Advertisement
Journal of Clinical Oncology  
Search for:
Limit by:
  Browse by Subject or Issue
Home Search or Browse JCO My JCO Subscriptions Customer Service Site Map

Journal of Clinical Oncology, Vol 24, No 7 (March 1), 2006: pp. 1195-1203
© 2006 American Society of Clinical Oncology.
DOI: 10.1200/JCO.2005.04.0717

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Heinrich, M. C.
Right arrow Articles by Fletcher, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Heinrich, M. C.
Right arrow Articles by Fletcher, J. A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Clinical and Molecular Studies of the Effect of Imatinib on Advanced Aggressive Fibromatosis (desmoid tumor)

Michael C. Heinrich, Grant A. McArthur, George D. Demetri, Heikki Joensuu, Petri Bono, Richard Herrmann, Hal Hirte, Sara Cresta, D. Bradley Koslin, Christopher L. Corless, Stephan Dirnhofer, Allan T. van Oosterom, Zariana Nikolova, Sasa Dimitrijevic, Jonathan A. Fletcher

From the Oregon Health and Science University Cancer Institute and Portland VA Medical Center, Portland, OR; Peter MacCallum Cancer Centre, E Melbourne, Australia; Dana-Farber Cancer Institute, Harvard Medical School, and Brigham and Women's Hospital, Boston, MA; Helsinki University Central Hospital, Helsinki, Finland; University Hospital, and Clinical Research Oncology, Novartis Pharma AG, Basel, Switzerland; Juravinski Cancer Centre, Hamilton, Ontario, Canada; Institute Nazionale Tumori Milano, Milano, Italy; UZ Gasthuisberg Dienst Oncology, Leuven, Belgium; Imatinib Target Exploration Consortium Study B2225

Address reprint requests to Michael C. Heinrich, MD, R&D-19 3710 SW US Veterans Hospital Rd, Portland, OR 97239; e-mail: heinrich{at}ohsu.edu


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 REFERENCES
 
PURPOSE: To determine the clinical efficacy of imatinib in patients with advanced aggressive fibromatosis (AF) and to identify the molecular basis of response/nonresponse to this agent.

PATIENTS AND METHODS: Nineteen patients with AF were treated with imatinib (800 mg/d) as part of a phase II clinical study. Tumor specimens were analyzed for mutations of KIT, PDGFRA, PDGFRB, and CTNNB1 (beta-catenin). Tumor expression of total and activated KIT, PDGFRA, and PDGFRB were assessed using immunohistochemistry and immunoblotting techniques. We also measured plasma levels of PDGF-AA and PDGF-BB in patients and normal patient controls.

RESULTS: Three of 19 patients (15.7%) had a partial response to treatment, with four additional patients having stable disease that lasted more than 1 year (overall 1 year tumor control rate of 36.8%). No mutations of KIT, PDGFRA, or PDGFRB were found. Sixteen of 19 patients (84%) had mutations involving the WNT pathway (APC or CTNNB1). However, there was no correlation between WNT pathway mutations and clinical response to imatinib. AF tumors expressed minimal to null levels of KIT and PDGFRA but expressed levels of PDGFRB that are comparable with normal fibroblasts. However, PDGFRB phosphorylation was not detected, suggesting that PDGFRB is only weakly activated. AF patients had elevated levels of PDGF-AA and PDGF-BB compared with normal patient controls. Notably, the plasma level of PDGF-BB was inversely correlated with time to treatment failure.

CONCLUSION: Imatinib is an active agent in the treatment of advanced AF. Imatinib response in AF patients may be mediated by inhibition of PDGFRB kinase activity.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 REFERENCES
 
Aggressive fibromatosis (AF, also known as desmoid tumor) is a fibroproliferative neoplasm that typically arises in the abdomen but can develop at other anatomic sites, most commonly in the extremities.1-3 These tumors have a relatively high local failure rate after primary treatment using surgery and/or radiotherapy, and although rarely giving rise to distant metastases, can be multifocal and, therefore, not surgically resectable. Moreover, tumor may recur adjacent to the site of surgical resection, underscoring the limitations of surgery in the palliative setting. Therefore, effective medical therapies for AF are needed to maintain quality of life and prolong survival. To date, medical therapy for recurrent and/or unresectable AF with tamoxifen, nonsteroidal anti-inflammatory drugs, or chemotherapy has yielded mixed results.4-8

Mace el al9 reported a favorable clinical response in two patients with extra-abdominal AF who were treated with imatinib. To date, there have been no additional clinical reports on the efficacy of imatinib for the treatment of refractory AF, and it is unclear whether the imatinib-mediated clinical responses result from inhibition of known imatinib targets, which include the KIT, ABL, ARG, and PDGFRA/B kinases. In other imatinib-responsive tumors, there is activation of a specific imatinib target because of genomic mutation or chromosomal translocation.10-14 In the case of AF, no such genomic abnormalities, involving imatinib-sensitive kinases, have been reported. The goal of the current study was to better define the activity of imatinib in the treatment of AF and to determine the molecular basis for response/nonresponse.


    PATIENTS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 REFERENCES
 
Study Design
Patients with primary or metastatic AF, Eastern Cooperative Oncology Group performance status of 0 to 2, and adequate end organ function were enrolled onto an open-label, phase II study.15 Prior systemic therapy for AF was allowed, with the exception of prior-imatinib therapy.

