Advertisement
Journal of Clinical Oncology  
Search for:
Limit by:
  Browse by Subject or Issue
Home Search or Browse JCO My JCO Subscriptions Customer Service Site Map

Originally published as JCO Early Release 10.1200/JCO.2005.01.6253 on January 17 2006

Journal of Clinical Oncology, Vol 24, No 5 (February 10), 2006: pp. 790-797
© 2006 American Society of Clinical Oncology.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Baldus, C. D.
Right arrow Articles by Ehninger, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Baldus, C. D.
Right arrow Articles by Ehninger, G.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

BAALC Expression and FLT3 Internal Tandem Duplication Mutations in Acute Myeloid Leukemia Patients With Normal Cytogenetics: Prognostic Implications

Claudia D. Baldus, Christian Thiede, Silke Soucek, Clara D. Bloomfield, Eckhard Thiel, Gerhard Ehninger

From the Charité, Universitätsmedizin Berlin, Campus Benjamin Franklin, Medizinische Klinik III, Berlin; Universitätsklinikum Carl Gustav Carus, Technische Universität Dresden, Medizinische Klinik I; Universitätsklinikum Carl Gustav Carus, Technische Universität Dresden, Deutsche Studieninitiative Leukämie Statistical Group, Dresden, Germany; and The Ohio State University, Comprehensive Cancer Center, Columbus, OH

Address reprint requests to Claudia D. Baldus, MD, Charité, Universitätsmedizin Berlin, Campus Benjamin Franklin, Department of Hematology, Oncology and Transfusion Medicine, Hindenburgdamm 30, 12203 Berlin, Germany; e-mail: claudia.baldus{at}charite.de


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Appendix
 Authors' Disclosures of...
 Author Contributions
 GLOSSARY
 REFERENCES
 
PURPOSE: Evaluate the impact of BAALC (brain and acute leukemia, cytoplasmic), a gene whose expression has been associated with adverse outcome in acute myeloid leukemia (AML) with normal cytogenetics, and FLT3 internal tandem duplication (ITD) mutations as independent prognostic factors in a larger study.

PATIENTS AND METHODS: BAALC expression was determined by real-time reverse transcriptase polymerase chain reaction in pretreatment blood samples of 307 adults ≤ 60 years of age with AML with normal cytogenetics. Patients were dichotomized at BAALC's median expression into low and high expressers. The FLT3 ITD mutant:wild-type ratio was determined by fragment analysis.

RESULTS: Compared with low-BAALC patients, high-BAALC patients had a higher rate of primary resistant leukemia (16% v 6%; P = .006). High BAALC expression was associated with a higher cumulative incidence of relapse (CIR; P = .018) and an inferior overall survival (OS; 3-year OS, 36% v 54%; P = .001). On multivariable analysis, high BAALC was independently predictive of resistant disease (P = .019), and high BAALC as well as a high FLT3 mutant:wild-type ratio were confirmed as the only factors predicting a high CIR (BAALC, P = .03; FLT3, P = .01) and inferior OS (BAALC, P = .001; FLT3, P = .012).

CONCLUSION: This study strengthens BAALC expression as one of the most important prognostic factors in AML patients with normal cytogenetics. BAALC expression and FLT3 mutation status should assist in tailoring induction and postremission therapies.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Appendix
 Authors' Disclosures of...
 Author Contributions
 GLOSSARY
 REFERENCES
 
Acute myeloid leukemia (AML) is a clinically and molecularly heterogeneous disease. Currently, cytogenetic findings provide the most important prognostic information.1,2 Approximately half of adult AML patients lack clonal chromosome aberrations at diagnosis, and although this group has an intermediate prognosi,s only 40% are long-term survivors. The identification of molecular markers that precisely differentiate a patient's risk could improve treatment outcome by the use of sophisticated risk adaptive treatment strategies.3,4

Genes involved in signal transduction have been the focus of molecular analyses. Mutations in the fms-like tyrosine kinase 3 (FLT3) receptor, most commonly an internal tandem duplication (ITD), are frequent in AML.5-8 Several studies have shown that overrepresentation of the ITD relative to the wild-type FLT3 allele is especially predictive of an adverse outcome.9-11

BAALC (brain and acute leukemia, cytoplasmic) is a gene implicated in normal hematopoiesis and leukemia.12 The gene, located at chromosome 8q22.3, encodes a protein of yet-unknown function. In hematopoiesis, BAALC reflects a stage-specific marker and is aberrantly expressed in a subset of acute leukemias.13 High mRNA expression levels of BAALC have been shown to be an adverse risk factor in newly diagnosed AML patients with normal cytogenetics. The first study to show this included 86 de novo AML patients younger than 60 years with a more favorable FLT3 mutation status treated on Cancer and Leukemia Group B (CALGB) protocol 9621.14

Independent confirmation is required to validate the initial results so that BAALC expression may be exploited for risk-adapted treatment stratification of AML patients with normal cytogenetics. Here we present the results of a Deutsche Studieninitiative Leukämie (DSIL) study comprising 307 adult AML patients ≤ 60 years with normal cytogenetics treated on the AML'96 protocol. In contrast to the CALGB study, our study includes patients diagnosed with secondary AML (sAML), and patients with a high-risk FLT3 mutation status, thus allowing a more comprehensive characterization of the patient's risk profile.


    PATIENTS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Appendix
 Authors' Disclosures of...
 Author Contributions
 GLOSSARY
 REFERENCES
 
Patients
We studied 307 patients treated on AML'96.15 Two hundred seventy-eight had de novo AML, and 29 had sAML, including 24 patients with a prior myelodysplastic syndrome (MDS) and five with therapy-related AML (tAML).

