|
|||||
|
|
||||||
Originally published as JCO Early Release 10.1200/JCO.2005.02.2350 on December 27 2005 © 2006 American Society of Clinical Oncology.
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| ABSTRACT |
|---|
|
|
|---|
TAp73 exert an oncogenic effect by inactivating p53 and TAp73 suppressor properties. Additionally,
TAp73 may cooperate with oncogenic RAS to induce cell transformation, confer drug resistance, and induce the phosphorylation of phosphorylated Rb. Here, we study the expression of TAp73 and
TAp73 variants and assess possible associations with E2F-1, p53 and K-ras status. We address the possible clinical relevance of alterations in these genes.
PATIENTS AND METHODS: We determine in 113 colon and 60 breast cancer patients (a) the expression levels of TAp73,
TAp73 (
Ex2p73,
Ex2/3p73, and
Np73), and E2F-1 transcripts by quantitative real-time reverse transcriptase polymerase chain reaction (PCR); (b) mutations in the first exon of K-ras by PCRsingle-stranded confirmational polymorphism; and (c) p53 status by immunohistochemistry. Tumor characteristics were examined in each patient.
RESULTS: Both suppressor and oncogenic isoforms of TP73 were significantly coupregulated in tumor tissues. Associations were observed between (a) p53 wild type status and upregulation of some TP73 variants; (b) overexpression of E2F-1 and some TP73 forms; and (c) upregulation of
TAp73 variants and advanced pathologic stage, lymph node metastasis, vascular invasion, presence of polyps, and tumor localization.
CONCLUSION: Overexpression of TP73 variants in tumor tissues indicates that they may be involved in colon and breast carcinogenesis. The association between upregulation of
TAp73 isoforms and poor prognosis features, specifically advanced tumor stage, suggests that they may be of practical clinical prognostic value. Interestingly, the in vivo associations identified here may indicate a functional network involving p73 variants, p53, and E2F-1.
| INTRODUCTION |
|---|
|
|
|---|
Whereas TP53 encodes one major protein, TP73 gives rise to a complex number of isoforms with opposing functions: TAp73,
Ex2p73,
Ex2/3p73,
Np73 and
N'p73. These isoforms can also be processed alternatively at the COOH-terminal (Fig 1A). TAp73 variants contain the NH2-terminal transactivation domain and largely mimic p53 function in experimental systems.6 The
Ex2p73 and
Ex2/3p73 isoforms lack exon 2 and exons 2 and 3, respectively.1,7
Np73 is generated from an alternative promoter in intron 3 and contains a newly described 3' exon.8 This variant plays an essential antiapoptotic role during mouse development, counteracting p53-mediated neuronal death in vivo.9 Interestingly, the
N'p73 variant is generated from the first promoter, but aberrantly includes 198 base pairs (bp) from the 3' exon. Translation of the
N'p73 transcript starts in the 3' exon, resulting in the production of a protein that is indistinguishable from
Np73 (Fig 1B).10
Ex2p73,
Ex2/3p73,
Np73 and
N'p73 (so-called
TAp73) are transactivation-deficient isoforms that fail to induce apoptosis and cell cycle arrest by acting as direct competitors for the DNA binding-sites and/or by heteroduplex formation with p53 and the transactivation-competent TAp73 variants, inhibiting their tumor suppressor properties.8,11,12 These findings, along with the description that p53 and TAp73 can induce the expression of the specific
Np73 variant in vitro by direct binding to its promoter, indicate an autoregulatory feedback loop that may modulate cell survival and death.13,14 In addition,
TAp73 isoforms confer drug resistance on wild-type p53 and TAp73 harboring tumor cells,8 and act as oncogenes transforming NIH3T3 cells and making them tumorigenic in nude mice.15 Petrenco et al16 report that the specific
Np73 isoform promotes immortalization in primary cells and cooperates with oncogenic Ras to induce their transformation in vivo, fulfilling the classic criteria for a cooperating oncogene.
|
TAp73 forms exert their oncogenic action. Stiewe et al17 report that all
TAp73 isoforms induce similar degrees of in vitro phosphorylation of the retinoblastoma tumor suppressor protein phosphorylated Rb (pRb) and, consequently, its inactivation.
TAp73-mediated phosphorylation of pRb results in enhanced E2F activity, suggesting that
TAp73 variants might also interfere with the pRb tumor suppressor pathway. Interestingly, E2F-1 could activate TP73 transcription through its binding motifs, located in the noncoding regions of the two TP73 promoters,15,18 although some authors suggest that the second alternative promoter may not be regulated directly by E2F.19
It is important to note that, to date, most studies identifying TP73 overexpression in primary human tumors have examined total levels of TP73, whereas nearly all of the studies analyzing specific variants only utilized a small number of tumors.19,20,21 Some exceptions exist nevertheless. A semiquantitative study in breast cancer showed overexpression of the specific
Np73 variant in 31% of the 52 cases analyzed.8 Overexpression of both
Np73 and TAp73 variants was observed in 85% of 51 patients with chronic B-cell lymphocytic leukemia.22 A recent study in 100 ovarian cancer cases with a complete expression profile of all NH2-terminal truncated isoforms showed their differential expression patterns.23 Notably, overexpression of the specific
Np73 form in patients with neuroblastoma was significantly associated with reduced survival and served as an independent prognostic marker in lung cancer.24,25
In an attempt to further characterize this complex pattern of expression in human tumors and to assess its role in carcinogenesis, we address here the real-time quantification of full-length TP73 (TAp73) and NH2-terminal truncated isoforms (
TAp73) derived from the two TP73 promoters in a series of 113 and 60 patients diagnosed with colon and breast carcinomas, respectively. Moreover, we analyze which TP73 variants could be responsible for inducing the expression of E2F-1 and whether the concomitant expression of specific TP73 variants and oncogenic K-ras could influence the malignant phenotype of primary tumors. Throughout the text,
TAp73 refers collectively to the NH2-terminal truncated variants analyzed here (
Ex2p73,
Ex2/3p73 and
Np73).