Patients were treated with 800 mg of imatinib daily (400 mg twice daily) with dose reductions for grade 3 toxicity or for recurrent grade 2 toxicity after an initial 1-week treatment break. The initial dose reduction was to 600 mg, with a second dose reduction to 400 mg allowed for further grade 3 toxicity or recurrent grade 2 toxicity after a 1-week treatment break. Full details of the clinical trial will be published separately.

Study investigations were performed after approval by a local human investigations committee and for United States centers in accord with an assurance filed with and approved by the US Department of Health and Human Services. Informed consent was obtained from each patient.

Tissue for Research
Archival pathology specimens were used for immunohistochemistry for CD117 and genomic DNA analyses. In seven cases, snap-frozen core biopsy tissue was obtained and used for protein and DNA analyses.

Assessment of Response
Best clinical response to imatinib were classified as complete responses, partial responses (PRs), stable disease (SD), progressive disease (PD), or nonevaluable determined using standard Southwest Oncology Group response criteria (pre-response evaluation criteria in solid tumors).16

Immunoblotting Studies
Protein lysates from frozen tumor specimens were immunoblotted for total and phosphorylated forms of KIT, PDGFRA, and PDGFRB as previously described.14,17 Additional immunoblot stains were performed using polyclonal rabbit antibodies to total p42/44 MAPK (Zymed Laboratories, South San Francisco, CA) and mouse monoclonal antibody to total STAT3 (clone ST3-5G7; Zymed Laboratories).

Measurement of Plasma PDGF-AA and PDGF-BB Levels
Peripheral venous blood was collected before initiating imatinib treatment and 1 month after starting therapy. Plasma samples were also collected from 20 healthy volunteers with a median age of 38 years (range, 22 to 59 years), nine of whom were male. Plasma PDGF-BB and PDGF-AA concentrations were determined using ELISA (R & D Systems, Minneapolis, MN) according to the manufacturer's recommendations.18

Analysis of KIT, PDGFRA, PDGFRB, and Beta-Catenin (CTNNB1) Mutations
Polymerase chain reaction (PCR) amplification of genomic DNA (gDNA) for KIT (exons 9, 11, 13, and 17) and PDGFRA (exons 12, 14, and 18) were performed and amplicons analyzed for mutations using denaturing, high-pressure liquid chromatography (WAVE; Transgenomics Inc, Omaha, NE).19,20 PCR amplification of gDNA for PDGFRB (exons 11 and 17) and CTNNB1 (exon 3) was performed using the following primer pairs:

PDGFRB exon 11 Forward: TGTCCTAGACGGACGAACC T and
Reverse: CCAACTTGCGTCCCCACACT
PDGFRB exon 17 Forward: CTTTCCCCACAATTGTCCC
Reverse: GAATCTGTTCCTGCGGTCAC
CTNNB1 exon 3 Forward: TTTGATGGAGTTGGACATGG
Reverse: CTGAGAAAATCCCTGTTCCC

Amplicons were analyzed for mutation of PDGRB or CTNNB1 using partially denaturing temperatures of 62.0°C for PDGFRB exon 11, 63.2°C for PDGFRB exon 17, and 61.5°C for CTNNB1 exon 3. Amplicons with abnormal denaturing, high-pressure liquid chromatography elution profiles were sequenced using an ABI 310 instrument to determine the nature of the mutations.20 All mutations were verified by repeat analysis.

Immunohistochemistry
Immunohistochemistry for KIT (CD117) was performed using the DakoCytomation rabbit antibody (A4502) both without and with epitope retrieval, as previously described.21 Pre-absorption of the antibody with a KIT peptide was used as a negative control.21

Statistical Analysis
Time to treatment failure (TTF) was estimated using the Kaplan-Meier method.22 For the TTF analysis, end point clinical events were defined as PD, patient death from any cause, withdrawal of patient consent, or discontinuation of therapy because of toxicity. The current report includes all available patient follow-up data through June 30, 2005.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 REFERENCES
 
A total of 19 patients with AF were enrolled into this study. The patient characteristics and primary clinical end points are presented in Table 1. The median patient age was 25 years (range, 17 to 63 years), and 12 of the 19 patients had AF that initially arose in the abdominal cavity. The remaining patients had AF arising in an extremity or trunk location. Eight patients had a personal and/or family history of familial adenomatous polyposis or Gardner syndrome.


View this table:
[in this window]
[in a new window]
 
Table 1. Summary of Patient Characteristics and Response to Imatinib Treatment

 
Our patient cohort had been heavily pretreated, with only one of 19 patients having untreated disease. Seventeen of 19 patients (89.5%) had undergone one or more surgical procedures (range, one to five curative intent resections). The two patients not undergoing prior surgery were deemed to have unresectable disease or disease that was unresectable without unacceptable morbidity. Most patients had also received one or more nonsurgical treatments, including radiotherapy (four of 19 patients; 21%) and/or chemotherapy (15 of 19 patients; 79%). The patients with a prior history of chemotherapy treatments had usually been exposed to multiple agents (range, one to eight). The most commonly used systemic agents were tamoxifen, nonsteroidal anti-inflammatory agents, doxorubicin, methotrexate, and vinblastine. Systemic treatments were typically given as a combination regimen, but some agents were used alone.

