|
|||||
|
|
||||||
Journal of Clinical Oncology, Vol 25, No 22 (August 1), 2007: pp. 3198-3204 © 2007 American Society of Clinical Oncology. DOI: 10.1200/JCO.2006.10.3028 Bone Marrow Transplantation Generates Immature Oocytes and Rescues Long-Term Fertility in a Preclinical Mouse Model of Chemotherapy-Induced Premature Ovarian Failure
From the Vincent Center for Reproductive Biology and Center for Regenerative Medicine, Massachusetts General Hospital/Harvard Medical School, Boston, MA Address reprint requests to Jonathan L. Tilly, PhD, Massachusetts General Hospital, THR-901B, 55 Fruit St, Boston, MA 02114; e-mail: jtilly{at}partners.org
Purpose Although early menopause frequently occurs in female cancer patients after chemotherapy (CTx), bone marrow (BM) transplantation (BMT) has been linked to an unexplained return of ovarian function and fertility in some survivors. Studies modeling this in mice have shown that BMT generates donor-derived oocytes in CTx-treated recipients. However, a subsequent report claimed that ovulated eggs are not derived from BM and that BM-derived oocytes reported previously are misidentified immune cells. This study was conducted to further clarify the impact of BMT on female reproductive function after CTx using a preclinical mouse model. Methods Female mice were administered CTx followed by BMT using coat color-mismatched female donors. After housing with males, the number of pregnancies and offspring genotype were recorded. For cell tracking, BM from germline-specific green fluorescent protein-transgenic mice was transplanted into CTx-treated wild-type recipients. Immune cells were sorted from blood and analyzed for germline markers. Results BMT rescued long-term fertility in CTx-treated females, but all offspring were derived from the recipient germline. Cell tracking showed that donor-derived oocytes were generated in ovaries of recipients after BMT, and two lines of evidence dispelled the claim that these oocytes are misidentified immune cells. Conclusion These data from a preclinical mouse model validate a testable clinical strategy for preserving or resurrecting ovarian function and fertility in female cancer patients after CTx, thus aligning with recommendations of the 2005 National Cancer Institute Breast Cancer Progress Review Group and President's Cancer Panel to prioritize research efforts aimed at improving the quality of life in cancer survivors.
In 2005, more than 660,000 women in the United States were diagnosed with cancer, 8% of whom were of prereproductive or reproductive age.1 Although the incidence of this disease increases each year, earlier detection and more effective treatments have reduced cancer-related mortalities by almost 1% per year since the 1990s. These improved chances for long-term survival have made the quality of life of cancer survivors a top research priority for the 2005 Breast Cancer Progress Review Group of the National Cancer Institute (http://deainfo.nci.nih.gov/advisory/pog/progress/index.htm) and the President's Cancer Panel (http://deainfo.nci.nih.gov/advisory/pcp/pcp.htm). One of the most devastating adverse effects of cancer treatments is damage to the reproductive system, which in young girls and women less than 40 years old is frequently associated with premature menopause and infertility (http://www.fertilehope.org).2-4 These outcomes seem to be, in large part, a result of cytotoxic effects on germ cells (oocytes) housed within the ovaries.5 Because of the near-universally accepted dogma that oocytes are endowed as a fixed and nonrenewing stockpile at birth,6,7 pathologic destruction of oocytes has been viewed as irreversible. Thus, experimental approaches aimed at sustaining fertility in female cancer survivors have been directed solely at preservation of existing oocytes.2-5,8,9 If, however, oocyte loss after treatment with highly cytotoxic agents is supposedly irreversible, then a puzzling observation repeatedly made over the past decade or so is an unexpected return of ovarian function and fertility in some reproductive-age women rendered prematurely menopausal by high-dose chemotherapy (CTx) if these patients undergo bone marrow (BM) transplantations (BMT) as part of their treatment protocol.10-13 One possible explanation for this may relate to a recent study we conducted with mice that has challenged the dogma of a fixed and nonrenewing oocyte stockpile being set forth in mammalian females at birth.14 Although this work was met with skepticism,15,16 independent corroboration that new oocytes are produced in adult females is now available17 and actually has been for decades.18-21 Of perhaps greater relevance to the clinical observations discussed earlier is a subsequent study that identified putative germ cells in BM that generate oocytes in CTx-treated female mice after transplantation.22 This work was also met with skepticism because these findings depart from traditional thinking that postnatal gametogenesis is confined to the gonads.15,18 However, germ cells have been identified by others in human and rat BM samples.23,24 Furthermore, male and female gametes have been generated from mouse embryonic stem cells,25-30 and oocyte-like cells have been produced from porcine skin and rat pancreatic stem cells.31,32 Moreover, and consistent with the work discussed earlier,22 spermatogonia have been derived from BM of adult male mice and men.33,33a,33b Nevertheless, a new study with mice has concluded that mature ovulated eggs are not derived from BM or circulating (blood) cells,34 raising doubts over whether stem-cell transplantation could be considered as a viable therapeutic option to revive ovarian function and fertility in women after CTx, as has recently been suggested.22,35 Given the controversial nature and the considerable clinical ramifications of this new line of inquiry, herein we sought to clarify the effects of BMT on female reproductive function using a preclinical mouse model of CTx-induced premature ovarian failure.
