compared with low ERG expressers had an inferior overall survival (OS, P = .02; 5-year OS: high ERG 26% v low ERG 58%) and relapse-free survival (RFS, P = .003; 5-year RFS: high ERG 34% v low ERG 72%). On multivariable analysis high ERG expression (P = .005), immunophenotypic subgroups (early v mature v thymic T-ALL; overall P = .04), HOX11L2 positivity (P = .055), and absence of HOX11 (P = .017) were independent adverse risk factors predicting RFS. Patients with high ERG expression had a hazard ratio (HR) for relapse of 3.2. Within the good prognostic subgroup of thymic T-ALL (n = 57), high ERG (HR, 4.1; P = .02) and presence of HOX11L2 (HR, 6.6; P = .008) were independent adverse factors for RFS. CONCLUSION: High expression of ERG is an adverse risk factor in adult T-ALL. Within thymic T-ALL, otherwise classified as standard-risk, high ERG expression-identified patients that were four times more likely to fail long-term RFS. The prognostic impact of ERG may assist treatment stratification and suggest the need of alternative regimens.
Acute T-lymphoblastic leukemia (T-ALL) accounts for 25% of adult ALL. Although the prognosis in T-ALL has improved in recent years as a result of an increased response rate using intensive chemotherapy, long-term disease-free survival remains limited to 32% to 46%.1,2 The varying clinical outcome of T-ALL patients implies the molecular heterogeneity of this disease. However, few molecular markers associated with clinical outcome have been identified.3 The molecular characterization of recurrent chromosomal translocations has provided insights into oncogenic pathways involved in leukemogenesis of T-ALL.4 Genes targeted by chromosomal translocations include oncogenic transcriptions factors as well as signal transduction members resulting in the disruption of normal hematopoietic proliferation and differentiation.5 Developmentally important transcriptions factors (ie, homeobox [HOX] genes) are frequently localized in the vicinity of the T-cell receptor genes resulting in high levels of oncogene expression.4,6 Moreover, it has been shown that even in the absence of chromosomal rearrangements aberrant activation of certain key transcription factor genes is a principal transforming event in ALL and may confer prognostic implications. In particular, ectopic expression of certain HOX genes may be of prognostic significance.7 ETS transcription factors are known to be key players in lineage specific regulation during commitment and differentiation of lymphocytes.8 In particular, the ETS transcription factor ERG has been shown to modulate the maturation of lymphoid cells. In early T-cell development, ERG expression is induced at the time of T-lineage specification and shut off once T-cell commitment is complete. ERG shows specificity to early T- and B-cell lineages as well as myeloid cells.9 In addition, ERG is involved in the rare t(16;21)(p11;q22) in acute myeloid leukemia (AML) leading to the chimeric FUS/ERG gene fusion.10 Furthermore, ERG is overexpressed in the prognostically inferior subgroup of AML with a complex karyotype.11 In AML lacking chromosomal aberrations, it was recently demonstrated that high level ERG expression was associated with an immature phenotype and was an independent risk factor predicting inferior outcome.12 We hypothesized that due to its specific involvement in T-cell development and its oncogenic potential, aberrant expression of ERG might play a role in T-ALL. To test this, we analyzed ERG mRNA expression levels in 105 adult patients with newly diagnosed T-ALL, enrolled on the multicenter treatment protocols of the German Acute Lymphoblastic Leukemia (GMALL) study group. Herein we show that high-level expression of ERG constitutes an independent adverse prognostic factor and identifies T-ALL patients with a high risk of relapse and inferior survival.
Patients and Treatment This study included adult patients with newly diagnosed T-ALL, who enrolled between 1993 and 2000 on the GMALL 05/93 and 06/99 multicenter protocols.13,14 These GMALL protocols included intensive chemotherapy and radiation (online-only Fig A1). For patients enrolled during this time period autologous or allogeneic stem-cell transplantation (SCT) was a treatment option based on physician discretion. All patients gave written informed consent to participate in the study according to the Declaration of Helsinki. This study was approved by the ethics board of the Johann Wolfgang Goethe-Universität Frankfurt am Main, Germany.