Np73 refers exclusively to the specific transactivation-deficient isoform which derives from the second alternative promoter (Fig 1B). The association between expression of aberrant TP73 isoforms and pathologic parameters of the colon and breast tumors analyzed supports their possible oncogenic function and their potential as prognostic markers. This is the first study in colon and breast cancer patients to examine the entire complex network and determine its possible clinical relevance.
| PATIENTS AND METHODS |
|---|
|
|
|---|
All tumors were histologically examined by a pathologist to (a) confirm the diagnosis of colon or breast adenocarcinoma and identify the histologic breast cancer subtype, (b) verify the presence of tumor and select those samples with at least 75% tumor tissue, and (c) establish the pathologic stage.
DNA and RNA were extracted from approximately 30 mg of colon and breast tumor and healthy tissue samples using the QIAmp DNA Mini Kit and RNeasy Mini Kit, respectively (Quiagen Inc, Hilden, Germany). After extraction, nucleic acids were quantified spectrophotometrically.
Primer Design
Primer sets for TAp73, Ex2p73 and
Np73 were as described previously.23 Primer pairs for Ex2/3p73 and E2F-1 were designed using Primer Express version 2.0 (Applied Biosystems, Foster City, CA). For TAp73, Ex2p73, and Ex2/3p73, primers spanning splice junctions were used to amplify the specific variants. The TAp73 set amplifies all the isoforms containing the transactivation domain. For
Np73, the forward primer detects a sequence unique to this transcript (5' untranslated region of the 3' exon). The housekeeping genes TATA binding protein (TBP), succinate dehydrogenase complex subunit A (SDHA), and ubiquitin C (UBC) were used as to normalize gene expression results. The specificity of each primer set was confirmed by melting curve analyses and detection of single bands of amplicons of the expected size on nondenaturing 8% polyacrylamide gels followed by sequencing. The sequences of the primer sets and the reaction conditions are shown in Table 1.
|
Real-time polymerase chain reaction (PCR) was performed in a Light-Cycler apparatus (Roche Diagnostics, Mannheim, Germany) using the LightCycler-FastStart DNA Master Plus SYBR Green I Kit (Roche Diagnostics). Each reaction was performed in a final volume of 20 µL containing 4 µL of cDNA, 0.5 µmol/L of each primer, and varying concentrations of dimethyl sulfoxide (Table 1), as well as 1x reaction mix including FastStar DNA polymerase, reaction buffer, deoxyribonucleotide triphosphates (dNTPs) and SYBR green. Thermal cycling for all genes was initiated with a denaturation step of 95°C for 10 minutes and then subjected to 40 cycles of PCR (denaturation at 94°C for 10 seconds, annealing at different temperature for each gene [Table 1] for 5 seconds, and elongation at 72°C for 10 seconds, during which fluorescence was acquired).
TAp73 and
Np73 Immunohistochemistry
Immunophenotype analysis of 25 colon and 14 breast human samples showing differential mRNA expression of TAp73 and
Np73 variants was performed according to standard procedures, with overnight incubation in the presence of the following primary antibodies: (1) a mouse monoclonal p73 antibody (KAM-CC242F, clone 5B429; Stressgen, Victoria, Canada, diluted 1/100) epitope corresponding to the NH2-terminal region (this antibody recognizes the TAp73 isoforms but does not detect the
Np73 variant or p53) and (2) a mouse monoclonal
Np73 antibody (OP181, clone 38C674; Calbiochem, EMD Biosciences, Darmstadt, Germany; diluted 1/100) developed against a peptide corresponding to amino acids 2-13 of human
Np73 (LYVGDPARHLAT). Mouse and human sequences are more than 95% identical at these amino acid residues. This antibody does not cross react with any TAp73 isoform or p53.27 Immunodetection was performed with peroxidase-labeled streptavidin biotin (LSA; DAKO, Glostrup, Denmark) using diaminobenzidine chromagen as substrate. All immunostaining was performed using the TechMate 500 (DAKO) automatic immunostaining device. Choroid plexus from a human fetus was used as positive control for both antibodies. TAp73 and
Np73 proteins were considered positive in tissue samples exhibiting nuclear staining in > 10% of the epithelial cells.
