Advertisement
Journal of Clinical Oncology  
Search for:
Limit by:
  Browse by Subject or Issue
Home Search or Browse JCO My JCO Subscriptions Customer Service Site Map

Journal of Clinical Oncology, Vol 25, No 22 (August 1), 2007: pp. 3198-3204
© 2007 American Society of Clinical Oncology.
DOI: 10.1200/JCO.2006.10.3028

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, H.-J.
Right arrow Articles by Tilly, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, H.-J.
Right arrow Articles by Tilly, J. L.
Related Articles
Right arrowRelated Editorial
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Bone Marrow Transplantation Generates Immature Oocytes and Rescues Long-Term Fertility in a Preclinical Mouse Model of Chemotherapy-Induced Premature Ovarian Failure

Ho-Joon Lee, Kaisa Selesniemi, Yuichi Niikura, Teruko Niikura, Rachael Klein, David M. Dombkowski, Jonathan L. Tilly

From the Vincent Center for Reproductive Biology and Center for Regenerative Medicine, Massachusetts General Hospital/Harvard Medical School, Boston, MA

Address reprint requests to Jonathan L. Tilly, PhD, Massachusetts General Hospital, THR-901B, 55 Fruit St, Boston, MA 02114; e-mail: jtilly{at}partners.org


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 AUTHORS' DISCLOSURES OF...
 AUTHOR CONTRIBUTIONS
 Appendix
 REFERENCES
 
Purpose Although early menopause frequently occurs in female cancer patients after chemotherapy (CTx), bone marrow (BM) transplantation (BMT) has been linked to an unexplained return of ovarian function and fertility in some survivors. Studies modeling this in mice have shown that BMT generates donor-derived oocytes in CTx-treated recipients. However, a subsequent report claimed that ovulated eggs are not derived from BM and that BM-derived oocytes reported previously are misidentified immune cells. This study was conducted to further clarify the impact of BMT on female reproductive function after CTx using a preclinical mouse model.

Methods Female mice were administered CTx followed by BMT using coat color-mismatched female donors. After housing with males, the number of pregnancies and offspring genotype were recorded. For cell tracking, BM from germline-specific green fluorescent protein-transgenic mice was transplanted into CTx-treated wild-type recipients. Immune cells were sorted from blood and analyzed for germline markers.

Results BMT rescued long-term fertility in CTx-treated females, but all offspring were derived from the recipient germline. Cell tracking showed that donor-derived oocytes were generated in ovaries of recipients after BMT, and two lines of evidence dispelled the claim that these oocytes are misidentified immune cells.

Conclusion These data from a preclinical mouse model validate a testable clinical strategy for preserving or resurrecting ovarian function and fertility in female cancer patients after CTx, thus aligning with recommendations of the 2005 National Cancer Institute Breast Cancer Progress Review Group and President's Cancer Panel to prioritize research efforts aimed at improving the quality of life in cancer survivors.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 AUTHORS' DISCLOSURES OF...
 AUTHOR CONTRIBUTIONS
 Appendix
 REFERENCES
 
In 2005, more than 660,000 women in the United States were diagnosed with cancer, 8% of whom were of prereproductive or reproductive age.1 Although the incidence of this disease increases each year, earlier detection and more effective treatments have reduced cancer-related mortalities by almost 1% per year since the 1990s. These improved chances for long-term survival have made the quality of life of cancer survivors a top research priority for the 2005 Breast Cancer Progress Review Group of the National Cancer Institute (http://deainfo.nci.nih.gov/advisory/pog/progress/index.htm) and the President's Cancer Panel (http://deainfo.nci.nih.gov/advisory/pcp/pcp.htm).

One of the most devastating adverse effects of cancer treatments is damage to the reproductive system, which in young girls and women less than 40 years old is frequently associated with premature menopause and infertility (http://www.fertilehope.org).2-4 These outcomes seem to be, in large part, a result of cytotoxic effects on germ cells (oocytes) housed within the ovaries.5 Because of the near-universally accepted dogma that oocytes are endowed as a fixed and nonrenewing stockpile at birth,6,7 pathologic destruction of oocytes has been viewed as irreversible. Thus, experimental approaches aimed at sustaining fertility in female cancer survivors have been directed solely at preservation of existing oocytes.2-5,8,9

If, however, oocyte loss after treatment with highly cytotoxic agents is supposedly irreversible, then a puzzling observation repeatedly made over the past decade or so is an unexpected return of ovarian function and fertility in some reproductive-age women rendered prematurely menopausal by high-dose chemotherapy (CTx) if these patients undergo bone marrow (BM) transplantations (BMT) as part of their treatment protocol.10-13 One possible explanation for this may relate to a recent study we conducted with mice that has challenged the dogma of a fixed and nonrenewing oocyte stockpile being set forth in mammalian females at birth.14 Although this work was met with skepticism,15,16 independent corroboration that new oocytes are produced in adult females is now available17 and actually has been for decades.18-21