Treatment
The treatment schema is summarized in Supplementary Figure A1 (online only). Patients received two cycles of induction therapy. Postinduction therapy was stratified for adults ≤ 60 years according to cytogenetic risk group. For patients with de novo AML and normal cytogenetics, those having a human leukocyte antigen–identical sibling donor were referred for allogeneic stem-cell transplantation (SCT). Those without a sibling donor were randomly assigned to receive intermediate dose cytarabine (ara-C; 1,000 mg/m2 every 12 hours, days 1 through 6; I-MAC) or high-dose ara-C (3,000 mg/m2 every 12 hours, days 1 through 6) plus mitoxantrone (10 mg/m2 days 4 to 6; H-MAC) and both of these were followed by autologous peripheral blood (PB) SCT. Patients not eligible for allogeneic or autologous SCT were randomly assigned to receive I-MAC or H-MAC followed by one consolidation cycle. Patients with sAML who were younger than 45 years were referred for unrelated-donor SCT. The Technical University Dresden ethics board approved this study. All patients gave written informed consent according to the Declaration of Helsinki.

Patient Samples
Of 473 adult AML patients ≤ 60 years with normal cytogenetics enrolled onto AML'96, 307 had diagnostic PB samples stored in the DSIL tissue bank. There was no significant difference in percentage of PB blasts between the 307 available samples and the remaining 166 (P = .67). Pathologic diagnoses were reviewed centrally and classified according to the French-American-British (FAB) schema. Pretreatment cytogenetic analyses of bone marrow (BM) or PB were performed in institutional cytogenetics laboratories, and karyotypes were reviewed centrally. Patients were classified as having normal cytogenetics on the basis of analysis of BM or PB metaphases; in most cases 20 metaphases were assessable.16

When possible, patients had a centrally determined pretreatment BM FLT3 and MLL genotype.8 Of the 307 patients analyzed for BAALC expression, 268 had sufficient material for FLT3 mutation studies and 179 for analysis of the MLL partial tandem duplication (PTD).

FLT3 and MLL Studies
The FLT3 genotype was determined as previously described.11 Polymerase chain reaction (PCR) for exons 14 and 15 was performed on genomic DNA using published primer molecules. For Genescan analysis of the FLT3 mutant:wild-type ratio (FLT3 ratio) PCR primer FLT3 14F was labeled with 6-FAM (TIB MOLBIOL, Berlin, Germany). Analysis of the MLL gene PTD has been published.8 Reverse transcriptase (RT-) PCR assays were used to amplify the mutant MLL transcript. Confirmation was performed by DNA sequencing and for selected samples by Southern Blot analysis.

BAALC Determination
Total RNA was isolated using the RNAzol B kit (Biozol, Munich, Germany), and complementary DNA (cDNA) synthesized using 1 µg of total RNA. Comparative real-time RT-PCR assays were performed as described with slight modifications.14 Each sample was analyzed in duplicate. Glucose-phosphate isomerase (GPI) and BAALC were coamplified in the same tube using 1 µL cDNA, 1x master mix (IQ Mix; BioRad, Munich, Germany), GPI probe (5'-HEX-TTCAGCTTGACCCTCAACACCAAC-TAMRA) with GPI forward (5'TCTTCGATGCCAACAAGGAC) and reverse (5'GCATCACGTCCTCCGTCAC) primers, and BAALC probe (5'-FAM-CTCTTTTAGCCTCTGTGGTCTGAAGGCCAT-TAMRA) with BAALC forward (5'GCCCTCTGACCCAGAAACAG) and reverse (5'CTTTTGCAGGCATTCTCTTAGCA) primers. Reactions were performed using the Rotor Gene Real-Time PCR 3000 Machine (Corbett Research, Uppsala, Sweden). The comparative cycle threshold (CT) method was used to determine the relative expression levels of BAALC, and the cycle number difference ({Delta}CT = GPIBAALC) was calculated for each replicate. Relative BAALC expression values were calculated using the mean of {Delta}CT from the two replicates, that is µ({Delta}CT) = ({Sigma}{Delta}CT)/2, and expressed as 2µ({Delta}CT). For samples without detectable BAALC amplification within 60 cycles, BAALC expression values were set at 0 (n = 74). A calibrator (RNA from the cell line KG1a) included in each run was used for standardization between runs. Positive and negative controls were included in all assays.

Statistical Analysis
Baseline clinical features across groups were compared using the {chi}2 or a two-sided Fisher's exact test for categoric and the nonparametric Mann-Whitney U test for continuous variables. A P value less than .05 was considered significant.

Achievement of complete remission (CR) was assessed after completion of the second induction cycle and required granulocytes ≥ 1,500/µL, platelets ≥ 100,000/µL, no PB blasts, BM cellularity more than 20% with maturation of all cell lines, no Auer rods, less than 5% BM blasts, and no extramedullary leukemia. Primary resistance to chemotherapy was defined as more than 25% blasts in the BM, lack of regeneration of normal hematopoiesis, persistence of PB blasts, or extramedullary leukemia after induction. Relapse was defined as the reappearance of circulating blasts, more than 10% BM blasts, more than 20% blasts and promyelocytes in two consecutive BM aspirates within 14 days, or development of extramedullary leukemia.