Mutational Status of K-Ras Exon 1
In the colon specimens, PCR amplification of K-ras was carried out in a 25 µL reaction volume with a final concentration of 1x PCR buffer, 1.5 units of Ampli Taq DNA polymerase (Perkin-Elmer, Roche Molecular Systems Inc, Branchburg, NJ), 200 µmol/L dNTPs mix, 0.6 µmol/L of each primer; 2.5 mmol/L MgCl2, 100 ng of genomic DNA as template, and distilled water to reach the total volume. For amplification, each sample was denatured at 94°C for 5 minutes and subjected to 35 cycles of PCR (94°C for 30 seconds, 58°C for 40 seconds, and 72°C for 30 seconds) followed by a final 7 minutes extension at 72°C. The amplified products of K-ras amplification were denatured by mixing with 15 µL of stop solution containing 98% formamide, 0.02% xylene cyanol, and 0.02% bromophenol blue, and heated to 95°C for 6 minutes and rapidly cooled on ice. Electrophoresis was performed on nondenaturing 12% polyacrylamide gels at 250 V for 12 hours at room temperature. The allelic band intensity on the gels was assessed nonradioisotopically using a commercially available silver staining method.28 Primers used for amplification of exon 1 of K-Ras, which contains codons 12 and 13 were as follows: 5' GACTGAATATAAACTTGTGGTAGT 3' and 5' CTATTGTTGGATCATATTCGTCC 3'. The bands that displayed a different mobility shift pattern were sequenced in an ABI Prism 377 DNA sequencer (PE Biosystem, Foster City, CA).
Analysis
p53 immunophenotypic analysis in colon and breast samples was performed according to standard procedures, with overnight incubation in the presence of the cl1801 mouse monoclonal antibody (Oncogene Sciences, Manhasset, NY). Immunodetection was performed with peroxidase-labeled streptavidin biotin (LSA; DAKO) using diaminobenzidine chromogen as substrate. All immunostaining was performed using the TechMate 500 (DAKO) automatic immunostaining device. cl1801 mouse monoclonal antibody was used because of its ability to detect up to 89% of TP53 point mutations.29 Tissue samples exhibiting definitive nuclear (or nuclear and cytoplasmic) staining in > 10% of the epithelial cells were considered positive for p53. Cases displaying no nuclear staining were considered negative.
Data Analysis
The following parameters were obtained from the medical records of the 113 colon cancer patients: age, sex, tumor side, lymph node metastases (LNM), pathologicstage, vascular invasion, tumor differentiation, and existence of polyps (defined by the presence of polyps in the surgical specimen). Pathologic stage was assessed using the TNM classification. Presence of lymph node metastases was evaluated by optical microscopy. No other immunohistochemical or molecular techniques were used (Table 2).
|
15% of the epithelial cells. erb-B2 expression was evaluated using the mouse monoclonal antibody CB11 (Novocastra Lab Ltd, Newcastle, United Kingdom). Levels of erb-B2 were considered overexpressed when
15% of the epithelial cells of the tissue samples displayed intense membrane positive staining.
|
.05 were considered statistically significant. Statistical analysis was performed using the Statistical Package for the Social Sciences version 11.0 (SPSS Inc, Chicago, IL). | RESULTS |
|---|
|
|
|---|
Ex2p73,
Ex2/3p73,
Np73, and TAp73 expression are shown in Table 4.
|
Ex2/3p73 and TAp73 expression levels in breast samples, it did not achieve statistical significance (Table 5). Weaker statistical correlations were observed between
Ex2/3p73 and TAp73 in colon samples and between TAp73 and
Ex2p73, and TAp73 and
Np73 in breast samples (Table 5). Even though
Np73 arises from the second alternative TP73 promoter, its expression levels show a strong correlation with the expression of the first TP73 promoter isoforms.
|
Np73 protein expression by immunohistochemistry utilizing TAp73- and
Np73-specific antibodies. Like most other TAp73 antibodies, this antibody cannot distinguish among the various TAp73 isoforms. TAp73 immunoreactivity was observed in 19% and 21% of the colon and breast cancer cases, respectively (Fig 2). TAp73 protein expression correlated with mRNA quantification in 22 (88%) of the 25 colon cases and in 12 (86%) of the 14 breast samples. The cases that did not present a protein-mRNA correlation showed no TAp73 protein and moderate mRNA levels.
Np73 protein expression was observed in 33% and 30% of the colon and breast cancer cases, respectively (Fig 2).
Np73 protein expression correlated with mRNA levels in 21 (84%) of the 25 colon cases and 11 (79%) of the 14 breast samples. The seven cases that did not show a correlation presented either no
Np73 protein and moderate mRNA levels or moderate
Np73 protein expression and low mRNA levels.
|
Ex2p73 (P = .05) and TAp73 (P = .05; Table 2). The geometric average for
Ex2p73 levels was 0.5 when p53 staining was negative, and 0.1 when positive. For TAp73 expression levels, the geometric average was 1.3 for negative p53 staining, and 0.4 when positive. The same association was not observed for
Ex2/3p73 and
Np73 forms. When cases were divided into tertiles, we observed that 17 (94%) of 18 patients with the lowest expression of both
Ex2p73 and TAp73 (first tertile) showed positive p53 staining, whereas 23 (64%) of 36 patients with the highest expression levels for
Ex2p73 and/or TAp73 (third tertile) displayed positive immunostaining (P = .02). Moreover, 43% of patients exhibiting high expression of
Ex2p73 and low expression of TAp73 displayed positive p53 staining compared with 78% of individuals with low levels of
Ex2p73 and high expression of TAp73. This association did not achieve statistical significance because of the reduced number of patients in each subgroup. In our breast cancer series, a statistical association was also observed between wild-type p53 status and overexpression of the
Np73 variant (P = .04), with geometric averages 1.4 and 0.3 for negative and positive p53 staining, respectively (Table 3). Although it was not statistically significant, the same association was also observed for the remaining TP73 TA-truncated isoforms. The trend was much less evident for the TAp73 isoform.