Animals C57BL/6 and 129/Sv mice were from Charles River (Wilmington, MA). FVB mice were from Taconic (Germantown, NY). TgOG2 transgenic mice with germline-specific expression of green fluorescent protein (GFP) were from K.J. MacLaughlin (University of Pennsylvania, Kennett Square, PA).36-38 Transgenic mice with GFP expression driven ubiquitously by the chicken ß-actin promoter [strain Tg(GFPU)5Nagy/J or C57BL/6-Tg(ACTB-EGFP)1Osb/J] were from Jackson Laboratory (Bar Harbor, ME). The institutional Animal Care and Use Committee of Massachusetts General Hospital approved all procedures.
Transplantations
Mating Trials
Donor Cell Tracking and Follicle Counts
Gene Expression
Flow Cytometry
BMT Rescues Long-Term Fertility Over the course of the 7-month mating trial, all (10 of 10) nontreated females achieved five successful (live-birth) pregnancies, and 80% (eight of 10) achieved six successful pregnancies (Fig 1A). Females administered nonlethal doses of CTx (busulfan 12 mg/kg, cyclophosphamide 120 mg/kg) without BMT became infertile, with the vast majority (10 of 13 mice) achieving three or less live-birth pregnancies and none achieving six live-birth pregnancies (Fig 1A). In mice that underwent BMT 1 week after nonlethal CTx, one never achieved a pregnancy. However, 90% of the mice that received BMT 1 week after nonlethal CTx achieved at least four live-birth pregnancies, 80% (eight of 10 mice) achieved five pregnancies, and 70% (seven of 10 mice) achieved six pregnancies (Fig 1A). There was a slight reduction in pups per litter in mice receiving nonlethal CTx plus BMT (6.3 ± 0.3 pups per litter) versus nontreated controls (7.6 ± 0.2 pups per litter; P = .02).
To assess the effect of the timing of BMT and mating initiation on fertility outcome, additional females were treated as follows and analyzed in parallel: (1) nonlethal CTx followed by BMT 1 week later, with mating initiated 2 months after treatment; (2) nonlethal CTx, with BMT and mating initiated 2 months after treatment; and (3) nonlethal CTx without BMT, with mating initiated 2 months after treatment. In animals administered nonlethal CTx without BMT, live-birth pregnancy rates were comparable irrespective of whether mating was initiated 1 week (Fig 1A) or 2 months (Fig 1B) later. Females administered nonlethal CTx followed by BMT 1 week later but with mating initiation postponed for 2 months (Fig 1B) showed a marked reduction in live-birth pregnancy rates compared with mice administered nonlethal CTx with both BMT and mating initiation performed 1 week later (Fig 1A). If both BMT and mating were postponed for 2 months in females administered nonlethal CTx, the beneficial effects of BMT on fertility rescue were markedly attenuated (Fig 1B). We also tested the effect of increasing the CTx dose on the ability of BMT to rescue fertility when BMT and mating initiation were performed 1 week after CTx. Of eight female mice administered median lethal doses (LD50) of CTx (busulfan 20 mg/kg, cyclophosphamide 200 mg/kg) without BMT, four died within 2 months, and no pregnancies were observed in these animals before death. Of the four females that survived long term, three (75%) achieved a live-birth pregnancy after the first mating, but none achieved a second pregnancy at any point over the remainder of the mating trial (Fig 1C). By comparison, only 25% (two of eight females) of the females exposed to LD50 CTx died afterwards if BMT was performed within 1 week of treatment, and one of these two females achieved a live-birth pregnancy before death. Of the six females that survived long term, five achieved one (83%), two achieved two (33%), and one (17%) achieved five live-birth pregnancies (Fig 1C).