Three of 19 patients (15.7%) had a PR to treatment (≥ 50% tumor shrinkage). The imaging studies from two responding patients are shown in Figures 1 and 2. Notably, the PR in all three patients was fairly durable, with all PRs lasting longer than 1.5 years (range, 594 to 1,494+ days). [18F] fluorodeoxyglucose-positron emission tomography/computed tomography was used to monitor disease activity in patient 10, whose best response was SD (Fig 3). Despite the absence of disease shrinkage after 12 weeks of imatinib, there was a marked decrease in glucose uptake by this AF tumor, indicating a biologic effect of imatinib. Shortly after these imaging studies, the patient withdrew from the study because of gastrointestinal side effects of imatinib. No additional postimatinib imaging studies are available.


Figure 1
View larger version (137K):
[in this window]
[in a new window]
 
Fig 1. Imatinib induced objective partial responses in aggressive fibromatosis patients. Magnetic resonance imaging of patient 1. Brackets indicate the tumor location. The duration of imatinib therapy is listed above each image and tumor measurements are listed below each image.

 

Figure 2
View larger version (58K):
[in this window]
[in a new window]
 
Fig 2. Imatinib induced objective partial responses in aggressive fibromatosis patients. Computed tomography imaging of patient 11. Arrows indicate the tumor location. The duration of imatinib therapy is listed immediately above each image.

 

Figure 3
View larger version (40K):
[in this window]
[in a new window]
 
Fig 3. [18F] fluorodeoxyglucose (FDG)-positron emission tomography/computed tomography imaging of patient 10. Imatinib treatment resulted in a marked reduction in tumor-associated glucose uptake even though there was no change in overall tumor size. (A) Baseline; (B) 12 months of imatinib treatment.

 
Four patients had SD lasting more than 1 year before treatment failure, yielding an overall 1-year disease control rate of 36.8% (seven of 19 patients). Mace et al9 had previously reported PRs during imatinib therapy in two patients with extra-abdominal AF. In contrast, all three PRs in this study occurred in patients whose AF arose from an abdominal primary site (three of 12 patients; 25%). No PRs were seen in the seven patients with AF arising from an extra-abdominal primary site. The median TTF for the 19 patients was 325 days (Fig 4).


Figure 4
View larger version (9K):
[in this window]
[in a new window]
 
Fig 4. Kaplan-Meier analysis of time to treatment failure (TTF) for all patients. Vertical bars on the curve are used to indicate patients who were censored for failure-free survival.

 
Overall, imatinib therapy was well tolerated by this population of heavily pretreated patients. However, dose reductions for grade 3 or greater toxicity were required in the majority of patients. The most common toxicities requiring dose reduction were gastrointestinal (47%), dermatologic (16%), or hematologic (11%). The tolerability of 800 mg/d of imatinib in patients with AF was similar to that reported for gastrointestinal stromal tumor patients treated with the same total daily imatinib dose.23

Immunohistochemical Analyses
On the basis of our previous survey of commercially available antibodies, the DakoCytomation rabbit anti-KIT (A4502) was chosen for this study.21 Each case was stained with and without epitope retrieval, and a variety of positive and negative controls were included to ensure optimal staining. In most cases the majority of tumor cells showed KIT staining when epitope retrieval was used (Table 1). However, only three cases showed KIT staining in the absence of epitope retrieval.

Figure 5 illustrates the staining results for patient 8, whose best response was SD. The tumor had the typical morphologic features of AF (Fig 5A), and was negative for KIT staining without epitope retrieval (Fig 5B). With the addition of epitope retrieval, however, moderate staining of tumor cells was seen (Fig 5C), and this staining was specifically blocked by preincubation of the antibody with CD117 peptide (Fig 5D). The significance of the staining observed after epitope retrieval remains unclear, as the tumor from patient 8 proved negative for KIT by immunoblotting (see below and Fig 5). There was no correlation between the apparent KIT staining by immunohistochemistry and clinical response. PDGFRA and PDGFRB were not assessed by immunohistochemistry, because in our experience the current commercially available antibodies do not yield reliable staining for these kinases (not shown).


Figure 5
View larger version (144K):
[in this window]
[in a new window]
 
Fig 5. Immunohistochemistry (IHC) for KIT in aggressive fibromatosis (patient 8). (A) Hematoxylin and eosin stain (original magnification 100x). (B) IHC without epitope retrieval. Note positive staining of mast cells (asterisks) and absence of tumor cell staining (arrows; original magnification 400x). (C) IHC with epitope retrieval. In addition to staining of mast cells (asterisks), there is diffuse, moderate staining of tumor cells (original magnification 400x). (D) Blocking of IHC staining with peptide. Preincubation of the KIT antibody with the antigenic peptide eliminated nearly all of the tumor staining after epitope retrieval (original magnification 400x).