Overall survival (OS) including all 307 patients was calculated using the Kaplan-Meier method, and the log-rank test was used to compare differences between survival curves.17 OS was measured from the protocol on-study date until the date of death regardless of cause, censoring for patients alive at last follow-up. Cumulative incidence of relapse (CIR) was defined for only those patients achieving a CR (n = 208; Supplementary Figure A2, online only). It was measured from the CR date until date of relapse, death or date last known alive, where death during CR was considered a competing risk. Median follow-up for patients alive was 29 months (range, one to 85 months). Estimates of CIR were calculated, and the differences among groups determined by Gray's k-sample test.18

BAALC expression values failed to satisfy the proportional hazards assumption; therefore, BAALC was dichotomized at its median with patients classified as low BAALC if they had expression values within the lower 50% and as high BAALC if they had BAALC expression values within the upper 50%. When patients were grouped into quartiles according to BAALC expression, differences between the first and second (OS, P = .8), and the third and fourth quartile (OS, P = 1.0) were not statistically significant. In contrast, comparing the first or second to the third or fourth quartiles, Kaplan-Meier analyses detected significantly inferior outcomes of the latter, supporting the use of the median for categorizing BAALC expression into low and high risk (Supplementary Figure A3, online only).

Logistical regression models were constructed for CR and primary resistance, Cox proportional hazards models for OS, and a multivariable model using Gray's method was constructed for CIR. All covariates whose univariate models reflected a P value less than .2 from the likelihood ratio test were considered for inclusion in the model. Stepwise forward selection was performed and the model-building process was stopped once the addition of variables was no longer significant at {alpha} = .05. Calculations were performed using SPSS software package, version 12 (SPSS Inc, Chicago, IL), and CIR was calculated using Gray's algorithm (http://biowww.dfci.harvard.edu/~gray/) and S-PLUS software, version 6.2 (Insightful AG, Reinach, Switzerland).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Appendix
 Authors' Disclosures of...
 Author Contributions
 GLOSSARY
 REFERENCES
 
BAALC Expression and Clinical Features
There were no significant differences between patients with low and high BAALC expression in pretreatment age, sex, WBC, percentage of BM blasts, or history of MDS/tAML (Table 1). High-BAALC patients presented with a higher percentage of blood blasts (P = .004). High BAALC expression was associated with the more immature FAB subtypes M0/M1 (P = .001; Table 1), whereas the monocytic differentiated FAB M5b correlated with low BAALC expression (P = .001). Gingival hyperplasia was more frequent in low-BAALC patients (P = .003).


View this table:
[in this window]
[in a new window]
 
Table 1. Presenting Characteristics by BAALC Expression Group

 
BAALC Expression and FLT3 and MLL Mutation Status
The 268 patients evaluated for FLT3 ITD mutations were divided into three groups: FLT3 wild type (ITD negative; n = 197), low FLT3 ratio (ie, ITD:wild-type ratio ≤ 0.8; n = 38) and high FLT3 ratio (ie, ITD:wild-type ratio > 0.8; n = 33). The FLT3 ratio cutoff of 0.8 was based on a previous study, in which AML'96 protocol patients were dichotomized at the median.11 In this study, the median FLT3 ratio was also 0.8. High-BAALC patients had a higher FLT3 ratio (P = .01; Table 1). There was no significant difference between low and high BAALC expressers in MLL PTD frequency (Table 1).

BAALC Expression and Achievement of CR
High BAALC expressers less often achieved CR than low BAALC expressers (62% v 73%; P = .038) and more often had primary resistant disease (16% v 6%; P = .006; Table 2). On multivariable analysis, neither BAALC expression nor the FLT3 ratio were independent factors for achievement of CR, but BAALC predicted primary resistance with an odds ratio of 2.8 for high-BAALC patients (P = .019; Table 3).


View this table:
[in this window]
[in a new window]
 
Table 2. Impact of BAALC Expression on Clinical Outcome

 

View this table:
[in this window]
[in a new window]
 
Table 3. Multivariable Analysis of BAALC Expression for Primary Resistance, CIR, and OS

 
BAALC Expression and Relapse
High-BAALC patients relapsed more frequently (43% v 29%;P = .042; Table 2) and had a higher CIR than low BAALC patients (3-year CIR: 50% v 32%; P = .018; Fig 1A; Table 2). Multivariable analysis found high BAALC expression (P = .03) and high FLT3 ratio (P = .01) as the only independent risk factors predicting a high CIR (Table 3).


Figure 1
View larger version (19K):
[in this window]
[in a new window]
 
Fig 1. Kaplan and Meier analysis of (A) cumulative incidence of relapse and (B) overall survival showing a significantly inferior outcome for patients with high BAALC expression compared with patients with low BAALC expression.

 
BAALC Expression and Survival
High BAALC expression predicted shorter OS (3-year OS, 36% v 54%; P = .001; Fig 1B). Multivariable analysis established high BAALC expression and high FLT3 ratio as independent risk factors for inferior survival. They were the only adverse risk factors for OS with a hazard ratio of death of 1.9 for high BAALC expressers (95% CI, 1.3 to 2.9; P = .001; Table 3).

BAALC and FLT3 Subgroups
We evaluated the impact of BAALC in conjunction with FLT3 mutation status. In multivariable analysis, the FLT3 ITD mutation status without quantitative determination for the mutated and wild-type allele was an independent prognostic factor predicting a higher CIR (P = .012), but not inferior OS. When the FLT3 mutation status was quantified by Genescan analysis, patients with a high FLT3 ratio (> 0.8) had an inferior outcome with a higher CIR (P < .0001) and inferior OS (P < .0001) compared with patients with FLT3 wild type or a low FLT3 ratio (≤ 0.8). Therefore, we defined patients with either FLT3 wild type or a low FLT3 ratio (≤ 0.8) as low-risk FLT3, and patients with a high FLT3 ratio as high-risk FLT3.