Cooperation of TP73 Isoforms With Oncogenic K-Ras in Tumorigenesis
Np73 has been classified as an immortalizing protein that cooperates with oncogenic Ras to transform primary fibroblasts.16 We analyzed whether high expression levels of
Np73 and occurrence of oncogenic K-ras coincide in colon tumor specimens, suggesting a selection of cells harboring both alterations during tumorigenesis in humans. K-ras mutation at codons 12 and/or 13 was observed in 34 (30%) of 113 patients. Our results showed no statistical association between overexpression of
Np73 and presence of K-Ras mutations. We also found no association between the remaining
TA/TAp73 isoforms and oncogenic K-Ras (Table 2).
Induction of E2F-1 by
TAp73 Isoforms
E2F-1 has been described to activate TP73 isoform transcription.15,18 Additionally,
TAp73 isoforms could induce activation of E2F through the hyperphosphorylation of pRb.17 We analyzed whether overexpression of
TAp73 isoforms correlates with upregulation of E2F-1 mRNA levels in our colon and breast tumor series. The median, minimum, and maximum, and 25th and 75th percentiles for E2F-1 expression are shown in Table 4 for colon and breast samples. A direct correlation was found between expression of E2F-1 and
Ex2p73 (P = .009; r = 0.26) and TAp73 (P = .036; r = 0.20) in colon samples (Table 5). In the breast cases, we observed direct correlations between E2F-1 expression and
Ex2p73 (P = .05; r = 0.26),
Ex2/3p73 (P = .05; r = 0.33), and TAp73 (P = 0.001; r = 0.43; Table 5).
Association With Colon Tumor Pathologic Data
Analysis of the relationship between TP73 isoform expression and pathologic data revealed some significant associations in colon cancer patients (Table 2). An association was found between tumor stage and expression of
Ex2/3p73 and
Np73 isoforms.
Ex2/3p73 expression was significantly higher in stage IV (P = .03), with geometric averages of 0.38 for stage I, 0.35 for stage II, 0.36 for stage III, and 25.55 for stage IV (Fig 3A).
Np73 levels increased significantly in parallel with the stage (P = .011), as indicated by the geometric average of its expression (0.06 in stage I, 0.19 in stage II, 0.46 in stage III, and 11.12 in stage IV; Fig 3B).
|
Ex2p73 (P = .03),
Ex2/3p73 (P = .04), and TAp73 (P = .01). The geometric average expression in patients with absence (71.7%) and presence (28.3%) of polyps was 0.17 and 0.45 for
Ex2p73, 0.3 and 1.28 for
Ex2/3p73, and 0.4 and 1.7 for TAp73, respectively.
Np73 overexpression was significantly associated with vascular invasion (P = .02). The geometric average
Np73 level of the 68 (60.2%) of 113 patients who did not show vascular invasion was 0.14; the remaining 39.8% with vascular invasion had a geometric average expression of 0.65.
Presence of lymph node metastases was associated with high levels of the
Ex2/3p73 variant (P = .04). The geometric average for the expression of the isoform in the 37 (32.75%) of 113 patients harboring lymph node metastases was 1.7 and in those without lymph node metastases (76 [67.25%] of 113) it was 0.4.
An association was observed between rectum tumor localization and upregulation of TAp73 variants (P = .004). The geometric average for TAp73 levels was 0.62, 0.22, and 1.8 for left, right, and rectum colon localization, respectively. A trend was also observed between rectum localization and overexpression of the
Ex2p73 isoform (P = .06). The geometric average of
Ex2p73 levels for left, right, and rectum colon localization was 0.17, 0.16, and 0.52, respectively.
Association With Breast Tumor Pathologic Data
Analysis of the relationship between the expression levels of TP73 variants and the pathologic data revealed significant associations in the breast series (Table 3). A significant association was observed between vascular invasion and overexpression of
Ex2p73 (P = .05). The geometric average levels for the patients harboring vascular invasion (41.7%) was 0.9, and for the remaining patients without this pathologic feature it was 0.3. A trend was also found between
Np73 overexpression and vascular invasion (P = .06).
Interestingly, some trends were found between overexpression of TP73 variants and the hormone receptors: high levels of
Ex2p73 and
Ex2/3p73 variants were associated with estrogen negative receptors (P = .06 and P = .07, respectively) and overexpression of TAp73 isoform was associated with progesterone negative receptors (P = .06).
| DISCUSSION |
|---|
|
|
|---|
TAp73) with opposite functions to the tumor suppressor p53 and the p73 full-length variants (TAp73) led us to undertake a detailed and comprehensive clinical analysis of their expression in tumor tissue. Here we have quantified the expression levels of the transactivation-competent TAp73 variants and the NH2-terminally truncated
TAp73 isoforms (
Ex2p73,
Ex2/3p73, and
Np73), in two large series of colon and breast cancer patients. Although expression levels of TP73 isoforms have been described to vary minimally among normal tissues from different organs,23 the availability of tumor and normal counterpart tissue used in the current study provides a good opportunity for the faithful analysis of the changes in expression in tumors.