BM-Derived Cells Generate Immature Oocytes
Donor BM–Derived Oocytes Are Not Misidentified CD45+ Cells Using ubiquitous GFP-expressing transgenic mice, Eggan et al34 recently concluded that donor-derived mature eggs were never observed in the oviducts of superovulated female mice after parabiotic blood exchange or BMT but that GFP-expressing cells found associated with ovulated eggs were CD45+ leukocytes. These authors then conjectured that "such circulating or bone-marrow-derived cells that travel to the ovary may in some cases coexpress or costain with markers typically associated with female germ cells" as an alternative explanation for the donor-derived immature oocytes we identified in recipient females after BMT in an earlier report.22 To assess the validity of this, blood-derived mononuclear cells were isolated from WT and transgenic adult female mice with germline-specific (TgOG2) or ubiquitous (ß-actin promoter) GFP expression. Flow cytometric analysis showed that CD45+/GFP-positive cells were present in ß-actin–GFP, but not TgOG2, transgenic mice (Figs 3A to 3C). Thus, it is highly unlikely that GFP-positive oocytes detected in ovaries of WT females after transplantation using TgOG2 mice as donors22 represent misidentified CD45+ leukocytes because TgOG2 CD45+ cells do not express GFP. In further support of this, CD45+/GFP-negative and CD45+/GFP-positive (where possible) cells were isolated from blood of WT, TgOG2, and ß-actin–GFP females and analyzed for expression of markers used earlier to identify germline cells in BM or blood.22 Although ß-actin was detected in all samples, we did not detect germ cell markers in any CD45+ cell fractions (Fig 3D). However, all germline markers were, as expected, present in adult ovary analyzed in parallel (Fig 3D).
The quality of life of cancer survivors after chemotherapeutic or radiologic treatments is of growing concern,41 with a particular emphasis on methods for preserving gonadal function and fertility.4,42 Until recently, fertility preservation protocols in females have been constrained by the belief that the oocyte reserve endowed at birth is fixed and irreplaceable. However, recent studies challenging this dogma14,19,22 have offered the possibility of oocyte regeneration as a viable option to revive ovarian function and fertility after exposure to gonadotoxic therapies.22,35 Although this line of reasoning is already indirectly supported by clinical reports linking stem-cell transplantations to a spontaneous and as-yet unexplained return of ovarian function and natural fertility in some women rendered prematurely menopausal by high-dose CTx,10-13,35 this work remains quite controversial.14-19,34 Addressing this issue directly using a preclinical mouse model of CTx-induced ovarian failure, herein, we observed a rescue of long-term fertility in CTx-treated females by BMT that was influenced by several variables. First, the timing of the transplantation was important, in that a maximal benefit was achieved when BMT was performed 1 week (v 2 months) after CTx. The amount of CTx was a key variable as well because BMT was only marginally effective at rescuing fertility when the doses of CTx were increased to LD50 values. A third variable was the timing of mating initiation after BMT. Although a beneficial effect of BMT was observed in CTx-treated females when mating was postponed for 2 months, the percentage of these females that exhibited long-term reproductive potential was considerably less than that observed when females became pregnant shortly after BMT. Because the timing of mating initiation was without effect in females administered CTx alone, a synergistic interaction apparently exists between metabolic or hormonal changes associated with pregnancy and the profertility effects of BMT. Interestingly, all of the offspring produced by CTx-treated females whose fertility was rescued by BMT were derived from the recipient germline, despite the fact that cell tracking experiments confirmed the presence of donor BM–derived oocytes in their ovaries. However, the number of GFP-positive oocytes was low, in the range of that reported for other models in which donor somatic cell engraftment has been monitored after BMT.43 Furthermore, donor-derived oocytes were only observed in immature follicles up to the preantral stage of development but never observed in maturing antral or Graafian follicles from which ovulated eggs are derived (for more information on mammalian follicular dynamics, see Appendix and Hirshfield44 and