On the basis of BAALC expression and FLT3 risk status, we identified four subgroups: (I) BAALC low/FLT3 low risk (n = 125), (II) BAALC high/FLT3 low risk (n = 110), (III) BAALC low/FLT3 high risk (n = 12), and (IV) BAALC high/FLT3 high risk (n = 21). Low-risk FLT3 mutation status and low BAALC expression identified patients with the best outcome. An escalating risk for high CIR and inferior OS was noted for the groups as follows: low BAALC expression with low-risk FLT3, high BAALC expression with low-risk FLT3; low BAALC expression with high-risk FLT3; high BAALC expression with high-risk FLT3 (Table 4; Fig 2).


View this table:
[in this window]
[in a new window]
 
Table 4. BAALC Expression and FLT3 Risk Groups (N = 268)

 

Figure 2
View larger version (16K):
[in this window]
[in a new window]
 
Fig 2. Outcome with respect to BAALC expression and FLT3 mutation status. Overall survival: group I, BAALC low/FLT3 low risk; group II, BAALC high/FLT3 low risk; group III, BAALC low/FLT3 high risk; group IV, BAALC high/FLT3 high risk. P value represents overall P values across the four groups.

 
BAALC Expression and Treatment
To assess the impact of consolidation, we restricted the analysis to patients receiving postremission therapy on protocol. Of the 208 patients achieving CR, 127 received the assigned postremission therapy (ie, 21 chemotherapy, 58 autologous SCT, and 48 allogeneic SCT). The kind of postremission treatment did not influence OS (P = .59). Compared with patients undergoing allogeneic SCT, patients receiving autologous SCT or chemotherapy had a higher CIR (P = .005 and P = .056 respectively; data not shown). High-BAALC patients for unknown reasons more frequently received allogeneic SCT (n = 26) than chemotherapy (n = 3; P = .014); there was no significant difference in the frequency of autologous SCT between high and low BAALC expressers. No significant differences were observed for known risk factors (eg, age, FLT3 status, sAML, WBC) for patients undergoing autologous versus allogeneic SCT.

For high BAALC patients undergoing allogeneic SCT (n = 26), a low CIR (3-year CIR, 16%) was observed compared with high-BAALC patients receiving autologous SCT (n = 22; 52%; P = .007; Fig 3A). In addition, high-BAALC patients undergoing allogeneic SCT had a similarly low CIR as low-BAALC (n = 22) patients (3-year CIR, 16% v 14%; P = .86; Fig 3B).


Figure 3
View larger version (17K):
[in this window]
[in a new window]
 
Fig 3. Consolidation treatment and BAALC expression. (A) Cumulative incidence of relapse (CIR) for patients with high BAALC expression receiving autologous (auto) stem-cell transplantation (SCT) or allogeneic (allo) SCT as consolidation therapy within the Deutsche Studieninitiative Leukämie AML'96 protocol. (B) CIR for patients with high and low BAALC expression receiving allo SCT as consolidation therapy.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Appendix
 Authors' Disclosures of...
 Author Contributions
 GLOSSARY
 REFERENCES
 
This large study of 307 AML patients enrolled onto DSIL AML'96 confirms and further defines the independent adverse prognostic significance of BAALC expression in AML patients with normal cytogenetics. The initial study identifying BAALC as a prognostic marker included 86 patients with normal cytogenetics and a more favorable FLT3 mutation status enrolled onto CALGB 9621.14 Our results are in good agreement with the previous report, showing a similar OS for low-BAALC patients (3-year OS: DSIL AML'96, 54%; CALGB 9621, 60%) and a significantly inferior OS (and event-free survival; data not shown) for high-BAALC patients (DSIL AML'96, 36%; CALGB 9621, 39%).

To compare the two studies, we applied the same approach, utilizing pretreatment blood samples for the expression analyses. BAALC expression can be detected in total normal marrow,13 but not in normal blood. The higher BAALC expression levels in marrow from healthy donors are a result of the presence of normal CD34+ progenitor cells that physiologically express BAALC. Blood was studied in AML to avoid contaminating cells with physiologic BAALC expression. Another group, however, recently reported a strong correlation between BAALC expression levels in blood and marrow samples from AML patients.19

Although high BAALC expression was associated with a higher percentage of circulating blasts, and both variables were associated with outcome in the univariate analysis, in multivariable analyses only BAALC expression was identified as a significant independent prognostic factor.

Various molecular markers and global gene expression profiling have been investigated to improve risk profile characterization of AML patients with normal cytogenetics.3,20-23 To date the most common and clinically important molecular defects are FLT3 ITD mutations; these are detected in 25% to 30% of cytogenetically normal AML and associated with inferior outcome.9,24 Clinical trials are now evaluating the efficacy of targeting FLT3 by specific inhibitors.25,26 We have demonstrated that high BAALC is significantly associated with a higher FLT3 ratio. For most AML patients (ie, those with a low risk FLT3 mutation status) BAALC expression allowed further discrimination of high- and low-risk patients. Importantly, in multivariable analysis high BAALC and a high FLT3 ratio were independently predictive of inferior OS and CIR. That both factors independently influence the clinical course suggests different molecular pathways may be involved.