 
Immunoblotting Studies
To investigate the potential molecular basis of the clinical response of AF to imatinib, we performed immunoblotting studies, using matched pretherapy/on-therapy snap-frozen biopsy specimens from seven patients. The pretherapy biopsies were obtained within 1 month before starting imatinib, and the on-therapy biopsies were taken after approximately 1 month of imatinib. The protein lysates were immunoblotted to determine the expression of KIT, PDGFRA, and PDGFRB. In addition, we assayed for the presence of activated forms of these receptors as well as total and activated forms of other proteins involved in intracellular signaling. As controls for intracellular protein loading, we used several proteins, including total STAT3 and total MAPK (Fig 6).


Figure 6
View larger version (52K):
[in this window]
[in a new window]
 
Fig 6. Immunoblotting of pretreatment and on-treatment aggressive fibromatosis tumor samples. Lysates from PDGF-AA/PDGF-BB stimulated 3T3 cells were included as positive controls for total and phosphorylated forms of PDGFRA and PDGFRB (low = 2 µg of lysate, high = 10 µg). Lysates from gastrointestinal stromal tumor-662 were included as positive controls for total and phosphorylated forms of KIT.

 
KIT was detected in only two of the seven tumors, but at low levels (< 5% of the KIT present in a KIT-mutant gastrointestinal stromal tumor included for comparison). Moreover, there was no apparent KIT phosphorylation KIT in these samples (Fig 6, Table 2). PDGFRB was expressed at moderate-to-high levels (equivalent to levels expressed by 3T3 fibroblasts) in all cases that were analyzed, but phosphorylation was undetectable. PDGFRA expression and phosphorylation were weak-to-null in all cases. Two of the seven patients were imatinib-responders, but there was no correlation between KIT or PDGFRB expression and response. The absence of KIT protein by immunoblotting suggests that KIT staining apparent by immunohistochemistry after epitope retrieval is not necessarily reflective of actual KIT expression.


View this table:
[in this window]
[in a new window]
 
Table 2. Summary of KIT, PDGFRA, and PDGFRB Immunoblotting Results

 
To identify biomarkers for imatinib-responsive tumors, we performed immunoblotting for phosphorylated forms of AKT, MAPK, STAT3 and for total AKT, STAT3, PI3K, and MAPK (data not shown). However, we were unable to detect any correlation between the total and activated forms of these proteins and clinical response to imatinib. Likewise, expression of the proliferation markers proliferating cell nuclear antigen and p27 did not correlate with imatinib response.

Molecular Genotyping Analyses
DNA prepared from either paraffin-embedded tumor samples or nuclear fractions of fresh-frozen biopsy material was screened for mutations in the KIT, PDGFRA, and PDGFRB genes. No mutations were found.

Most AF are associated with abnormalities in the regulation of WNT pathway signaling, either because of germline/somatic inactivation of APC or somatic beta-catenin (CTNNB1) gain-of-function mutations.24-26 To test the hypothesis that the clinical response of AF to imatinib might correlate with the presence and/or type of WNT signaling pathway abnormality, we genotyped tumor specimens for activating mutations of CTNNB1 and obtained individual and family medical histories from enrolled patients.

Consistent with previous reports, 16 of 19 patients (84%) had either an activating mutation of CTNNB1 or a personal/family history of familial adenomatous polyposis (including Gardner syndrome) indicating a germline APC mutation (Table 1). However, there was no correlation between the presence or type of WNT signaling pathway abnormality and clinical response to imatinib treatment.

Plasma PDGF Levels
To explore the potential role of an autocrine/paracrine mechanism of activation of PDGFR in desmoids, we measured soluble PDGF-AA and PDGF-BB plasma levels in 14 patients that had matched samples obtained before initiation of imatinib and after 1 month of therapy (Table 3). The median pretreatment plasma levels of PDGF-AA and PDGF-BB were 290 and 340 pg/mL, respectively. In contrast, the median plasma PDGF-BB levels in 20 healthy patient controls was 187 pg/mL, and this value was significantly different from that obtained in AF patients before beginning imatinib (P = .007). There was no significant relationship between baseline PDGF-AA or PDGF-BB plasma levels and objective response to imatinib. However, the plasma log transform of the PDGF-BB level at 1 month had a significant inverse correlation with the TTF (P = .03).


View this table:
[in this window]
[in a new window]
 
Table 3. Plasma Levels of Soluble PDGF Ligands and Correlation With Clinical Response to Imatinib

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 REFERENCES
 
Fibroproliferative lesions are a group of disorders that are histologically characterized by an excessive proliferation of fibroblast-like spindle cells.1,27,28 Despite the clonal nature of AF, the cellular morphology shares many similarities with the reactive fibroblastic processes associated with wound healing. Recently, aberrant regulation of CTNNB1 was shown to link these two pathologic states. Inducible transgenic expression of a mutant, stabilized form of CTNNB1 produced AF tumors, hyperplastic gastrointestinal polyps, and hyperplastic wound healing responses to cutaneous injury.27 Notably, most human AF tumors are associated with germline or somatic mutation of APC or CTNNB1.8,24,26

We investigated the activity of imatinib (400 mg bid) in 19 patients with AF. Within this heavily pretreated population of patients, three of 19 patients (15.7%) had an objective PR using pre-response evaluation criteria in solid tumors conventional Southwest Oncology Group criteria. Notably, one patient continues to have an ongoing objective response lasting more than 3 years. Although the natural history of AF is variable, we believe that these objective responses are attributable to imatinib therapy. In addition, four other patients had SD that lasted for more than 1 year. All four patients had PD before study entry, so we speculate that the prolonged period of SD resulted from imatinib therapy.