Gougeon45). Accordingly, BMT rescues long-term fertility by either protecting existing oocytes from CTx or reinstituting recipient oogenesis. Although we have no direct evidence ruling out the first possibility, it is unlikely for the following reasons. First, the rescue of fertility by BMT was not transient but sustained long term, even though the follicle reserve in CTx-treated females 2 months after BMT was 25% of that observed in nontreated controls. Because follicle numbers dictate the timing of ovarian failure,46 it is unlikely that the reproductive life span of CTx-treated females after BMT would be similar to nontreated controls unless their compromised follicle reserve was being replenished at some low rate. Second, a near-complete rescue of fertility was achieved when BMT was performed 1 week after CTx, well after the drugs have exerted their detrimental effects and been removed from the body. In fact, a profertility effect of BMT was still observed, albeit diminished, when the transplantations were performed 2 months after the insult. Past studies have shown that fertility preservation in female mice exposed to anticancer therapy can be achieved with a known protective agent if it is administered before the insult.8,9 Furthermore, oocytes exposed to CTx irreversibly commit to fragmentation (death) within 4 hours.47 Given all of this, it is unlikely that BMT rescues fertility by salvaging a sufficient number of existing oocytes 1 week after CTx exposure to sustain normal long-term reproductive potential. Therefore, we believe that BMT functions primarily by reactivating host oogenesis, which becomes impaired in a BMT-reversible manner after CTx through either direct effects of the drugs on the cells responsible for oogenesis (eg, cell cycle arrest) or indirect effects of the drugs on the microenvironments (niches) that support the aforementioned cells. It is also possible that CTx damages the ovaries such that engraftment or differentiation of germ cells fails to occur unless the gonadal microenvironment is repaired by the transplanted somatic cells or by factors released from the transplanted cells. This line of reasoning fits with recent studies of male germline stem-cell function in mice, in which nongermline-dependent alterations in the testicular microenvironment were identified as being a principal cause of age-related spermatogenic failure and testicular atrophy.48 Indeed, preliminary data from our lab have shown that transplantation of BM harvested from young adult TgOG2 female mice into WT female mice of advanced age does not generate immature oocytes and follicles.49 Although the age-related changes in the ovaries that preclude oocyte formation in aged females after transplantation remain unknown, these findings underscore the need to consider the niche in which new germ cells are made as well as the niche into which these cell engraft and differentiate as equally important issues. In addition, at least for high-dose CTx-exposed females in which BMT reduced post-treatment lethality, BMT might also rescue fertility as part of a more global beneficial effect of BMT on overall health. In summary, this study supports and extends past work from our lab22 and others23,24,33,33a,33b identifying cells with germline potential in BM of adult mammals. Although Eggan et al34 recently claimed, without supporting data, that donor-derived immature oocytes detected in the ovaries of female mice after transplantation22 actually represent CD45+ immune cells, experiments conducted herein to directly test the validity of this have proven it to be incorrect. Furthermore, as demonstrated in the online Appendix, the use of ß-actin–GFP transgenic mice for donor germ cell tracking, as reported by Eggan et al,34 has considerable limitations. However, our data do indicate that these BM-derived germ cells apparently do not mature for ovulation or fertilization. Nevertheless, the ability of BMT to rescue long-term fertility in CTx-treated female mice and the clinical case studies linking BMT to a return of fertility in female cancer patients10-13 clearly justify additional testing of adult stem-cell–based technologies as a potential new strategy for the management of gonadal failure and infertility in female cancer survivors. In the interim, female cancer patients should still be referred for established fertility preservation protocols as per the recently recommended guidelines from the American Society of Clinical Oncology.4
The author(s) indicated no potential conflicts of interest.