Morphological and Immunophenotypic Analyses Immunophenotyping of fresh samples was centrally performed in the GMALL reference laboratory at the Charité, University Hospital Berlin, Germany. Immunophenotyping was carried out using commercially available, fluorochrome-labeled monoclonal antibodies: CD7, CD5, CD2, CD3, CD4, CD8, CD1a, CD56, CD19, CD33, CD13, CD10, HLA-DR, CD117, CD34, and TdT. Immunophenotyping was performed as described using a FACScan and Cell Quest software (Becton Dickinson, Heidelberg, Germany).15,16 Cell-surface antigens were considered positive when 20% or more of cells showed fluorescence intensity, and cytoplasmic/intranuclear staining was considered positive when 10% or more of cells exhibited cytoplasmic/intranuclear fluorescence compared with negative controls. Patients were assigned to the following subtypes according to the European Group for Immunophenotyping of Leukemias classification.15 In this classification T-lineage leukemias were categorized based on the maturation status: pre-T-ALL (cyCD3+, CD7+, CD5, CD2, sCD3, CD4, CD8, CD1a); early T-ALL (cyCD3+, CD7+, CD5+/, CD2+/, sCD3, CD4/+, CD8/+, CD1a); thymic T-ALL (cyCD3+, CD7+, CD5+, CD2+, sCD3+/, CD4+/, CD8+/, CD1a+); and mature T-ALL (cyCD3+, CD7+, CD5+, CD2+, sCD3+, CD4+/, CD8+/, CD1a). The GMALL study group merges the immature subtypes of pre-T-ALL and early T-ALL to form a combined early T-ALL group.
RNA Isolation and Complementary DNA Synthesis
Real-Time Reverse Transcriptase Polymerase Chain Reaction HOX11 and HOX11L2. Real-time RT-PCR was used to determine HOX11 and HOX11L2 expression levels. Patients were classified positive or negative for HOX11 and HOX11L2 based on the presence or absence of amplification of the target genes HOX11 and HOX11L2.17 The following primers and probes were used for HOX11 and HOX11L2: HOX11-F GATGGAGAGTAACCGCAGATACAC, HOX11-R TGCGCGGCTTCTTCTTCTT, HOX11-FAM FAM-AGGACAGGTTCACAGGTCACCCCTATCAGA-BHQ1, and HOX11L2-F CAAGACCTGGTTCCAAAACCG, HOX11L2-R AGGCTGGATGGAGTCGTTGA, and HOX11L2-FAM FAM-CAGCTGCAACACGACGCCTTCCAA-BHQ1. The ABsolute QPCR Mix (ABGene, Hamburg, Germany) containing the hot start enzyme Thermo-Start DNA polymerase was used with the following cycler program: 15 minutes at 95°C, 55 cycles (15 seconds at 95°C, 60 seconds at 60°C), and 10 minutes at 25°C. RNA from the ALL-SIL and HPB-ALL cell lines were used as positive controls.
Statistical Analysis Achievement of complete remission (CR) was assessed after completion of induction chemotherapy and required granulocytes 1,500/µL or higher, platelets 100,000/µL or higher, no peripheral blood blasts, BM cellularity greater than 20% with maturation of all cell lines, less than 5% BM blasts, and no extramedullary leukemia. Primary resistance to chemotherapy was defined as higher than 25% blasts in the BM or persistence of peripheral blood blasts after induction. Relapse was defined as the reappearance of circulating blasts, higher than 5% BM blasts, or development of extramedullary leukemia. Median follow-up for living patients was 59 months (range, 2.4 months to 110 months). After exclusion of 15 patients that received SCT as consolidation treatment, 90 T-ALL patients were included for analyses of overall survival (OS) and 74 for relapse-free survival (RFS). OS was calculated using the Kaplan-Meier method and the log-rank test was used to compare differences between survival curves. OS was measured from the protocol on-study date until the date of death regardless of cause, censoring for patients alive at last follow-up. RFS was defined only for patients who achieved CR, and was measured from the date of attaining CR until the date of relapse, censoring for death in CR (in one patient).