Of perhaps greater relevance to the clinical observations discussed earlier is a subsequent study that identified putative germ cells in BM that generate oocytes in CTx-treated female mice after transplantation.22 This work was also met with skepticism because these findings depart from traditional thinking that postnatal gametogenesis is confined to the gonads.15,18 However, germ cells have been identified by others in human and rat BM samples.23,24 Furthermore, male and female gametes have been generated from mouse embryonic stem cells,25-30 and oocyte-like cells have been produced from porcine skin and rat pancreatic stem cells.31,32 Moreover, and consistent with the work discussed earlier,22 spermatogonia have been derived from BM of adult male mice and men.33,33a,33b

Nevertheless, a new study with mice has concluded that mature ovulated eggs are not derived from BM or circulating (blood) cells,34 raising doubts over whether stem-cell transplantation could be considered as a viable therapeutic option to revive ovarian function and fertility in women after CTx, as has recently been suggested.22,35 Given the controversial nature and the considerable clinical ramifications of this new line of inquiry, herein we sought to clarify the effects of BMT on female reproductive function using a preclinical mouse model of CTx-induced premature ovarian failure.


    METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 AUTHORS' DISCLOSURES OF...
 AUTHOR CONTRIBUTIONS
 Appendix
 REFERENCES
 
Animals
C57BL/6 and 129/Sv mice were from Charles River (Wilmington, MA). FVB mice were from Taconic (Germantown, NY). TgOG2 transgenic mice with germline-specific expression of green fluorescent protein (GFP) were from K.J. MacLaughlin (University of Pennsylvania, Kennett Square, PA).36-38 Transgenic mice with GFP expression driven ubiquitously by the chicken ß-actin promoter [strain Tg(GFPU)5Nagy/J or C57BL/6-Tg(ACTB-EGFP)1Osb/J] were from Jackson Laboratory (Bar Harbor, ME). The institutional Animal Care and Use Committee of Massachusetts General Hospital approved all procedures.

Transplantations
BM was harvested from crushed femurs and tibias of donor females between 6 and 10 weeks of age, and 2 to 3 x 107 cells were injected into recipients via the tail vein 1 week or 2 months after CTx.22 To condition recipients, female mice were administered single intraperitoneal injections of busulfan (Sigma, St Louis, MO) and cyclophosphamide (Cytoxan; Bristol-Meyers Squibb Co, New York, NY) at 6 weeks of age.

Mating Trials
Recipient females (129/Sv or FVB) were coat color mismatched with donor females (C57BL/6) and housed with C57BL/6 males after BMT. Each offspring was assigned maternal heritage based on coat color (agouti/chinchilla, recipient-derived; black, donor-derived). Adult males of proven fertility were housed with females at a 1:2 ratio. Males were randomly rotated among cages after each pregnancy. The number of offspring per litter and the coat color of each offspring were recorded. Control mating trials using nontreated mice were conducted to validate the coat color tracking protocol (data not shown).

Donor Cell Tracking and Follicle Counts
Ovaries were fixed in paraformaldehyde, embedded in paraffin, and sectioned (6 µm) in their entirety for analysis using a GFP-specific antibody (sc-9996; Santa Cruz Biotechnology, Santa Cruz, CA).22 The number of GFP-positive versus GFP-negative oocytes was recorded by serial section immunohistochemistry, and the total number of oocyte-containing follicles per ovary was determined by histomorphometry.14,19 Positive and negative controls, consisting of ovarian sections from adult TgOG2 and wild-type (WT) females, respectively, were always included with the experimental tissues on each slide.

Gene Expression
Total RNA was extracted after digestion with RNAse-free DNAse, and 1 µg was reverse transcribed using oligo-dT primers. The samples were amplified via 28 to 40 cycles of polymerase chain reaction. Expression of ß-actin in each sample was analyzed to confirm fidelity of the cDNA synthesis and polymerase chain reaction amplification, and all amplified products were sequenced to confirm identity. Sequence data for the forward and reverse primers used are provided in the Appendix (online only).