Both
TAp73 and TAp73 forms were found to be upregulated in a significant number of the colon and breast tumors examined, indicating a possible involvement in colon and breast tumorigenesis. Other studies examining TP73 variants suggest that their relative expression levels might be tumor specific.23,19 The finding that the expression levels of the analyzed variants directly correlate with each other is surprising, and might indicate that both promoters are regulated by the same stimuli. Analysis of the functional heterocomplexes formed among the tumor suppressor and the oncogenic p73 variants and how their stoichiometry could be influenced by changes in their expression levels in human tumors is crucial to the understanding of whether they have either a tumor-suppressor or an oncogenic role. It is possible that the presence of
TAp73 variants, even at low levels, completely suppresses the transactivating activity of TAp73, with the consequent elimination of essential TAp73 antitumorigenic function. In addition, at the protein level,
TAp73 isoforms have been described to be more stable than those of TAp73.12,14
In our colon and breast tumor samples, some associations were observed between expression of wild-type p53 and upregulation of specific TP73 isoforms, supporting the hypothesis that two different alterations in the same pathway might not confer additional growth advantages during carcinogenesis and thereby alleviate the selective pressure on those cells harboring both alterations. Such an association was also observed in a previous study in which we analyzed total expression levels of TP73.34 The fact that both alternations are not found concomitantly suggests that p73 can inactivate the p53 tumor supressor pathway. In this context, p73 could be considered to act as an oncogene. Overexpression of wild-type TP73 was thought to be a mechanism to compensate for TP53 inactivation, a scenario in which p73 would carry out the activities of p53. However, such an association (TP73 upregulation and mutated TP53) has not been observed, suggesting that p73 might not play a tumor-suppressor role.
Np73 is the only p73 variant under the control of the second alternative promoter (Fig 1B). This cryptic promoter can be activated by both wild-type p53 and TAp73 variants.14,35 The upregulation of the specific
Np73 variant observed in our series could be a result of activation of this second promoter by increased levels of TAp73 forms in the colon and breast tumor samples. In our breast series, the association found between wild-type p53 status and upregulation of the
Np73 isoform could also be a result of the transactivation of the
Np73 promoter by p53.
In vitro, the specific
Np73 isoform causes immortalization of primary fibroblasts and rescues them from Ras-induced senescence; in addition, it cooperates with oncogenic Ras in transforming them in vivo.16 We hypothesized that oncogenic Ras and upregulation of
Np73 variant could be common alterations acquired consecutively during human tumorigenesis. In our colon and breast tumor series, we could not confirm our hypothesis as a statistical association between activated K-Ras and overexpression of either
Np73 or the remaining TP73 variants was not found. Therefore, in human colon and breast tumorigenesis, the
Np73 variant might cooperate with other oncogenes in the process of transformation. Identification of oncogenes that can cooperate with the specific
Np73 form might help to identify individuals at higher risk of developing cancer.
Some novel results were obtained in the analysis of our colon and breast cancer series. A correlation between E2F-1 and
Np73 expression levels was not observed, supporting the suggestion that the intronic alternative TP73 promoter may not be directly regulated by E2F-1.19 However, some correlations were found between mRNA levels of E2F-1 and TP73 variants derived from the first promoter. These correlations could be explained in different ways. While the first TP73 promoter is a known target of E2F,36
TAp73 isoforms can also inactivate pRb tumor suppressor protein, resulting in E2F release.17 In our study, it is difficult to know whether E2F-1 activates the expression of first-promoterderived TP73 variants or whether E2F-1 upregulation is a consequence of pRb inactivation by
TAp73 forms. Certainly, a positive feedback loop may exist.
Colorectal and breast cancers are two of the most frequent malignancies in Western societies, and remain associated with high mortality rates. In this context, the search for molecular markers that could help to either detect the disease at early stages or predict the tumor behavior and response to therapy is extremely important. Therefore, the clinical significance of the upregulation of TP73 variants in these tumor types is of particular interest. The association of the overexpression of TP73 isoforms with poor-prognosis tumor features could highlight their role as oncogenes. In our colon cancer series, the upregulation of TP73 variants was associated with tumor stage, lymph node metastases, vascular invasion, presence of polyps, and tumor localization (Table 2). Overexpression of
Ex2/3p73 and
Np73 was associated with more advanced stages; specifically, expression levels of
Ex2/3p73 were significantly higher in stage IV and
Np73 levels increased in parallel with the stage. Therefore,
Ex2/3p73 and
Np73 may be markers of malignant potential in this tumor type.
Currently, pathologic stage is the prognostic factor that has the most clearly demonstrated practical use in colorectal cancer, with the 5-year survival of stage I patients (close to 90%) contrasting strongly with that of stage IV patients (< 10%).37 In a recent study in lung cancer, the percentage of patients showing positive expression of the oncogenic
Np73 form was higher for stage III and was associated with a lower 5-year survival.25 In addition,
Np73 variant expression is a predictor of unfavorable outcome in neuroblastoma.24 Taken together, these observations suggest that a follow-up of our patient series for relapse and overall survival regarding TP73 isoforms expression status will provide additional information on the prognostic value of the expression levels of these oncogenic TP73 variants in these tumor types. Nevertheless, the correlation already observed with the pathologic stage could anticipate its value as a prognostic marker. Notably,
TAp73 variants have been described to confer drug resistance and might also predict treatment responsiveness.14
Interestingly, an association was observed between patients displaying
Ex2p73 or TAp73 overexpression and rectum tumor localization. Two pathways for colorectal carcinogenesis have been defined: the suppressor and the mutator. Patients with the mutator phenotype are characterized by inactivation of mismatch repair genes, consequently harboring microsatellite instability, and show their tumor in the right side of the colon.38 Perhaps overexpression of these two TP73 variants could help to identify colorectal tumors form the suppressor pathway.