Conception and design: Jonathan L. Tilly Financial support: Jonathan L. Tilly Collection and assembly of data: Ho-Joon Lee, Kaisa Selesniemi, Yuichi Niikura, Teruko Niikura, Rachael Klein, David M. Dombkowski Data analysis and interpretation: Ho-Joon Lee, Kaisa Selesniemi, Yuichi Niikura, Rachael Klein, Jonathan L. Tilly Manuscript writing: Jonathan L. Tilly Final approval of manuscript: Ho-Joon Lee, Kaisa Selesniemi, Yuichi Niikura, Teruko Niikura, Rachael Klein, David M. Dombkowski, Jonathan L. Tilly
Sequence Information for Polymerase Chain Reaction Primers (Gene Expression Analyses) Forward and reverse primers used (5'-3') for reverse transcriptase polymerase chain reaction analysis were as follows, with GenBank accession numbers and references (where appropriate) provided: murine Mvh (NM_010029) (Fujiwara Y, Komiya T, Kawabata H, et al. Proc Natl Acad Sci U S A 91:12258-12262, 1994): GGAAACCAGCAGCAAGTGAT and TGGAGTCCTCATCCTCTGG; murine Nohma (AY626343) (Pangas SA, Yan W, Matzuk MM, et al. Gene Expr Patterns 5:257-263, 2004): GTCCCAACACCTTTTCACA and AGACACATCAAGTTCAGATG; murine Oog3 (NM_201258) (Dade S, Callebaut I, Mermillod P, et al. FEBS Lett 555:533-538, 2003): TCACAGATTCCCTCAGTATG and GCATTTTTATTGTTTATCTCA; murine Tex101/Ts101rp (NM_019981) (Kurita A, Takizawa T, Takayama T, et al. Biol Reprod 64:935-945, 2001; Takayama T, Mishima T, Mori M, et al. Biol Reprod 72:1315-1323, 2005): TAGACCGTTCCCAGGTCTTG and AGCACTGAGTTGTGCCATTG; murine Nobox (AY061761) (Suzumori N, Yan C, Matzuk MM, et al. Mech Dev 111:137-141, 2002; Rajkovic A, Pangas SA, Ballow D, et al. Science 305:1157-1159, 2004): CCCTTCAGTCACAGTTTCCGT and GTCTCTACTCTAGTGCCTTCG; murine Stella (AY082485) (Saitou M, Barton SC, Surani MA. Nature 418:293-300, 2002): CCCAATGAAGGACCCTGAAAC and AATGGCTCACTGTCCCGTTCA; murine Dazl (NM_010021) (Cooke HJ, Lee M, Kerr S, et al. Hum Mol Genet 5:513-516, 1996): GTGTGTCGAAGGGCTATGGAT and ACAGGCAGCTGATATCCAGTG; green fluorescent protein (GFP): TCCTTGAAGAAGATGGTGCG and AAGTTCATCTGCACCACCG; and murine ß-actin (X03672 [GenBank] ): GATGACGATATCGCTGCGCTG and GTACGACCAGAGGCATACAGG.
Germline Markers Remain Detectable in Bone Marrow After Chemotherapy
Oocytes of ß-actin–GFP Transgenic Mice Exhibit Heterogeneity in Reporter Expression During the course of analyzing CD45+ cells from the ß-actin–GFP line (Fig 3 in article), we noted that approximately one third of circulating CD45+ cells did not express GFP. Because the strength of conclusions drawn from cell tracking experiments in transplanted animals using this transgenic line as a reporter (Eggan K, Jurga S, Gosden RG, et al. Nature 441:1109-1114, 2006) is dependent on uniform expression of the marker in the cell lineage of interest, we tested the fidelity of GFP expression in immature and mature oocytes of adult ß-actin–GFP transgenic female mice. First, ovaries were removed and analyzed for GFP expression by immunohistochemistry, as detailed in the accompanying article. Similar to the variability in GFP expression observed in CD45+ cells in blood (Fig 3 in article), a wide range of transgene expression was detected in immature oocytes in the ovaries, with highly positive oocytes found adjacent to other oocytes that exhibited minimal or no detectable GFP expression (Appendix Figs A2A to A2C). Second, epifluorescence analysis of oocytes obtained from oviducts of adult ß-actin–GFP transgenic female mice after superovulation revealed a somewhat more uniform expression of the transgene, although one ovulated oocyte of a total of 55 analyzed required digital image enhancement to visualize a low level of GFP expression (Appendix Figs A2D to A2F).