Determination of BAALC expression in conjunction with FLT3 risk status appeared to identify four groups characterized by an increasingly adverse prognosis: BAALC low/FLT3 low risk, BAALC high/FLT3 low risk, BAALC low/FLT3 high risk, and BAALC high/FLT3 high risk. Indeed, high-level BAALC expression in conjunction with high-risk FLT3 mutation status identified patients with a predicted CIR at 20 months of 75% and 100% probability of dying by 3 years. Whereas high BAALC expression clearly identifies a new poor prognostic subgroup of patients within the FLT3 low risk group, future larger studies are required to clearly define the impact of BAALC expression within the FLT3 high-risk group.

We found a significantly higher rate of primary resistant leukemia for patients with high compared with low BAALC expression. The novel finding that high BAALC expression is associated with primary refractory disease in multivariable analysis underscores its importance for the choice of future remission-induction chemotherapy for this patient subgroup. We found high BAALC expression to be an independent factor predicting CIR, confirming its previously reported impact on disease-free survival.

In this study high-BAALC patients undergoing allogeneic transplantation had a low CIR, suggesting that these patients may benefit from this therapy. Allogeneic SCT conferred a similar low CIR for high and low BAALC patients treated on the AML'96 protocol. When additional patients who received autologous or allogeneic SCT in first CR off protocol were included (to increase the sample size), these findings were confirmed.

In summary, we conclude that high BAALC expression in conjunction with FLT3 mutation status successfully identifies high-risk patients within the heterogeneous group of cytogenetically normal AML patients. High BAALC expression is established as one of the most important independent risk factors associated with resistant disease, a high CIR, and inferior survival. Modulation of induction therapy and intensification of postremission therapy may be critical to improve outcome for these high-risk patients. Our preliminary results and exploratory analyses suggest that patients with high BAALC expression may benefit from consolidation with allogeneic SCT. However, a prospective randomized trial is necessary to confirm this. Moreover, further studies are needed to determine the yet-unknown function of BAALC protein in normal hematopoiesis and leukemia.


    Appendix
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Appendix
 Authors' Disclosures of...
 Author Contributions
 GLOSSARY
 REFERENCES
 
The following participants entered patients onto the trial: D. Huhn, O. Knigge (Universitätsklinikum Charité, Berlin); E. Späth-Schwalbe, S. Hesse-Amojo (Krankenhaus Spandau, Berlin); O. Rick, W. Siegert (Charité Campus Mitte, Berlin); R. Kolloch, U. Krümpelmann (Krankenanstalten Gilead, Bielefeld); K.-H. Pflüger, T. Wolff (Evang. Diakonissenanstalt Bremen); H.-H. Heidtmann (St Joseph-Hospital, Bremerhaven); F. Marquard (Allgemeines Krankenhaus, Celle); M. Hähnel, F. Fiedler, R. Herbst (Krankenhaus Küchwald, Chemnitz); M. Gramatzki, G. Helm (Universitätsklinikum, Erlangen); J.-G. Saal (Malteser Krankenhaus, Flensburg); H.-G. Höffkes, M. Arland (Städtisches Klinikum, Fulda); E. Faßhauer (St Elisabeth-Krankenhaus, Halle); N. Schmitz, P. Dreger (Allgemeines Krankenhaus St Georg, Hamburg); H. Schmidt, K. Buhrmann (Kreiskrankenhaus, Hameln); H. Dürk (St Marien-Hospital, Hamm); M. Burk (Klinikum Stadt, Hanau); A.-D. Ho, U. Mahlknecht (Universitätsklinikum, Heidelberg); A. Bartholomäus (St Bernward Krankenhaus, Hildesheim); A.A. Fauser (Klinik f. Hämatologie/Onkologie und KMT, Idar-Oberstein); H. Link, F.-G. Hagmann (Westpfalzklinikum, Kaiserslautern); G. Köchling (Kreiskrankenhaus, Leer); K.-P. Schalk (St Vincent-Krankenhaus, Limburg/Lahn); S. Fetscher (Städtisches Krankenhaus Süd, Lübeck); T. Wagner (Universitätsklinikum, Lübeck); A. Neubauer (Universitätsklinikum, Marburg); H. Bodenstein, J. Tischler (Klinikum Minden, Minden); H. Pohlmann, N. Brack (Städtisches Krankenhaus München Harlaching, München); M. Wilhelm, H. Wandt, K. Schäfer-Eckart, (Städtisches Klinikum, Nürnberg); B. Seeber (Klinikum Offenbach, Offenbach); F. Hirsch (Kreiskrankenhaus, Offenburg); T. Geer, H. Heißmeyer (Diakonie-Krankenhaus, Schwäbisch-Hall); J. Labenz (Ev. Jung-Stilling-Krankenhaus, Siegen); J. Kaesberger (Diakonissen-Krankenhaus, Stuttgart); W.E. Aulitzky, L. Leimer (Robert-Bosch-Krankenhaus, Stuttgart); M.R. Clemens, R. Mahlberg (Mutterhaus der Borromaerinnen, Trier); R. Schwerdtfeger (Deutsche Klinik für Diagnostik, Wiesbaden); R. Engberding, R. Winter (Stadtkrankenhaus, Wolfsburg); M. Sandmann (Klinikum St Antonius, Wuppertal); F. Weissinger, H. Rückle-Lanz (Universitätsklinikum, Würzburg).


    Authors' Disclosures of Potential Conflicts of Interest
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Appendix
 Authors' Disclosures of...
 Author Contributions
 GLOSSARY
 REFERENCES
 
The authors indicated no potential conflicts of interest.