The most remarkable association found in our breast cancer series is the correlation between TP73 variants and the hormone receptors (Table 3). The association observed between upregulation of
Ex2p73 and negative estrogen receptors and between TAp73 and negative progesterone receptors indicates that the expression of these variants could be used as a marker for patient suitability for hormone therapy. Moreover, the association observed between
Ex2p73 and
Np73 and vascular invasion highlights the possible oncogenic role of the transactivation truncated p73 variants in breast carcinogenesis.
Upregulation of the tumor suppressor TAp73 variants in both the colon and breast samples was associated with certain features associated with poor prognosis. This may be explained by the fact that suppressor TAp73 and putative oncogenic
TAp73 forms are coexpressed in the tumor samples and, even though TAp73 variants are upregulated, the oncogenic isoforms may cancel their suppressor function, resulting in a prevalent oncogenic activity.
The p73 NH2-terminal truncated variants could be alternatively spliced at the COOH-terminal (Fig 1A). This region contains a sterile alpha motif (SAM) and a proline-rich domain.39,40 The SAM domain is involved in protein-protein interactions, and is present in proteins whose functions range from signal transduction to transcriptional repression.39 p73
, p73
, and p73
contain SAM domains.39 p73
transactivates p53 target genes to a lesser extent than p73ß, suggesting that the p73 SAM domain is involved in transcriptional regulation.41 A study quantifying the expression levels of specific variants that harbor simultaneous splicing alternatives at the 3' and 5' terminal regions in human tissues could reveal how the COOH-terminal splicing affects p73 activity and which combination of NH2- and COOH- processing is involved in tumorigenesis. If displaying a truncated NH2-terminal implies a transactivation deficiency, the processing at the COOH-terminal may have little effect on the protein function. Unfortunately, it is difficult to perform such a study.
In conclusion, the association of upregulation of
TAp73 variants with poor prognostic features of tumors is suggestive of a possible oncogenic role and indicates that they may be of value as molecular prognostic markers. This is the case for the
Ex2/3p73 and
Np73 variants, whose overexpression in colon cancer patients is associated with advanced pathologic stage. Nevertheless, a follow-up of our patient series to confirm the association of overexpression of
Ex2/3p73 and
Np73 isoforms with lower survival is mandatory to assess the predictive value of these molecular parameters. In this context, a step further will be consideration of the treatment that these patients received to determine whether overexpression of these variants are prognostic for clinical outcomes or whether they are predictive of differential benefits from specific therapies. p53 immunohistochemical status is widely included in the medical records of cancer patients. However, the modifier action that
TAp73 variants could exert on p53 suggests that analysis of TP73 isoforms levels should be considered.
| Authors' Disclosures of Potential Conflicts of Interest |
|---|
|
|
|---|
| Author Contributions |
|---|
|
|
|---|
| Conception and design: Gemma Domínguez Provision of study materials or patients: Constanza Maximiano, María E. Gómez, Jose A. Rivera, Carmen García-Andrade Collection and assembly of data: Gemma Domínguez, Jose M. García, Cristina Peña, Javier Silva, Vanesa García, Lara Martínez Data analysis and interpretation: Gemma Domínguez, Lara Martínez, Felix Bonilla Manuscript writing: Gemma Domínguez, Felix Bonilla Final approval of manuscript: Gemma Domínguez, Jose M. García, Cristina Peña, Javier Silva, Vanesa García, Lara Martínez, Constanza Maximiano, María E. Gómez, Jose A. Rivera, Carmen García-Andrade, Felix Bonilla
|
| Glossary |
|---|
|
|
|---|
Isoforms: Arising from a differential exon-splicing process, isoforms are proteins derived from the same gene but have distinct physical, and sometimes biologic, properties.
Oligomerization: The forming of a compound (polymer) by the combination of relatively few smaller molecules (monomers).
SDHA (succinate dehydrogenase complex subunit A): This protein is one of the four components of the enzymatic mitochondrial complex II which is involved in the mitochondrial respiratory chain. It is consider a housekeeping gene because of its essential function in cells.
TAp73: TP73 isoforms, which contain the DNA-binding, the oligomerization, and transactivation domains. TAp73 proteins largely mimic p53 suppressor functions in experimental systems and are capable of inducing cell cycle arrest and cell death in response to DNA damage.
TAp73:
Ex2p73,
Ex2/3p73,
Np73, and
N'p73, so called
TAp73, are transactivation-deficient TP73 variants that are generated through alternative processing at the NH2-terminal region or differential promoter usage.
TAp73 proteins fail to induce apoptosis and cell cycle arrest by acting as direct competitors for the DNA binding-sites and/or by heteroduplex formation with p53 and the transactivation-competent TAp73 variants, inhibiting their tumor suppressor properties.
TBP: Gene coding for the TATA box-binding protein, a transcription initiation factor. TBP plays a key role in the activation and regulation of eukaryotic promoters that occurs when it binds to TATA elements in promoter regions, initiating the assembly of a preinitiation complex involving RNA polymerase II and several initiation factors.
TP73: Family member of the tumor suppressor gene TP53. Although p73 was initially described as a tumor suppressor protein, nowadays is accepted that it could exert both a tumor suppressor or an oncogenic function depending on its isoforms.
Transactivation: Induction of the transcription by a transcription factor binding to DNA and activating adjacent proteins.