We attempted to identify the potential molecular basis for the clinical response of AF tumors to imatinib, but were unable to identify any genomic mutations of KIT, PDGFRA, or PDGFRB that would result in constitutive activation of the kinase activity of these proteins. Nor could we identify any relationship between mutations of APC or CTNNB1 and clinical response to imatinib.

Mace et al9 investigated the expression of potential imatinib targets in nine AF lesions by immunohistochemistry and reverse transcriptase-PCR. They observed that all nine tumors had evidence of PDGFRA and PDGFRB expression, and that six were positive for KIT. There are, however, technical issues that impact on the interpretation of these findings. First, their study employed a PDGFRA antibody that, in our experience, does not yield specific staining. Second, the A4502 KIT antibody was used in their study at a concentration (1:100) that is two to three times higher than that used in other studies in the field, potentially contributing to false-positive staining.21,29

KIT staining in AF has been a point of controversy in the literature. Following a publication by Yantiss et al30 in which 75% of AF were deemed KIT positive by immunohistochemistry, other investigators took issue with this finding, noting that the concentration of the A4502 KIT antibody used in that study was high (1:30), and that epitope retrieval may have further biased the results.21,31-32 Knowing that immunohistochemistry for KIT can be problematic, we conducted our study using a staining protocol that was based on: (1) the A4502 antibody, which proved best in a comparison with several other commercially available antibodies, and (2) staining optimization using a number of controls, including antigenic peptide blocking.21 In addition, we examined the staining of each tumor with and without epitope retrieval, and compared apparent staining with the results of immunoblotting for KIT on the same tumors. Our results suggest that staining that is dependent on epitope retrieval does not represent true KIT expression in AF, and that most AFs do not express demonstrable levels of this imatinib target.

In contrast to the study by Mace et al9, we were unable to detect PDGFRA expression or activation in the AF tumors that we analyzed. However, all seven AF tumors expressed abundant PDGFRB protein in levels ranging from 31% to 199% of the levels found in control 3T3 lysates that were immunoblotted on the same membrane. We could not detect phosphorylated PDGFRB in either whole cell lysates or immunoprecipitates of AF tumors from nonstudy patients (data not shown). However, we have previously observed that in dermatofibrosarcoma protuberans, autocrine activation of PDGFRB is associated with levels of receptor phosphorylation that are substantially lower than that of activated PDGFRA in gastrointestinal stromal tumors with oncogenic mutation of PDGFRA.14,17 Theoretically, activation of PDGFRB in untreated AF tumors might be detectable using more sensitive techniques such as mass spectrometry or immunoaffinity purification of phospho-PDGFRB. It is also possible that PDGFRB activation in non-neoplastic elements of AF tumors, such as endothelial cells, may contribute to imatinib response. In support of a clinically relevant role of PDGFRB, we observed elevated plasma levels of PDGF ligands in patients with AF. Moreover, measurement of PDGF-BB 1 month after starting imatinib demonstrated that lower levels of PDGF-BB were associated with a longer TTF. However, it is not clear if elevated PDGF-ligand levels actually stimulate AF cell growth or merely correlates with tumor burden.

We conclude that imatinib has clinical activity in advanced AF. However, the optimal use of imatinib in this disease remains unclear and will require additional study. We speculate that PDGFRB may be the target imatinib-responsive kinase in this disease, but additional studies will be required to confirm this hypothesis and to identify biomarkers predictive of imatinib response/nonresponse in AF tumors.


    Authors' Disclosures of Potential Conflicts of Interest and Author Contributions.
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 REFERENCES
 
Although all authors completed the disclosure declaration, the following authors or their immediate family members indicated a financial interest. No conflict exists for drugs or devices used in a study if they are not being evaluated as part of the investigation. For a detailed description of the disclosure categories, or for more information about ASCO's conflict of interest policy, please refer to the Author Disclosure Declaration and the Disclosures of Potential Conflicts of Interest section in Information for Contributors.
Authors Employment Leadership Consultant Stock Honoraria Research Funds Testimony Other

Michael C. Heinrich Novartis (A) Novartis (A) Novartis (B)
Grant A. McArthur Novartis (A) Novartis (A) Novartis (B)
George D. Demetri Novartis (A) Novartis (A) Novartis (A)
Heikki. Joensuu Novartis (A) Novartis (B)
Richard Herrmann Novartis (A) Novartis (A) Novartis (B)
Hal Hirte Pfizer (A); Roche (A)
Christopher L. Corless Novartis (A) Novartis (A)
Stephan Dirnhofer Novartis (A)
Allan T. van Oosterom Novartis (A) Novartis (B)
Zariana Nikolova Novartis Pharma AG Novarits (A)
Sasa Dimitrijevic Novartis Pharma AG Novartis Pharma (B)
Jonathan A. Fletcher Novartis (A) Novartis (B)

Dollar Amount Codes (A) < $10,000 (B) $10,000-99,999 (C) ≥ $100,000 (N/R) Not Required


    Author Contributions
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 REFERENCES
 