    Author Contributions
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Appendix
 Authors' Disclosures of...
 Author Contributions
 GLOSSARY
 REFERENCES
 

Conception and design: Claudia D. Baldus, Christian Thiede, Gerhard Ehninger

Administrative support: Eckhard Thiel, Gerhard Ehninger

Provision of study materials or patients: Christian Thiede, Gerhard Ehninger

Collection and assembly of data: Claudia D. Baldus, Christian Thiede, Silke Soucek

Data analysis and interpretation: Claudia D. Baldus, Christian Thiede, Silke Soucek, Clara D. Bloomfield

Manuscript writing: Claudia D. Baldus, Christian Thiede, Clara D. Bloomfield

Final approval of manuscript: Claudia D. Baldus, Christian Thiede, Clara D. Bloomfield, Eckhard Thiel, Gerhard Ehninger

 


    GLOSSARY
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Appendix
 Authors' Disclosures of...
 Author Contributions
 GLOSSARY
 REFERENCES
 
BAALC (brain and acute leukemia, cytoplasmic): The BAALC gene, located on chromosome 8q22.3, encodes a protein with no homology to any known proteins or functional domains. Expression of this gene was found mainly in neuroectoderm-derived tissues and hematopoietic precursors.

CIR (cumulative incidence of relapse): The use of competing risk analyses are indicated in the presence of competing events (such as death and relapse), and the Gray's test is a recommended method to estimate the CIR.

Gene expression profiling: Identifying the expression of a set of genes in a biologic sample (eg, blood, tissue) using microarray technology.

Mutations in the fms-like tyrosine kinase 3 (FLT3) receptor: The FLT3 gene, located at chromosome band 13q12,encodes a membrane-bound protein member of the class III tyrosine kinase recep-tor family. Receptors belonging to the tyrosine kinase family (eg, EGFR, PDGFR) are activated through the auto- or transphosphorylation of tyrosine residues in the cytoplasmic region of the receptors in an ATP-dependent manner. An internal tandem duplication of FLT3 is one of the most common mutations in normal karyotype acute myeloid leukemia, occurring in approximately 28% to 38% of these patients.

Risk-adapted treatment stratification: Intensive treatments such as allogeneic stem-cell transplantation are potentially curative in acute myeloid leukemia (AML) but remain to be associated with high treatment-related mortality. Molecular markers will likely be valuable to stratify karyotypically normal AML patients within risk-adapted therapies.


    Acknowledgment
 
We are grateful to Amy S. Ruppert for her statistical support. We thank Marita Hartwig, Ulrike Löwel, Marika Karger, and Peggy Grassmel for excellent technical assistance. We also thank the participants of the DSIL study group listed in the Appendix (online only) who entered their patients onto the trial.


    NOTES
 
Supported by Leukemia Clinical Research Foundation (C.D.Bloomfield) and supported by grants from the Deutsche Krebshilfe and the Bundesministerium f. Bildung u. Forschung (Kompetenznetzwerk "Akute und Chronische Leukämien"; G.E.).

C.D. Baldus and C. Thiede contributed equally to this work.

Terms in blue are defined in the glossary, found at the end of this article and online at www.jco.org.

Authors' disclosures of potential conflicts of interest and author contributions are found at the end of this article.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Appendix
 Authors' Disclosures of...
 Author Contributions
 GLOSSARY
 REFERENCES
 
1. Grimwade D: The clinical significance of cytogenetic abnormalities in acute myeloid leukaemia. Best Pract Res Clin Haematol 14:497-529, 2001[Medline]

2. Byrd JC, Mrozek K, Dodge RK, et al: Pretreatment cytogenetic abnormalities are predictive of induction success, cumulative incidence of relapse, and overall survival in adult patients with de novo acute myeloid leukemia: Results from Cancer and Leukemia Group B (CALGB 8461). Blood 100:4325-4336, 2002[Abstract/Free Full Text]

3. Bullinger L, Dohner K, Bair E, et al: Use of gene-expression profiling to identify prognostic subclasses in adult acute myeloid leukemia. N Engl J Med 350:1605-1616, 2004[Abstract/Free Full Text]

4. Haferlach T, Kern W, Schoch C, et al: A new prognostic score for patients with acute myeloid leukemia based on cytogenetics and early blast clearance in trials of the German AML Cooperative Group. Haematologica 89:408-418, 2004[Abstract/Free Full Text]

5. Nakao M, Yokota S, Iwai T, et al: Internal tandem duplication of the flt3 gene found in acute myeloid leukemia. Leukemia 10:1911-1918, 1996[Medline]

6. Kiyoi H, Naoe T, Nakano Y, et al: Prognostic implication of FLT3 and N-RAS gene mutations in acute myeloid leukemia. Blood 93:3074-3080, 1999[Abstract/Free Full Text]

7. Schnittger S, Schoch C, Dugas M, et al: Analysis of FLT3 length mutations in 1003 patients with acute myeloid leukemia: Correlation to cytogenetics, FAB subtype, and prognosis in the AMLCG study and usefulness as a marker for the detection of minimal residual disease. Blood 100:59-66, 2002[Abstract/Free Full Text]

8. Steudel C, Wermke M, Schaich M, et al: Comparative analysis of MLL partial tandem duplication and FLT3 internal tandem duplication mutations in 956 adult patients with acute myeloid leukemia. Genes Chromosomes Cancer 37:237-251, 2003[CrossRef][Medline]

9. Kottaridis PD, Gale RE, Frew ME, et al: The presence of a FLT3 internal tandem duplication in patients with acute myeloid leukemia (AML) adds important prognostic information to cytogenetic risk group and response to the first cycle of chemotherapy: Analysis of 854 patients from the United Kingdom Medical Research Council AML 10 and 12 trials. Blood 98:1752-1759, 2001[Abstract/Free Full Text]