Cox proportional hazards models were constructed for RFS and OS. The following covariates were included in the full model: ERG expression (low v high), presence or absence of HOX11 and HOX11L2 expression, treatment protocol (GMALL 05/93 v GMALL 06/99), sex, white blood count (WBC; < 100,000/µL v
ERG Expression in T-ALL Patients and Association With Clinical and Molecular Features ERG expression was analyzed in pretreatment samples of 105 newly diagnosed T-ALL patients. Low ERG (n = 52) and high ERG (n = 53) were defined as described in the Statistical Methods section. There were no significant differences between patients with low and high ERG expression with respect to sex, pretreatment WBC, age, positivity for HOX11 and HOX11L2 expression, nor immunophenotype (Table 1).
Outcome and Survival in T-ALL Patients With Respect to ERG Expression No difference was seen in the CR rate between the low and the high ERG group. High ERG was associated with a higher relapse rate (46%) compared with patients with low ERG expression (20%; P = .01; Table 1). Patients with high level ERG expression had a significantly shorter OS (P = .02; 5-year OS: high ERG 26% v low ERG 58%) and RFS (P = .003; 5-year RFS: high ERG 34% v low ERG 72%; Table 2, Fig 1). On multivariable analysis, high expression of ERG was of independent adverse prognostic significance for RFS with a hazard ratio (HR) of 3.2 (95% CI, 1.4 to 7.3; P = .005). Significant adverse cofactors included the immunophenotype with inferior outcome for patients with early and mature T-ALL compared with thymic T-ALL, as well as absence of HOX11 and positivity of HOX11L2 (Table 3). In the multivariable analysis for OS the only factor in the final model predicting outcome was the immunophenotype (P < .001).
ERG Expression and Survival in Thymic Differentiated T-ALL As reported previously,13 T-ALL patients with an early or mature immunophenotype showed an adverse outcome compared with patients with thymic differentiated CD1a positive T-ALL (Fig 2). ERG expression levels (when used as a continuous variable) were significantly correlated with the immunophenotype (overall P value, P = .038; Table 1) with higher expression levels in early compared with thymic (P = .01) and to mature T-ALL (P = .18).
Due to the difference in outcome among immunophenotypic subgroups and the association between ERG expression levels and immunophenotypic subgroups, we analyzed the prognostic relevance of ERG within these three T-ALL subgroups. There was no difference in OS or RFS between high and low ERG expressers within the small subgroups of early (n = 21) and mature T-ALL (n = 23; data not shown). Within the largest subgroup, thymic T-ALL patients (n = 61), 34 patients were classified as low ERG expressers and 27 patients were classified as high ERG expressers. There were no significant differences in age, WBC, HOX11 or HOX11L2 expression between these two groups. For patients with thymic T-ALL high ERG expression was associated with a significantly higher relapse rate (42% v 13%; P = .03; Table 4). Among 57 patients included in the survival analyses, high ERG expression resulted in a shorter OS (P = .48; 5-year OS: high ERG, 35% v low ERG, 72%) and inferior RFS with a 5-year RFS of 46% for patients with high versus 82% for patients with low ERG expression (P = .01; Table 4, Fig 3). When the analysis was restricted to HOX11L2 negative patients ERG expression remained a significant prognostic factor (OS P = .04; RFS P = .02). In the multivariable analyses including all thymic T-ALL patients, patients with high ERG expression were four times more likely to relapse than those with low ERG expression (HR, 4.1; 95% CI, 1.2 to 13.7; P = .02; Table 5). The only other significant factor predictive for inferior RFS was HOX11L2 positivity. For OS HOX11L2 positivity was the only significant risk factor predicting inferior survival in thymic T-ALL with a HR for death of 3.6 (95% CI, 1.1 to 11.3; P = .03); high ERG expression was also in included in the final model, but failed to be of statistical significance (HR, 2.3; 95% CI, 0.9 to 5.9; P = .08).