In our earlier experiments (Johnson J, Bagley J, Skaznik-Wikiel M, et al. Cell 122:303-315, 2005) and those shown herein, we used donor transgenic mice with germline-specific expression of GFP (TgOG2) to maximize reliable detection of donor-derived germ cells after transplantation. Indeed, the GFP-positive immature oocytes detected in the ovaries of transplanted WT females after BMT were found to coexpress a suite of markers confirming their phenotype as both germ cells (ie, Mvh) and immature oocytes (ie, Nobox, Gdf9) (Johnson J, Bagley J, Skaznik-Wikiel M, et al. Cell 122:303-315, 2005). In a recent study (Eggan K, Jurga S, Gosden RG, et al. Nature 441:1109-1114, 2006) that has questioned our past work (Johnson J, Bagley J, Skaznik-Wikiel M, et al. Cell 122:303-315, 2005), a ß-actin–GFP transgenic line was used to monitor donor-derived cells after parabiotic blood exchange or BMT. These authors concluded that there was no evidence for mature ovulated eggs being derived from BM or peripheral blood (Eggan K, Jurga S, Gosden RG, et al. Nature 441:1109-1114, 2006). However, our data indicate that the ß-actin–GFP transgene is not uniformly expressed in either somatic (CD45+ leukocytes) or germ (oocytes) cell lineages. Therefore, an absence of detectable GFP expression in a given cell does not necessarily equate to that cell being of WT origin. One way to minimize the impact of this variability in transgene expression on the interpretation of experimental outcomes using ß-actin–GFP mice as reporters is to analyze a large number of samples. To this end, it is noteworthy that, although the total cumulative number of superovulated eggs analyzed by Eggan et al (Eggan K, Jurga S, Gosden RG, et al. Nature 441:1109-1114, 2006) from many different experimental paradigms was in the hundreds, very small numbers of eggs were actually studied on a per-mouse basis. In fact, some of the more critical evidence put forth by Eggan et al (Eggan K, Jurga S, Gosden RG, et al. Nature 441:1109-1114, 2006) was, quite surprisingly, based on analysis of only two mice per group from which a total of either four (chemotherapy [CTx]- treated mice at 2 months after parabiotic blood exchange) or seven (CTx-treated mice at 2 months after BMT) eggs were examined. Accordingly, we believe that, despite a current lack of data showing the production of fertilization-competent eggs being derived from adult female BM after transplantation, it is premature to dismiss this or the potential utility of adult stem-cell–based technologies in fertility preservation as a possibility in the future.
Outcome Differences in Preclinical (Mouse) and Clinical Studies
We thank D.T. Scadden for helpful discussions and guidance regarding stem-cell transplantation and K.J. MacLaughlin for TgOG2 transgenic mice.
Supported by Grant No. R37-AG012279 from the National Institutes of Health, Sea Breeze Foundation, JM Foundation, and Vincent Memorial Research Funds. Authors disclosures of potential conflicts of interest and author contributions are found at the end of this article.