10. Whitman SP, Archer KJ, Feng L, et al: Absence of the wild-type allele predicts poor prognosis in adult de novo acute myeloid leukemia with normal cytogenetics and the internal tandem duplication of FLT3: a cancer and leukemia group B study. Cancer Res 61:7233-7239, 2001[Abstract/Free Full Text]

11. Thiede C, Steudel C, Mohr B, et al: Analysis of FLT3-activating mutations in 979 patients with acute myelogenous leukemia: Association with FAB subtypes and identification of subgroups with poor prognosis. Blood 99:4326-4335, 2002[Abstract/Free Full Text]

12. Tanner SM, Austin JL, Leone G, et al: BAALC, the human member of a novel mammalian neuroectoderm gene lineage, is implicated in hematopoiesis and acute leukemia. Proc Natl Acad Sci U S A 98:13901-13906, 2001[Abstract/Free Full Text]

13. Baldus CD, Tanner SM, Kusewitt DF, et al: BAALC, a novel marker of human hematopoietic progenitor cells. Exp Hematol 31:1051-1056, 2003[Medline]

14. Baldus CD, Tanner SM, Ruppert AS, et al: BAALC expression predicts clinical outcome of de novo acute myeloid leukemia patients with normal cytogenetics: A Cancer and Leukemia Group B Study. Blood 102:1613-1618, 2003[Abstract/Free Full Text]

15. Schaich M, Ritter M, Illmer T, et al: Mutations in ras proto-oncogenes are associated with lower mdr1 gene expression in adult acute myeloid leukaemia. Br J Haematol 112:300-307, 2001[CrossRef][Medline]

16. Mitelman F, (ed). ISCN: An International System for Human Cytogenetic Nomenclature. Basel, Switzerland, S. Karger, 1995

17. Kaplan EL, Meier P: Nonparametric estimation from incomplete observations. J Am Stat Assoc 53:457-481, 1958[CrossRef]

18. Gray RJ: A class of k-sample tests for comparing the cumulative incidence of a competing risk. Ann Stat 16:1141-1154, 1988[CrossRef]

19. Bienz M, Ludwig M, Mueller BU, et al: Risk assessment in patients with acute myeloid leukemia and a normal karyotype. Clin Cancer Res 11:1416-1424, 2005[Abstract/Free Full Text]

20. Barjesteh van Waalwijk van Doorn-Khosrovani S, Erpelinck C, van Putten WL, et al: High EVI1 expression predicts poor survival in acute myeloid leukemia: A study of 319 de novo AML patients. Blood 101:837-845, 2003[Abstract/Free Full Text]

21. Dohner K, Tobis K, Ulrich R, et al: Prognostic significance of partial tandem duplications of the MLL gene in adult patients 16 to 60 years old with acute myeloid leukemia and normal cytogenetics: A study of the Acute Myeloid Leukemia Study Group Ulm. J Clin Oncol 20:3254-3261, 2002[Abstract/Free Full Text]

22. Preudhomme C, Sagot C, Boissel N, et al: Favorable prognostic significance of CEBPA mutations in patients with de novo acute myeloid leukemia: A study from the Acute Leukemia French Association (ALFA). Blood 100:2717-2723, 2002[Abstract/Free Full Text]

23. Valk PJ, Verhaak RG, Beijen MA, et al: Prognostically useful gene-expression profiles in acute myeloid leukemia. N Engl J Med 350:1617-1628, 2004[Abstract/Free Full Text]

24. Frohling S, Schlenk RF, Breitruck J, et al: AML Study Group Ulm. Acute myeloid leukemia. Prognostic significance of activating FLT3 mutations in younger adults (16 to 60 years) with acute myeloid leukemia and normal cytogenetics: A study of the AML Study Group Ulm. Blood 100:4372-4380, 2002[Abstract/Free Full Text]

25. Smith BD, Levis M, Beran M, et al: Single-agent CEP-701, a novel FLT3 inhibitor, shows biologic and clinical activity in patients with relapsed or refractory acute myeloid leukemia. Blood 103:3669-3676, 2004[Abstract/Free Full Text]

26. Bernasconi P, Boni M, Cavigliano PM, et al: Molecularly targeted therapy in acute myeloid leukemia. Ann N Y Acad Sci 1028:409-422, 2004[CrossRef][Medline]

Submitted February 15, 2005; accepted October 5, 2005.