The distinct expression of the ETS transcription factor ERG during normal T-cell development as well as its oncogenic potential prompted us to determine the prognostic impact of ERG expression in T-ALL. Studies in normal hematopoiesis have examined the regulation of ERG and shown a marked upregulation of ERG in early T-cell precursors at the time of specification to the T-lineage and silencing just after T-lineage commitment.9 However, no studies have previously investigated the role of ERG expression in lymphoblastic leukemia. In patients with AML with normal cytogenetics high expression levels of ERG were recently reported to be predictive for inferior outcome.12 We now have explored the prognostic impact of ERG expression levels in adult patients diagnosed with T-ALL and show for the first time that high mRNA expression of ERG is an independent risk factor in T-ALL predicting inferior RFS. The prognosis of T-ALL in adults remains limited with 5-year survival rates of 32% to 46%. In B-lineage ALL and myeloid leukemia, the prognosis can be attributed to specific cytogenetic or molecular aberrations.3,18 Cellular and molecular aberrations have been identified by immunophenotypic analyses and by molecular genetic techniques such as RT-PCR, global gene expression, direct sequencing, and analyses of epigenetic changes.19-26 However, only a few abnormalities have recently proven to be of prognostic significance in adult T-ALL.19-21,23,25 The most relevant molecular risk factors include the transcription factors HOX11 and HOX11L2, which belong to developmentally important genes that when aberrantly expressed promote malignant transformation. Their prognostic relevance however, in both childhood and in adult T-ALL, is controversial. In childhood T-ALL, HOX11 expression was associated with favorable outcome, most likely reflecting an arrest of the leukemic cells at an early cortical stage of T-cell maturation.20,27 Another study however, showed no difference in survival according to the HOX11 status.28 Differences in prognosis have also been observed with respect to HOX11L2, which was associated with favorable28 as well as inferior outcome in different studies.7 In adult T-ALL the prognostic relevance of HOX11 is also controversial, showing superior outcome for patients expressing HOX1121 as well as no difference in outcome with respect to the HOX11 status.4,17,24 Overexpression of HOX11L2 has been associated with inferior outcome in various studies.4,17,24 The identification of molecular risk factors is needed to guide treatment stratification in future trials. Genes of the ETS transcription factor family are involved in signal transduction pathways that regulate and promote cell differentiation, proliferation, and tissue invasion. Dysregulation of such genes may have significant impact on normal cell growth. While our data suggest that expression of ERG is a potential risk factor and may guide treatment stratification in adult T-ALL, the molecular mechanism of aberrant ERG expression contributing to leukemogenesis is unknown. In normal T-cell development, ERG expression is downregulated at initiation of T-cell commitment. In adult T-ALL higher ERG expression levels were found in the immature subtype of early T-ALL resembling the physiological expression pattern of normal T-cell development. A similar finding was observed in AML, where high expression of ERG was significantly correlated with the immature subtypes.12 We propose that aberrant overexpression of ERG in thymic differentiated T-ALL may specify a hitherto obscured molecular immature cell origin. High level expression in the more immature subtypes of T-ALL and aberrant overexpression of ERG in thymic differentiated T-ALL may be responsible for more aggressive disease resulting in an adverse outcome. In our study overexpression of ERG in patients within thymic differentiated CD1a positive T-ALLcurrently regarded as a standard risk groupemerged as an independent adverse factor for RFS. In this study, we have for the first time identified high ERG expression as an independent adverse prognostic factor in adult patients with T-ALL. In addition, we have characterized the presence of HOX11L2 as an adverse risk factor and confirmed the adverse impact of the absence of HOX11 expression.21 Moreover, within the largest immunophenotypic subgroup, thymic T-ALL, high ERG expression, and positivity of HOX11L2 independently identified patients that were at high risk to fail to achieve long-term RFS. These analyses in thymic T-ALL are based on small numbers and a prospective trial will be necessary to confirm these results. However, the fact that HOX11L2 and ERG expression independently impact the clinical course suggests the involvement of different molecular pathways in T-ALL. Importantly, high ERG expression identified high-risk patients within the relatively good prognostic group of thymic T-ALL with an inferior outcome (projected OS at 5 years, 35%) similar to patients with mature T-ALL (5 years OS, 27%). These high-risk patients characterized by a high CR rate and a high relapse rate might benefit from alternative consolidation regimens including SCT. Encouraging results of allogeneic SCT in first CR in T-ALL have already been reported with a RFS of 74% at 3 years.29 In contrast, low ERG expression was predictive for favorable outcome with 82% of thymic T-ALL patients remaining relapse-free at 5 years, thus identifying patients for whom more intensive consolidation regimens may become unnecessary. Increasing understanding about the molecular aberrations in leukemogenesis allows treatment optimization for patients with leukemia. Prognostically relevant molecular markers can guide risk-adapted treatment strategies and will also be the basis for the development of new targeted therapies. In this perspective, insights into the transcriptional regulation of ERG and its oncogenic pathways, as well as the prognostic relevance of ERG, emerge as critical steps for treatment stratification and the design of novel therapeutic approaches. If further prospective studies confirm our results ERG expression may routinely serve as a risk factor for treatment stratification in adult T-ALL.