Conception and design: Michael C. Heinrich, Grant A. McArthur, George D. Demetri, Heikki Joensuu, Christopher L. Corless, Allan T. van Oosterom, Zariana Nikolova, Sasa Dimitrijevic, Jonathan A. Fletcher

Administrative support: Michael C. Heinrich

Provision of study materials or patients: Michael C. Heinrich, Grant A. McArthur, George D. Demetri, Heikki Joensuu, Richard Herrmann, Hal Hirte, Sara Cresta, Allan T. van Oosterom

Collection and assembly of data: Michael C. Heinrich, Grant A. McArthur, George D. Demetri, Heikki Joensuu, Petri Bono, Richard Herrmann, Christopher L. Corless, Stephan Dirnhofer, Jonathan A. Fletcher

Data analysis and interpretation: Michael C. Heinrich, Grant A. McArthur, George D. Demetri, Heikki Joensuu, Petri Bono, Richard Herrmann, Hal Hirte, D. Bradley Koslin, Christopher L. Corless, Stephan Dirnhofer, Zariana Nikolova, Jonathan A. Fletcher

Manuscript writing: Michael C. Heinrich, Grant A. McArthur, George D. Demetri, Heikki Joensuu, Petri Bono, Christopher L. Corless, Stephan Dirnhofer, Jonathan A. Fletcher

Final approval of manuscript: Michael C. Heinrich, Grant A. McArthur, George D. Demetri, Heikki Joensuu, Petri Bono, Richard Herrmann, Hal Hirte, Sara Cresta, Christopher L. Corless, Stephan Dirnhofer, Allan T. van Oosterom, Zariana Nikolova, Sasa Dimitrijevic, Jonathan A. Fletcher

 


    Acknowledgment
 
We thank members of the OHSU Cancer Institute Biostatistics and Bioinformatics Shared Resource (NIH 5P30 CA69533-04) for data analyses.


    NOTES
 
Supported by Grants from Novartis Oncology and a VA Merit Review Grant (MCH).

Authors' disclosures of potential conflicts of interest and author contributions are found at the end of this article.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 REFERENCES
 
1. Alman BA, Pajerski ME, az-Cano S, et al: Aggressive fibromatosis (desmoid tumor) is a monoclonal disorder. Diagn Mol Pathol 6:98-101, 1997[CrossRef][Medline]

2. Biermann JS: Desmoid tumors. Curr Treat Options Oncol 1:262-266, 2000[Medline]

3. Hoos A, Lewis JJ, Antonescu CR, et al: Characterization of molecular abnormalities in human fibroblastic neoplasms: A model for genotype-phenotype association in soft tissue tumors. Cancer Res 61:3171-3175, 2001[Abstract/Free Full Text]

4. Schnitzler M, Cohen Z, Blackstein M, et al: Chemotherapy for desmoid tumors in association with familial adenomatous polyposis. Dis Colon Rectum 40:798-801, 1997[CrossRef][Medline]

5. Ballo MT, Zagars GK, Pollack A: Radiation therapy in the management of desmoid tumors. Int J Radiat Oncol Biol Phys 42:1007-1014, 1998[CrossRef][Medline]

6. Pignatti G, Barbanti-Brodano G, Ferrari D, et al: Extraabdominal desmoid tumor: A study of 83 cases. Clin Orthop Relat Res 375:207-213, 2000[CrossRef][Medline]

7. Smith AJ, Lewis JJ, Merchant NB, et al: Surgical management of intra-abdominal desmoid tumours. Br J Surg 87:608-613, 2000[CrossRef][Medline]

8. Knudsen AL, Bulow S: Desmoid tumour in familial adenomatous polyposis: A review of literature. Fam Cancer 1:111-119, 2001[Medline]

9. Mace J, Sybil BJ, Sondak V, et al: Response of extraabdominal desmoid tumors to therapy with imatinib mesylate. Cancer 95:2373-2379, 2002[CrossRef][Medline]

10. Druker BJ, Talpaz M, Resta DJ, et al: Efficacy and safety of a specific inhibitor of the bcr-abl tyrosine kinase in chronic myeloid leukemia. N Engl J Med 344:1031-1037, 2001[Abstract/Free Full Text]

11. Van Oosterom AT, Judson I, Verweij J, et al: Safety and efficacy of imatinib (STI571) in metastatic gastrointestinal stromal tumours: A phase I study. Lancet 358:1421-1423, 2001[CrossRef][Medline]

12. Apperley JF, Gardembas M, Melo JV, et al: Response to imatinib mesylate in patients with chronic myeloproliferative diseases with rearrangements of the platelet-derived growth factor receptor beta. N Engl J Med 347:481-487, 2002[Abstract/Free Full Text]

13. Demetri GD, von Mehren M, Blanke CD, et al: Efficacy and safety of imatinib mesylate in advanced gastrointestinal stromal tumors. N Engl J Med 347:472-480, 2002[Abstract/Free Full Text]

14. McArthur GA, Demetri GD, van Oosterom A, et al: Molecular and clinical analysis of locally advanced dermatofibrosarcoma protuberans treated with imatinib: Imatinib target exploration consortium study b2225. J Clin Oncol 23:866-873, 2005[Abstract/Free Full Text]