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Facebook Facebook   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
JCOHome page
K. H. Metzeler, A. Dufour, T. Benthaus, M. Hummel, M.-C. Sauerland, A. Heinecke, W. E. Berdel, T. Buchner, B. Wormann, U. Mansmann, et al.
ERG Expression Is an Independent Prognostic Factor and Allows Refined Risk Stratification in Cytogenetically Normal Acute Myeloid Leukemia: A Comprehensive Analysis of ERG, MN1, and BAALC Transcript Levels Using Oligonucleotide Microarrays
J. Clin. Oncol., October 20, 2009; 27(30): 5031 - 5038.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
G. Marcucci, K. Maharry, M. D. Radmacher, K. Mrozek, T. Vukosavljevic, P. Paschka, S. P. Whitman, C. Langer, C. D. Baldus, C.-G. Liu, et al.
Prognostic Significance of, and Gene and MicroRNA Expression Signatures Associated With, CEBPA Mutations in Cytogenetically Normal Acute Myeloid Leukemia With High-Risk Molecular Features: A Cancer and Leukemia Group B Study
J. Clin. Oncol., November 1, 2008; 26(31): 5078 - 5087.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
P. Paschka, G. Marcucci, A. S. Ruppert, S. P. Whitman, K. Mrozek, K. Maharry, C. Langer, C. D. Baldus, W. Zhao, B. L. Powell, et al.
Wilms' Tumor 1 Gene Mutations Independently Predict Poor Outcome in Adults With Cytogenetically Normal Acute Myeloid Leukemia: A Cancer and Leukemia Group B Study
J. Clin. Oncol., October 1, 2008; 26(28): 4595 - 4602.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. Langer, M. D. Radmacher, A. S. Ruppert, S. P. Whitman, P. Paschka, K. Mrozek, C. D. Baldus, T. Vukosavljevic, C.-G. Liu, M. E. Ross, et al.
High BAALC expression associates with other molecular prognostic markers, poor outcome, and a distinct gene-expression signature in cytogenetically normal patients younger than 60 years with acute myeloid leukemia: a Cancer and Leukemia Group B (CALGB) study
Blood, June 1, 2008; 111(11): 5371 - 5379.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
N. P. Agaram, M. P. Laquaglia, B. Ustun, T. Guo, G. C. Wong, N. D. Socci, R. G. Maki, R. P. DeMatteo, P. Besmer, and C. R. Antonescu
Molecular Characterization of Pediatric Gastrointestinal Stromal Tumors
Clin. Cancer Res., May 15, 2008; 14(10): 3204 - 3215.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. P. Whitman, A. S. Ruppert, M. D. Radmacher, K. Mrozek, P. Paschka, C. Langer, C. D. Baldus, J. Wen, F. Racke, B. L. Powell, et al.
FLT3 D835/I836 mutations are associated with poor disease-free survival and a distinct gene-expression signature among younger adults with de novo cytogenetically normal acute myeloid leukemia lacking FLT3 internal tandem duplications
Blood, February 1, 2008; 111(3): 1552 - 1559.
[Abstract] [Full Text] [PDF]


Home page
haematolHome page
G. J.L. Kaspers and C. M. Zwaan
Pediatric acute myeloid leukemia: towards high-quality cure of all patients
Haematologica, November 1, 2007; 92(11): 1519 - 1532.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
C. D. Baldus, P. Martus, T. Burmeister, S. Schwartz, N. Gokbuget, C. D. Bloomfield, D. Hoelzer, E. Thiel, and W. K. Hofmann
Low ERG and BAALC Expression Identifies a New Subgroup of Adult Acute T-Lymphoblastic Leukemia With a Highly Favorable Outcome
J. Clin. Oncol., August 20, 2007; 25(24): 3739 - 3745.
[Abstract] [Full Text] [PDF]


Home page
The OncologistHome page
S. Meshinchi and R. J. Arceci
Prognostic Factors and Risk-Based Therapy in Pediatric Acute Myeloid Leukemia
Oncologist, March 1, 2007; 12(3): 341 - 355.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
J. S. Kim, J. I. Eom, J.-W. Cheong, A. J. Choi, J. K. Lee, W. I. Yang, and Y. H. Min
Protein Kinase CK2{alpha} as an Unfavorable Prognostic Marker and Novel Therapeutic Target in Acute Myeloid Leukemia
Clin. Cancer Res., February 1, 2007; 13(3): 1019 - 1028.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. Mrozek, G. Marcucci, P. Paschka, S. P. Whitman, and C. D. Bloomfield
Clinical relevance of mutations and gene-expression changes in adult acute myeloid leukemia with normal cytogenetics: are we ready for a prognostically prioritized molecular classification?
Blood, January 15, 2007; 109(2): 431 - 448.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Heuser, G. Beutel, J. Krauter, K. Dohner, N. von Neuhoff, B. Schlegelberger, and A. Ganser
High meningioma 1 (MN1) expression as a predictor for poor outcome in acute myeloid leukemia with normal cytogenetics
Blood, December 1, 2006; 108(12): 3898 - 3905.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. D. Radmacher, G. Marcucci, A. S. Ruppert, K. Mrozek, S. P. Whitman, J. W. Vardiman, P. Paschka, T. Vukosavljevic, C. D. Baldus, J. E. Kolitz, et al.
Independent confirmation of a prognostic gene-expression signature in adult acute myeloid leukemia with a normal karyotype: a Cancer and Leukemia Group B study
Blood, September 1, 2006; 108(5): 1677 - 1683.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
C. D. Bloomfield, K. Mrozek, and M. A. Caligiuri
Cancer and Leukemia Group B Leukemia Correlative Science Committee: Major Accomplishments and Future Directions.
Clin. Cancer Res., June 1, 2006; 12(11): 3564s - 3571s.
[Abstract] [Full Text] [PDF]


Home page
ASH Education BookHome page
K. Mrozek and C. D. Bloomfield
Chromosome Aberrations, Gene Mutations and Expression Changes, and Prognosis in Adult Acute Myeloid Leukemia
Hematology, January 1, 2006; 2006(1): 169 - 177.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Baldus, C. D.
Right arrow Articles by Ehninger, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Baldus, C. D.
Right arrow Articles by Ehninger, G.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

About
JCO
 Editorial
Roster
 Advertising
Information
 Librarians &
Institutions
 Rights &
Permissions
 PDA Services

Copyright © 2006 by the American Society of Clinical Oncology, Online ISSN: 1527-7755. Print ISSN: 0732-183X
Terms and Conditions of Use
  HighWire Press HighWire Press™ assists in the publication of JCO Online