The authors indicated no potential conflicts of interest.
We thank Alexandra Bittroff-Leben, Verena Serbent, Ulrike Baak, Regina Reutzel, and Barbara Komischke for their excellent technical assistance.
published online ahead of print at www.jco.org on September 5, 2006. Supported by grants from the Deutsche Krebshilfe (Max Eder Nachwuchsförderung) and the German Kompetenznetzwerk Akute und chronische Leukämien (C.D. Baldus). The funding sources had no involvement in the study. Terms in blue are defined in the glossary, found at the end of this article and online at www.jco.org. Authors disclosures of potential conflicts of interest and author contributions are found at the end of this article.
1. Thomas X, Boiron JM, Huguet F, et al: Outcome of treatment in adults with acute lymphoblastic leukemia: Analysis of the LALA-94 trial. J Clin Oncol 22:4075-4086, 2004 2. Hoelzer D, Goekbuget N, Ottmann O, et al: Acute lymphoblastic leukemia. Am Soc Hematol Educ Program 1:162-192, 2002 3. Goekbuget N, Hoelzer D: Recent approaches in acute lymphoblastic leukemia in adults. Rev Clin Exp Hematol 6:114-141, 2002[CrossRef][Medline] 4. Armstrong SA, Look AT: Molecular genetics of acute lymphoblastic leukemia. J Clin Oncol 23:6306-6315, 2005 5. Look AT: Oncogenic transcription factors in the human acute leukemias. Science 278:1059-1064, 1997 6. Soulier J, Clappier E, Cayuela JM, et al: HOXA genes are included in genetic and biologic networks defining human acute T-cell leukemia (T-ALL). Blood 106:274-286, 2005 7. Ballerini P, Blaise A, Busson-Le Coniat M, et al: HOX11L2 expression defines a clinical subtype of pediatric T-ALL associated with poor prognosis. Blood 100:991-997, 2002 8. Maroulakou IG, Bowe DB: Expression and function of Ets transcription factors in mammalian development: A regulatory network. Oncogene 19:6432-6442, 2000[CrossRef][Medline] 9. Anderson MK, Hernandez-Hoyos G, Diamond RA, et al: Precise developmental regulation of ETS family transcription factors during specification and commitment to the T cell lineage. Development 126:3131-3148, 1999[Abstract] 10. Kong XT, Ida K, Ichikawa H, et al: Consistent detection of TLS/FUS-ERG chimeric transcripts in acute myeloid leukemia with t(16;21)(p11;q22) and identification of a novel transcript. Blood 90:1192-1199, 1997 11. Baldus CD, Liyanarachchi S, Mrozek K, et al: Acute myeloid leukemia with complex karyotypes and abnormal chromosome 21: Amplification discloses overexpression of APP, ETS2, and ERG genes. Proc Natl Acad Sci U S A 101:3915-3920, 2004 12. Marcucci G, Baldus CD, Ruppert AS, et al: Overexpression of the ETS-related gene, ERG, predicts a worse outcome in acute myeloid leukemia with normal karyotype: A Cancer and Leukemia Group B study. J Clin Oncol 23:9234-9242, 2005 13. Hoelzer D, Arnold R, Buechner T, et al: Characteristics, outcome and risk factors in adult T-lineage acute lymphoblastic leukemia (ALL). Blood 94:659a, 1999 (abstr 2926) 14. Bruggemann M, Raff T, Flohr T, et al: Clinical significance of minimal residual disease quantification in adult patients with standard risk acute lymphoblastic leukemia. Blood 107:1116-1123, 2006 15. Bene MC, Castoldi G, Knapp W, et al: Proposals for the immunological classification