UBC (ubiquitin C): Protein involved in the process of protein turnover in eukaryotic cells. Its essential function qualifies UBC as a housekeeping gene.
| Acknowledgment |
|---|
| NOTES |
|---|
Terms in blue are defined in the glossary, found at the end of this article and online at www.jco.org.
Authors' disclosures of potential conflicts of interest and author's contributions are found at the end of this article.
| REFERENCES |
|---|
|
|
|---|
2. Irwin MS, Kaelin WG: p53 family update: p73 and p63 develop their own identities. Cell Growth Differ 12:337-349, 2001
3. Melino G, De Laurenzi V, Vousden KH: p73: Friend or foe in tumorigenesis. Nat Rev Cancer 2:605-615, 2002[CrossRef][Medline]
4. Moll UM, Erster S, Zaika A: p53, p63 and p73: Solos, alliances and feuds among family members. Biochim Biophys Acta 1552:47-59, 2001[Medline]
5. Yang A, Walker N, Bronson R, et al: p73-deficient mice have neurological, pheromonal and inflammatory defects but lack spontaneous tumours. Nature 404:99-103, 2000[CrossRef][Medline]
6. Jost CA, Marin MC, Kaelin WG Jr: p73 is a simian [correction of human] p53-related protein that can induce apoptosis. Nature 389:191-194, 1997[CrossRef][Medline]
7. Sherr CJ, Weber JD: The ARF/p53 pathway. Curr Opin Genet Dev 10:94-99, 2000[CrossRef][Medline]
8. Zaika AI, Slade N, Erster SH, et al: deltaNp73, a dominant-negative inhibitor of wild-type p53 and TAp73, is up-regulated in human tumors. J Exp Med 196:765-780, 2002
9. Pozniak CD, Radinovic S, Yang A, et al: An anti-apoptotic role for the p53 family member, p73, during developmental neuron death. Science 289:304-306, 2000
10. Ishimoto O, Kawahara C, Enjo K, et al: Possible oncogenic potential of deltaNp73: A newly identified isoform of human p73. Cancer Res 62:636-641, 2002
11. Fillippovich I, Sorokina N, Gatei M, et al: Transactivation-deficient p73alpha (p73Deltaexon2) inhibits apoptosis and competes with p53. Oncogene 20:514-522, 2001[CrossRef][Medline]
12. Stiewe T, Theseling CC, Putzer BM: Transactivation-deficient delta TA-p73 inhibits p53 by direct competition for DNA binding: Implications for tumorigenesis. J Biol Chem 277:14177-14185, 2002
13. Nakagawa T, Takahashi M, Ozaki T, et al: Autoinhibitory regulation of p73 by deltaNp73 to modulate cell survival and death through a p73-specific target element within the deltaNp73 promoter. Mol Cell Biol 22:2575-2585, 2002
14. Grob TJ, Novak U, Maisse C, et al: Human deltaNp73 regulates a dominant negative feedback loop for TAp73 and p53. Cell Death Differ 8:1213-1223, 2001[CrossRef][Medline]
15. Stiewe T, Zimmermann S, Frilling A, et al: Transactivation-deficient deltaTA-p73 acts as an oncogene. Cancer Res 62:3598-3602, 2002
16. Petrenko O, Zaika A, Moll UM: deltaNp73 facilitates cell immortalization and cooperates with oncogenic ras in cellular transformation in vivo. Mol Cell Biol 23:5540-5555, 2003
17. Stiewe T, Stanelle J, Theseling CC, et al: Inactivation of retinoblastoma (Rb) tumor suppressor by oncogenic isoforms of the p53 family member p73. J Biol Chem 278:14230-14236, 2003
18. Putzer BM, Tuve S, Tannapfel A, et al: Increased deltaN-p73 expression in tumors by upregulation of the E2F1-regulated, TA-promoter-derived deltaN'-p73 transcript. Cell Death Differ 10:612-614, 2003[CrossRef][Medline]
19. Stiewe T, Tuve S, Peter M, et al: Quantitative TP73 transcript analysis in hepatocellular carcinomas. Clin Cancer Res 10:626-633, 2004
20. Tomkova K, Belkhiri A, El-Rifai W, et al: p73 isoforms can induce T-cell factor-dependent transcription in gastrointestinal cells. Cancer Res 64:6390-6393, 2004
21. Tuve S, Wagner SN, Schittek B, et al: Alterations of deltaTA-p73 splice transcripts during melanoma development and progression. Int J Cancer 108:162-166, 2004[CrossRef][Medline]
22. Leupin N, Luthi A, Novak U, et al: P73 status in B-cell chronic lymphocytic leukaemia. Leuk Lymphoma 45:1205-1207, 2004[CrossRef][Medline]
23. Concin N, Becker K, Slade N, et al: Transdominant deltaTAp73 isoforms are frequently up-regulated in ovarian cancer: Evidence for their role as epigenetic p53 inhibitors in vivo. Cancer Res 64:2449-2460, 2004
24. Casciano I, Mazzocco K, Boni L, et al: Expression of deltaNp73 is a molecular marker for adverse outcome in neuroblastoma patients. Cell Death Differ 9:246-251, 2002[CrossRef][Medline]
25. Uramoto H, Sugio K, Oyama T, et al: Expression of deltaNp73 predicts poor prognosis in lung cancer. Clin Cancer Res 10:6905-6911, 2004
26. Palmer HG, Larriba MJ, Garcia JM, et al: Snail represses vitamin D receptor expression and responsiveness in human colon cancer. Nat Med 10:917-919, 2004[CrossRef][Medline]