1. Jemal A, Murray T, Ward E, et al: Cancer statistics, 2005. CA Cancer J Clin 55:10-30, 2005 2. Meirow D, Nugent D: The effects of radiotherapy and chemotherapy on female reproduction. Hum Reprod Update 7:535-543, 2001 3. Wenzel L, Dogan-Ates A, Habbal R, et al: Defining and measuring reproductive concerns of female cancer survivors. J Natl Cancer Inst Monogr 34:94-98, 2005 4. Lee SJ, Schover LR, Partridge AH, et al: American Society of Clinical Oncology recommendations on fertility preservation in cancer patients. J Clin Oncol 24:2917-2931, 2006 5. Tilly JL: Commuting the death sentence: How oocytes strive to survive. Nat Rev Mol Cell Biol 2:838-848, 2001[CrossRef][Medline] 6. Zuckerman S: The number of oocytes in the mature ovary. Recent Prog Horm Res 6:63-108, 1951[Medline] 7. Zuckerman S, Baker TG: The development of the ovary and the process of oogenesis, in Zuckerman S, Weir BL (eds): The Ovary. New York, NY, Academic Press, 1977, pp 41-67 8. Morita Y, Perez GI, Paris F, et al: Oocyte apoptosis is suppressed by disruption of the acid sphingomyelinase gene or by sphingosine-1-phosphate therapy. Nat Med 6:1109-1114, 2000[CrossRef][Medline] 9. Paris F, Perez GI, Fuks Z, et al: Sphingosine-1-phosphate preserves fertility in irradiated female mice without propagating genomic damage in offspring. Nat Med 8:901-902, 2002[CrossRef][Medline] 10. Salooja N, Chatterjee R, McMillan AK, et al: Successful pregnancies in women following single autotransplant for acute myeloid leukemia with a chemotherapy ablation protocol. Bone Marrow Transplant 13:431-435, 1994[Medline] 11. Sanders JE, Hawley J, Levy W, et al: Pregnancies following high-dose cyclophosphamide with or without high-dose busulfan or total-body irradiation and bone marrow transplantation. Blood 87:3045-3052, 1996 12. Salooja N, Szydlo R, Socie G, et al: Pregnancy outcomes after peripheral blood or bone marrow transplantation: A retrospective study. Lancet 358:271-276, 2001[CrossRef][Medline] 13. Hershlag A, Schuster MW: Return of fertility after autologous stem cell transplantation. Fertil Steril 77:419-421, 2002[CrossRef][Medline] 14. Johnson J, Canning J, Kaneko T, et al: Germline stem cells and follicular renewal in the postnatal mammalian ovary. Nature 428:145-150, 2004[CrossRef][Medline] 15. Byskov AG, Faddy MJ, Lemmen JG, et al: Eggs forever? Differentiation 73:438-446, 2005[CrossRef][Medline] 16. Telfer EE, Gosden RG, Byskov AG, et al: On regenerating the ovary and generating controversy. Cell 122:821-822, 2005[CrossRef][Medline] 17. Kerr JB, Duckett R, Myers M, et al: Quantification of healthy follicles in the neonatal and adult mouse ovary: Evidence for maintenance of primordial follicle supply. Reproduction 132:95-109, 2006 18. Johnson J, Skaznik-Wikiel M, Lee H-J, et al: Setting the record straight on data supporting postnatal oogenesis in female mammals. Cell Cycle 4:1471-1477, 2005[Medline] 19. Skaznik-Wikiel M, Tilly JC, Lee H-J, et al: Serious doubts over "Eggs forever?" Differentiation 75:93-99, 2007[CrossRef][Medline] 20. Allen E: Ovogenesis during sexual maturity. Am J Anat 31:439-482, 1923[CrossRef] 21. Vermande-Van Eck G: Neo-ovogenesis in the adult monkey. Anat Rec 125:207-224, 1956[CrossRef][Medline] 22. Johnson J, Bagley J, Skaznik-Wikiel M, et al: Oocyte generation in adult mammalian ovaries by putative germ cells derived from bone marrow and peripheral blood. Cell 122:303-315, 2005[CrossRef][Medline] 23. Logothetou-Rella H: Meiosis in hematological malignancies: In situ cytogenetic morphology. Histol Histopathol 11:943-963, 1996[Medline] 24. Logothetou-Rella H: Description of primordial germ cells, oogonia, oocytes and embryo-like growth in squash preparations of tissues from hematological malignancies. Histol Histopathol 11:965-984, 1996[Medline] 25. Hübner K, Fuhrmann G, Christenson LK, et al: Derivation of oocytes from mouse embryonic stem cells. Science 300:1251-1256, 2003 26. Toyooka Y, Tsunekawa N, Akasu R, et al: Embryonic stem cells can form germ cells in vitro. Proc Natl Acad