15. Corless C, Heinrich M, Dimitrijevic S, et al: Correlation of imatinib response with activation of KIT and PDGF receptors in a variety of cancers: Results of the CSTIB2225 trial. 39th Annual Meeting of the American Society of Clinical Oncology, Chicago, IL, May 31-June 3, 2003 (abstr 195)

16. Green S, Weiss GR: Southwest Oncology Group standard response criteria, endpoint definitions and toxicity criteria. Invest New Drugs 10:239-253, 1992[CrossRef][Medline]

17. Duensing A, Medeiros F, McConarty B, et al: Mechanisms of oncogenic KIT signal transduction in primary gastrointestinal stromal tumors (GISTs). Oncogene 23:3999-4006, 2004[CrossRef][Medline]

18. Bono P, Krause A, von Mehren M, et al: Serum KIT and KIT ligand levels in patients with gastrointestinal stromal tumors treated with imatinib. Blood 103:2929-2935, 2004[Abstract/Free Full Text]

19. Medeiros F, Corless CL, Duensing A, et al: KIT-negative gastrointestinal stromal tumors: Proof of concept and therapeutic implications. Am J Surg Pathol 28:889-894, 2004[Medline]

20. Heinrich MC, Corless CL, Demetri GD, et al: Kinase mutations and imatinib response in patients with metastatic gastrointestinal stromal tumor. J Clin Oncol 21:4342-4349, 2003[Abstract/Free Full Text]

21. Went PT, Dirnhofer S, Bundi M, et al: Prevalence of KIT expression in human tumors. J Clin Oncol 22:4514-4522, 2004[Abstract/Free Full Text]

22. Kaplan EL, Meier P: Nonparametric estimation from incomplete observations. J Amer Stat Assoc 53:457-481, 1958[CrossRef]

23. Verweij J, Casali PG, Zalcberg J, et al: Progression-free survival in gastrointestinal stromal tumours with high-dose imatinib: Randomised trial. Lancet 364:1127-1134, 2004[CrossRef][Medline]

24. Alman BA, Li C, Pajerski ME, et al: Increased beta-catenin protein and somatic APC mutations in sporadic aggressive fibromatoses (desmoid tumors). Am J Pathol 151:329-334, 1997[Abstract]

25. Li C, Bapat B, Alman BA: Adenomatous polyposis coli gene mutation alters proliferation through its beta-catenin-regulatory function in aggressive fibromatosis (desmoid tumor). Am J Pathol 153:709-714, 1998[Abstract/Free Full Text]

26. Miyoshi Y, Iwao K, Nawa G, et al: Frequent mutations in the beta-catenin gene in desmoid tumors from patients without familial adenomatous polyposis. Oncol Res 10:591-594, 1998[Medline]

27. Cheon SS, Cheah AY, Turley S, et al: Beta-Catenin stabilization dysregulates mesenchymal cell proliferation, motility, and invasiveness and causes aggressive fibromatosis and hyperplastic cutaneous wounds. Proc Natl Acad Sci U S A 99:6973-6978, 2002[Abstract/Free Full Text]

28. Li M, Cordon-Cardo C, Gerald WL, et al: Desmoid fibromatosis is a clonal process. Hum Pathol 27:939-943, 1996[CrossRef][Medline]

29. Lucas DR, al-Abbadi M, Tabaczka P, et al: C-Kit expression in desmoid fibromatosis: Comparative immunohistochemical evaluation of two commercial antibodies. Am J Clin Pathol 119:339-345, 2003[Abstract/Free Full Text]

30. Yantiss RK, Spiro IJ, Compton CC, et al: Gastrointestinal stromal tumor versus intra-abdominal fibromatosis of the bowel wall: A clinically important differential diagnosis. Am J Surg Pathol 24:947-957, 2000[CrossRef][Medline]

31. Miettinen M: Are desmoid tumors kit positive? Am J Surg Pathol 25:549-550, 2001[CrossRef][Medline]

32. Hornick JL, Fletcher CD: Immunohistochemical staining for KIT (CD117) in soft tissue sarcomas is very limited in distribution. Am J Clin Pathol 117:188-193, 2002[Abstract/Free Full Text]

Submitted September 2, 2005; accepted December 12, 2005.


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Facebook Facebook   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
JCOHome page
S. George, P. Merriam, R. G. Maki, A. D. Van den Abbeele, J. T. Yap, T. Akhurst, D. C. Harmon, G. Bhuchar, M. M. O'Mara, D. R. D'Adamo, et al.
Multicenter Phase II Trial of Sunitinib in the Treatment of Nongastrointestinal Stromal Tumor Sarcomas
J. Clin. Oncol., July 1, 2009; 27(19): 3154 - 3160.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
E. Raymond, A. A. Brandes, C. Dittrich, P. Fumoleau, B. Coudert, P. M.J. Clement, M. Frenay, R. Rampling, R. Stupp, J. M. Kros, et al.
Phase II Study of Imatinib in Patients With Recurrent Gliomas of Various Histologies: A European Organisation for Research and Treatment of Cancer Brain Tumor Group Study
J. Clin. Oncol., October 1, 2008; 26(28): 4659 - 4665.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. C. Heinrich, H. Joensuu, G. D. Demetri, C. L. Corless, J. Apperley, J. A. Fletcher, D. Soulieres, S. Dirnhofer, A. Harlow, A. Town, et al.
Phase II, Open-Label Study Evaluating the Activity of Imatinib in Treating Life-Threatening Malignancies Known to Be Associated with Imatinib-Sensitive Tyrosine Kinases
Clin. Cancer Res., May 1, 2008; 14(9): 2717 - 2725.
[Abstract] [Full Text] [PDF]