Flow Cytometry
Approximately 0.5 mL of blood from each mouse was treated with 3 mL of ACK Lysing Buffer (Cambrex, Walkersville, MD) for 5 minutes to lyse RBCs, centrifuged, washed, and centrifuged again. The cell pellet was resuspended in phosphate-buffered saline, treated with Fc receptor block (antimouse CD16/32; BD Biosciences, San Diego, CA) for 20 minutes on ice, and reacted with a 1:20 dilution of CD45 APC (BD Biosciences) for 20 minutes on ice. Samples were centrifuged, washed, and analyzed with a FACSAria cytometer (Harvard Stem Cell Institute, Boston, MA).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 AUTHORS' DISCLOSURES OF...
 AUTHOR CONTRIBUTIONS
 Appendix
 REFERENCES
 
BMT Rescues Long-Term Fertility
Over the course of the 7-month mating trial, all (10 of 10) nontreated females achieved five successful (live-birth) pregnancies, and 80% (eight of 10) achieved six successful pregnancies (Fig 1A). Females administered nonlethal doses of CTx (busulfan 12 mg/kg, cyclophosphamide 120 mg/kg) without BMT became infertile, with the vast majority (10 of 13 mice) achieving three or less live-birth pregnancies and none achieving six live-birth pregnancies (Fig 1A). In mice that underwent BMT 1 week after nonlethal CTx, one never achieved a pregnancy. However, 90% of the mice that received BMT 1 week after nonlethal CTx achieved at least four live-birth pregnancies, 80% (eight of 10 mice) achieved five pregnancies, and 70% (seven of 10 mice) achieved six pregnancies (Fig 1A). There was a slight reduction in pups per litter in mice receiving nonlethal CTx plus BMT (6.3 ± 0.3 pups per litter) versus nontreated controls (7.6 ± 0.2 pups per litter; P = .02).


Figure 1
View larger version (15K):
[in this window]
[in a new window]
[PowerPoint Slide for Teaching]
 
Fig 1. (A) Percentage of mice receiving vehicle (n = 10), nonlethal chemotherapy (CTx-low, n = 13), or nonlethal CTx followed by bone marrow (BM) transplantation (BMT) 1 week later (CTx-low + BM/1 week, n = 10) that achieved the indicated number of successful (live-birth) pregnancies over a 7-month period when mating was initiated coincident with BMT. (B) Percentage of mice that achieved the indicated number of live-birth pregnancies when mating initiation was postponed for 2 months after BMT. Treatment groups were as follows: CTx-low + BM/1 week, nonlethal CTx followed by BMT 1 week later (n = 6); CTx-low + BM/2 months, nonlethal CTx followed by BMT 2 months later (n = 5); and CTx-low, nonlethal CTx with no BMT (n = 6). (C) Percentage of surviving mice receiving a median lethal dose (LD50) of CTx (CTx-high, n = 4) or LD50 CTx followed by BMT 1 week later (CTx-high + BM/1 week, n = 6) that achieved the indicated number of live-birth pregnancies when mating was initiated coincident with BMT.

 
To assess the effect of the timing of BMT and mating initiation on fertility outcome, additional females were treated as follows and analyzed in parallel: (1) nonlethal CTx followed by BMT 1 week later, with mating initiated 2 months after treatment; (2) nonlethal CTx, with BMT and mating initiated 2 months after treatment; and (3) nonlethal CTx without BMT, with mating initiated 2 months after treatment. In animals administered nonlethal CTx without BMT, live-birth pregnancy rates were comparable irrespective of whether mating was initiated 1 week (Fig 1A) or 2 months (Fig 1B) later. Females administered nonlethal CTx followed by BMT 1 week later but with mating initiation postponed for 2 months (Fig 1B) showed a marked reduction in live-birth pregnancy rates compared with mice administered nonlethal CTx with both BMT and mating initiation performed 1 week later (Fig 1A). If both BMT and mating were postponed for 2 months in females administered nonlethal CTx, the beneficial effects of BMT on fertility rescue were markedly attenuated (Fig 1B).

We also tested the effect of increasing the CTx dose on the ability of BMT to rescue fertility when BMT and mating initiation were performed 1 week after CTx. Of eight female mice administered median lethal doses (LD50) of CTx (busulfan 20 mg/kg, cyclophosphamide 200 mg/kg) without BMT, four died within 2 months, and no pregnancies were observed in these animals before death. Of the four females that survived long term, three (75%) achieved a live-birth pregnancy after the first mating, but none achieved a second pregnancy at any point over the remainder of the mating trial (Fig 1C). By comparison, only 25% (two of eight females) of the females exposed to LD50 CTx died afterwards if BMT was performed within 1 week of treatment, and one of these two females achieved a live-birth pregnancy before death. Of the six females that survived long term, five achieved one (83%), two achieved two (33%), and one (17%) achieved five live-birth pregnancies (Fig 1C).