Sci U S A 100:11457-11462, 2003 27. Geijsen N, Horoshak M, Kim K, et al: Derivation of embryonic germ cells and male gametes from embryonic stem cells. Nature 427:148-154, 2004[CrossRef][Medline] 28. Novak I, Lightfoot DA, Wang H, et al: Mouse embryonic stem cells form follicle-like ovarian structures but do not progress through meiosis. Stem Cells 24:1931-1936, 2006 29. Lacham-Kaplan O, Chy H, Trounson A: Testicular cell conditioned medium supports differentiation of embryonic stem cells into ovarian structures containing oocytes. Stem Cells 24:266-273, 2006 30. Nayernia K, Nolte J, Michaelmann HW, et al: In vitro-differentiated embryonic stem cells give rise to male gametes that can generate offspring mice. Dev Cell 11:125-132, 2006[CrossRef][Medline] 31. Dyce PW, Wen L, Li J: In vitro germline potential of stem cells derived from fetal porcine skin. Nat Cell Biol 8:384-390, 2006[CrossRef][Medline] 32. Danner S, Kajahn J, Geismann C, et al: Derivation of oocyte-like cells from a clonal pancreatic stem cell line. Mol Hum Reprod 13:11-20, 2007 33. Nayernia K, Lee JH, Drusenheimer N, et al: Derivation of male germ cells from bone marrow stem cells. Lab Invest 86:654-663, 2006[CrossRef][Medline] 33. Lue Y, Erkkila K, Liu PY, et al: Fate of bone marrow stem cells transplanted into the testis: Potential implication for men with testicular failure. Am J Pathol 170:899-908, 2007 33. Drusenheimer N, Wulf G, Nolte J, et al: Putative human male germ cells from bone marrow stem cells. Soc Reprod Fertil 63:69-76, 2007 (suppl) 34. Eggan K, Jurga S, Gosden RG, et al: Ovulated oocytes in adult mice derive from non-circulating germ cells. Nature 441:1109-1114, 2006[CrossRef][Medline] 35. Oktay K: Spontaneous conceptions and live birth after heterotopic ovarian transplantation: Is there a germline stem cell connection? Hum Reprod 21:1345-1348, 2006 36. Yeom YI, Fuhrmann G, Ovitt CE, et al: Germline regulatory element of Oct-4 specific for the totipotent cycle of embryonal cells. Development 122:881-894, 1996[Abstract] 37. Yoshimizu T, Sugiyama N, De Felice M, et al: Germline-specific expression of the Oct-4/green fluorescent protein (GFP) transgene in mice. Dev Growth Differ 41:675-684, 1999[CrossRef][Medline] 38. Szabo PE, Hübner K, Schöler HR, et al: Allele-specific expression of imprinted genes in mouse migratory primordial germ cells. Mech Dev 115:157-160, 2002[CrossRef][Medline] 39. Reference deleted by author. 40. Reference deleted by author. 41. Partridge AH, Bunnell CA, Winer EP: Quality of life issues among women undergoing high-dose chemotherapy for breast cancer. Breast Dis 14:41-50, 2001[Medline] 42. Partridge AH, Gelber S, Peppercorn J, et al: Web-based survey of fertility issues in young women with breast cancer. J Clin Oncol 22:4174-4183, 2004 43. Krause DS: Engraftment of bone marrow-derived epithelial cells. Ann N Y Acad Sci 1044:117-124, 2005[CrossRef][Medline] 44. Hirshfield AN: Development of follicles in the mammalian ovary. Int Rev Cytol 124:43-101, 1991[Medline] 45. Gougeon A: Regulation of ovarian follicular development in primates: Facts and hypotheses. Endocr Rev 17:121-155, 1996 46. Gosden RG, Faddy MJ: Biological bases of premature ovarian failure. Reprod Fertil Dev 10:73-78, 1998[CrossRef][Medline] 47. Jurisicova A, Lee H-J, D'Estaing SG, et al: Molecular requirements for doxorubicin-mediated death in murine oocytes. Cell Death Differ 13:1466-1474, 2006[CrossRef][Medline] 48. Ryu B-Y, Orwig KE, Oatley JM, et al: Effects of aging and niche microenvironment on spermatogonial stem cell self-renewal. Stem Cells 24:1505-1511, 2006 49. Niikura Y, Skaznik-Wikiel M, Johnson J, et al: Germline stem cell transplantation does not reverse age-related ovarian failure. J Soc Gynecol Investig 13:187A, 2006 (abstr 372) Submitted December 7, 2006; accepted February 23, 2007.
Related Editorial
This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|||||||||||
|
Copyright © 2007 by the American Society of Clinical Oncology, Online ISSN: 1527-7755. Print ISSN: 0732-183X
|