Home page
RadioGraphicsHome page
E. S. McDonald, E. S. Yi, and D. E. Wenger
Best Cases from the AFIP: Extraabdominal Desmoid-type Fibromatosis
RadioGraphics, May 1, 2008; 28(3): 901 - 906.
[Full Text] [PDF]


Home page
Jpn J Clin OncolHome page
K. Ezumi, H. Yamamoto, I. Takemasa, M. Nomura, M. Ikeda, M. Sekimoto, and M. Monden
Dacarbazine-Doxorubicin Therapy Ameliorated an Extremely Aggressive Mesenteric Desmoid Tumor Associated with Familial Adenomatous Polyposis: Report of a Case
Jpn. J. Clin. Oncol., March 1, 2008; 38(3): 222 - 226.
[Abstract] [Full Text] [PDF]


Home page
Am Soc Clin Oncol Ed BookHome page
P. G. Casali
Clinical Decision-making in Rare Tumors: What Is Needed from Clinical Trials
ASCO Educational Book, January 1, 2008; 2008(1): 530 - 533.
[Abstract] [Full Text] [PDF]


Home page
Mayo Clin Proc.Home page
K. M. Skubitz and D. R. D'Adamo
Sarcoma
Mayo Clin. Proc., November 1, 2007; 82(11): 1409 - 1432.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S. Signoroni, M. Frattini, T. Negri, E. Pastore, E. Tamborini, P. Casieri, M. Orsenigo, L. Da Riva, P. Radice, P. Sala, et al.
Cyclooxygenase-2 and Platelet-Derived Growth Factor Receptors as Potential Targets in Treating Aggressive Fibromatosis
Clin. Cancer Res., September 1, 2007; 13(17): 5034 - 5040.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
T. Guo, N. P. Agaram, G. C. Wong, G. Hom, D. D'Adamo, R. G. Maki, G. K. Schwartz, D. Veach, B. D. Clarkson, S. Singer, et al.
Sorafenib Inhibits the Imatinib-Resistant KITT670I Gatekeeper Mutation in Gastrointestinal Stromal Tumor
Clin. Cancer Res., August 15, 2007; 13(16): 4874 - 4881.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
D. Lev, D. Kotilingam, C. Wei, M. T. Ballo, G. K. Zagars, P. W.T. Pisters, A. A. Lazar, S. R. Patel, R. S. Benjamin, and R. E. Pollock
Optimizing Treatment of Desmoid Tumors
J. Clin. Oncol., May 1, 2007; 25(13): 1785 - 1791.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
S. X. Skapek, W. S. Ferguson, L. Granowetter, M. Devidas, A. R. Perez-Atayde, L. P. Dehner, F. A. Hoffer, R. Speights, M. C. Gebhardt, G. V. Dahl, et al.
Vinblastine and Methotrexate for Desmoid Fibromatosis in Children: Results of a Pediatric Oncology Group Phase II Trial
J. Clin. Oncol., February 10, 2007; 25(5): 501 - 506.
[Abstract] [Full Text] [PDF]


Home page
Ann. Surg. Oncol.Home page
N. Steeghs, J. W. R. Nortier, and H. Gelderblom
Small Molecule Tyrosine Kinase Inhibitors in the Treatment of Solid Tumors: An Update of Recent Developments
Ann. Surg. Oncol., February 1, 2007; 14(2): 942 - 953.
[Abstract] [Full Text] [PDF]


Home page
Diabetes CareHome page
F. Folli, G. Galimberti, M. Pastore, A. M. Davalli, and E. Bosi
Paraneoplastic insulin resistance syndrome in advanced aggressive fibromatosis (desmoid tumor) treated by imatinib mesylate.
Diabetes Care, September 1, 2006; 29(9): 2178 - 2180.
[Full Text] [PDF]


Home page
JCOHome page
M. E. Ray and T. S. Lawrence
Radiation Therapy for Aggressive Fibromatosis (desmoid tumor)
J. Clin. Oncol., August 1, 2006; 24(22): 3714 - 3715.
[Full Text] [PDF]


Home page
JCOHome page
G. D. Demetri and M. C. Heinrich
In Reply
J. Clin. Oncol., August 1, 2006; 24(22): 3715 - 3715.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Heinrich, M. C.
Right arrow Articles by Fletcher, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Heinrich, M. C.
Right arrow Articles by Fletcher, J. A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

About
JCO
 Editorial
Roster
 Advertising
Information
 Librarians &
Institutions
 Rights &
Permissions
 PDA Services

Copyright © 2006 by the American Society of Clinical Oncology, Online ISSN: 1527-7755. Print ISSN: 0732-183X
Terms and Conditions of Use
  HighWire Press HighWire Press™ assists in the publication of JCO Online