27. Sayan AE, Paradisi A, Vojtesek B, et al: New antibodies recognizing p73: Comparison with commercial antibodies. Biochem Biophys Res Co 330:186-193, 2005[CrossRef][Medline]
28. Oto M, Miyake S, Yuasa Y: Optimization of nonradioisotopic single strand conformation polymorphism analysis with a conventional minislab gel electrophoresis apparatus. Ann Biochem 213:19-22, 1993
29. Sjögren S, Inganäs M, Torbjörn N, et al: The p53 gene in breast cancer: Prognostic value of complementary DNA sequencing versus immunohistochemistry. J Natl Cancer Inst 88:173-182, 1996
30. Domínguez G, Silva JM, Silva J, et al: Wild type p73 overexpression and high-grade malignancy in breast cancer. Breast Cancer Res Treat 66:183-190, 2001[CrossRef][Medline]
31. Tannapfel A, Wasner M, Krause K, et al: Expression of p73 and its relation to histopathology and prognosis in hepatocellular carcinoma. J Natl Cancer Inst 91:1154-1158, 1999
32. Chi SG, Chang SG, Lee SJ, et al: Elevated and biallelic expression of p73 is associated with porgression of human bladder cancer. Cancer Res 59:2791-2793, 1999
33. Sunahara M, Ichimiya S, Nimura Y, et al: Mutational analysis of p73 gene in localized at chromosome 1p36.3 in colorectal carcinomas. Int J Oncol 13:319-323, 1998[Medline]
34. Domínguez G, Silva J, Silva JM, et al: Different expression of p14ARF defines two groups of breast carcinomas in terms of TP73 expression and TP53 mutational status. Genes Chromosomes Cancer 31:99-106, 2001[CrossRef][Medline]
35. Katarsheva NN, Contente A, Lenz-Stoppler C, et al: p53 induces the expression of its antagonist p73 deltaN, establishing an autoregulatory feedback loop. Oncogene 21:4715-4727, 2002[CrossRef][Medline]
36. Seelan RS, Irwin M, van der Stoop P, et al: The human p73 promoter: Characterization and identification of functional E2F binding sites. Neoplasia 4:195-203, 2002[CrossRef][Medline]
37. Cohen AM, Minsky BD, Schilsky RL: Cancer of the colon, in Devita Jr VT, Hellman S, Rosemberg SA (ed): Cancer Principles and Practice of Oncology. Philadelphia, PA, Lippincott-Raven, 1997, pp 1144-1197
38. Chaves P, Cruz C, Lage P, et al: Immunohistochemical detection of mismatch repair gene proteins as useful tool for the identification of colorectal carcinoma with the mutator phenotype. J Pathol 191:355-360, 2000[CrossRef][Medline]
39. Arrowsmith CH: Structure and function in the p53 family. Cell Death Differ 6:1169-1173, 1999[CrossRef][Medline]
40. Ozaki T, Naka M, Takada N, et al: Deletion of the COOH-terminal region of p73alpha enhances both its transactivation function and DNA-binding activity but inhibits induction of apoptosis in mammalian cells. Cancer Res 59:5902-5907, 1999
41. Zaika AI, Kovalev S, Marchenko ND, Moll UM: Overexpression of the wild type p73 gene in breast cancer tissues and cell lines. Cancer Res 59:3257-3263, 1999
Submitted April 4, 2005; accepted October 13, 2005.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Facebook
Reddit
Technorati
Twitter What's this?
Related Correspondence
This article has been cited by other articles:
![]() |
J.-P. Roperch, K. El Ouadrani, A. Hendrix, S. Emami, O. De Wever, G. Melino, and C. Gespach Netrin-1 Induces Apoptosis in Human Cervical Tumor Cells via the TAp73{alpha} Tumor Suppressor Cancer Res., October 15, 2008; 68(20): 8231 - 8239. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Bozzetti, R. Nizzoli, A. Musolino, E. M. Martella, P. Crafa, C. A. Lagrasta, R. Camisa, A. Bonati, P. Lunghi, and A. Ardizzoni p73 and p53 Pathway in Human Breast Cancers J. Clin. Oncol., April 10, 2007; 25(11): 1451 - 1453. [Full Text] [PDF] |
||||
![]() |
G. Dominguez and F. Bonilla In Reply J. Clin. Oncol., April 10, 2007; 25(11): 1453 - 1454. [Full Text] [PDF] |
||||
![]() |
R Malaguarnera, V Vella, R Vigneri, and F Frasca p53 family proteins in thyroid cancer Endocr. Relat. Cancer, March 1, 2007; 14(1): 43 - 60. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Reimer, S. Sadr, A. Wiedemair, S. Stadlmann, N. Concin, G. Hofstetter, E. Muller-Holzner, C. Marth, and A. G. Zeimet Clinical Relevance of E2F Family Members in Ovarian Cancer--An Evaluation in a Training Set of 77 Patients Clin. Cancer Res., January 1, 2007; 13(1): 144 - 151. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. R. Watson, A. Blanch, D. C. C. Lin, M. Ohh, and M. S. Irwin Mdm2-mediated NEDD8 Modification of TAp73 Regulates Its Transactivation Function J. Biol. Chem., November 10, 2006; 281(45): 34096 - 34103. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|||||||||||
|
Copyright © 2006 by the American Society of Clinical Oncology, Online ISSN: 1527-7755. Print ISSN: 0732-183X
|