of acute leukemias. Leukemia 9:1783-1786, 1995[Medline] 16. Schwartz S, Rieder H, Schläger B, et al: Expression of the human homologue of rat NG2 in adult acute lymphoblastic leukemia: Close association with MLL rearrangement and a CD10(-)/CD24(-) /CD65s(+)/CD15(+) B-cell phenotype. Leukemia 17:1589-1595, 2003[CrossRef][Medline] 17. Baak U, Goekbuget N, Burmeister T, et al: HOX11L2 genotyping identifies subset of adult thymic T-ALL with inferior outcome. Blood 106:70, 2005 (abstr 228) 18. Marcucci G, Mrozek K, Bloomfield CD: Molecular heterogeneity and prognostic biomarkers in adults with acute myeloid leukemia and normal cytogenetics. Curr Opin Hematol 12:68-75, 2005[CrossRef][Medline] 19. Thiel E, Kranz BR, Raghavachar A, et al: Prethymic phenotype and genotype of pre-T (CD7+/ER-)-cell leukemia and its clinical significance within adult acute lymphoblastic leukemia. Blood 73:1247-1258, 1989 20. Ferrando AA, Neuberg DS, Staunton J, et al: Gene expression signatures define novel oncogenic pathways in T cell acute lymphoblastic leukemia. Cancer Cell 1:75-87, 2002[CrossRef][Medline] 21. Ferrando AA, Neuberg DS, Dodge RK, et al: Prognostic importance of TLX1 (HOX11) oncogene expression in adults with T-cell acute lymphoblastic leukaemia. Lancet 363:535-536, 2004[CrossRef][Medline] 22. Pear WS, Aster JC: T cell acute lymphoblastic leukemia/lymphoma: A human cancer commonly associated with aberrant NOTCH1 signaling. Curr Opin Hematol 11:426-433, 2004[CrossRef][Medline] 23. Weng AP, Ferrando AA, Lee W, et al: Activating mutations of NOTCH1 in human T cell acute lymphoblastic leukemia. Science 306:269-271, 2004 24. Asnafi V, Buzyn A, Thomas X, et al: Impact of TCR status and genotype on outcome in adult T-cell acute lymphoblastic leukemia: A LALA-94 study. Blood 105:3072-3078, 2005 25. Roman-Gomez J, Jimenez-Velasco A, Agirre X, et al: Lack of CpG island methylator phenotype defines a clinical subtype of T-cell acute lymphoblastic leukemia associated with good prognosis. J Clin Oncol 23:7043-7049, 2005 26. Chiaretti S, Li X, Gentleman R, et al: Gene expression profile of adult T-cell acute lymphocytic leukemia identifies distinct subsets of patients with different response to therapy and survival. Blood 103:2771-2778, 2004 27. Cave H, Suciu S, Preudhomme C, et al: Clinical significance of HOX11L2 expression linked to t(5;14)(q35;q32), of HOX11 expression, and of SIL-TAL fusion in childhood T-cell malignancies: Results of EORTC studies 58881 and 58951. Blood 103:442-450, 2004 28. Gottardo NG, Jacoby PA, Sather HN, et al: Significance of HOX11L2/TLX3 expression in children with T-cell acute lymphoblastic leukemia treated on Childrens Cancer Group protocols. Leukemia 19:1705-1708, 2005[CrossRef][Medline] 29. Thomas X, Danaila C, Le QH, et al: Long-term follow-up of patients with newly diagnosed adult acute lymphoblastic leukemia: A single institution experience of 378 consecutive patients over a 21-year period. Leukemia 15:1811-1822, 2001[Medline] Submitted February 12, 2006; accepted June 12, 2006. This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|||||||||||
|
Copyright © 2006 by the American Society of Clinical Oncology, Online ISSN: 1527-7755. Print ISSN: 0732-183X
|