BM-Derived Cells Generate Immature Oocytes
Although BMT resurrected long-term fertility in CTx-treated females (Fig 1A), all of the offspring produced by these animals (n = 325) were derived from the recipient germline. Thus, the effects of BMT do not seem dependent on germline-committed cells in the transplanted fractions. To further examine this, we transplanted WT females administered nonlethal CTx with BM harvested from TgOG2 transgenic donor females expressing GFP under the control of a germline-specific promoter.22,36-38 Two months after BMT, ovaries of females that underwent transplantation possessed donor-derived (GFP-positive) oocytes enclosed within immature follicles (Figs 2A to 2D), although the percentage of the total immature follicle pool containing GFP-positive oocytes was relatively low (1.4% ± 0.6%, n = 5 mice). Furthermore, although the total number of immature follicles per ovary in CTx-treated females 2 months after BMT (369 ± 89 follicles, n = 5 mice) was lower than in nontreated controls (1,461 ± 344 follicles, n = 5 mice), it was significantly higher than in females administered CTx without subsequent BMT (41 ± 12 follicles, n = 4 mice; P = .011 v CTx plus BMT group).


Figure 2
View larger version (137K):
[in this window]
[in a new window]
[PowerPoint Slide for Teaching]
 
Fig 2. (A to D) Representative cell tracking in wild-type (WT) recipient ovaries showing TgOG2 donor bone marrow–derived (green fluorescent protein [GFP] –positive, brown) oocytes contained within (A) primordial and (B) growing immature follicles. (A) Inset highlights a donor-derived primordial/early primary oocyte, whereas arrows demarcate adjacent WT primordial oocytes. Ovarian sections from (C) a donor animal and (D) a nontransplanted WT animal (arrows, primordial oocytes; asterisks, growing oocytes) representing positive and negative controls for GFP detection, respectively. Sections were counterstained with hematoxylin to visualize tissue architecture.

 
Donor BM–Derived Oocytes Are Not Misidentified CD45+ Cells
Using ubiquitous GFP-expressing transgenic mice, Eggan et al34 recently concluded that donor-derived mature eggs were never observed in the oviducts of superovulated female mice after parabiotic blood exchange or BMT but that GFP-expressing cells found associated with ovulated eggs were CD45+ leukocytes. These authors then conjectured that "such circulating or bone-marrow-derived cells that travel to the ovary may in some cases coexpress or costain with markers typically associated with female germ cells" as an alternative explanation for the donor-derived immature oocytes we identified in recipient females after BMT in an earlier report.22 To assess the validity of this, blood-derived mononuclear cells were isolated from WT and transgenic adult female mice with germline-specific (TgOG2) or ubiquitous (ß-actin promoter) GFP expression. Flow cytometric analysis showed that CD45+/GFP-positive cells were present in ß-actin–GFP, but not TgOG2, transgenic mice (Figs 3A to 3C). Thus, it is highly unlikely that GFP-positive oocytes detected in ovaries of WT females after transplantation using TgOG2 mice as donors22 represent misidentified CD45+ leukocytes because TgOG2 CD45+ cells do not express GFP. In further support of this, CD45+/GFP-negative and CD45+/GFP-positive (where possible) cells were isolated from blood of WT, TgOG2, and ß-actin–GFP females and analyzed for expression of markers used earlier to identify germline cells in BM or blood.22 Although ß-actin was detected in all samples, we did not detect germ cell markers in any CD45+ cell fractions (Fig 3D). However, all germline markers were, as expected, present in adult ovary analyzed in parallel (Fig 3D).


Figure 3
View larger version (46K):
[in this window]
[in a new window]
[PowerPoint Slide for Teaching]
 
Fig 3. Representative flow cytometric analysis of CD45 expression (y axis) and green fluorescent protein (GFP) expression (x axis) in peripheral blood–derived cells harvested from (A) wild-type (WT), (B) TgOG2 transgenic, or (C) ß-actin–GFP transgenic female mice. (D) Representative expression of germline markers (Mvh, Nobox, Stella, and Dazl) in CD45+ cells isolated from peripheral blood of WT, TgOG2 transgenic, or ß-actin–GFP transgenic (ubiquitous [uGFP]) mice by flow cytometry. Ovary RNA was used as a positive control for germline marker expression. Actin expression was used to confirm fidelity of the cDNA synthesis reaction and polymerase chain reaction amplification, whereas GFP was analyzed to confirm isolation of transgenic CD45+ cells from the ubiquitous GFP-expressing line. Mock, mock reverse-transcribed RNA.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 AUTHORS' DISCLOSURES OF...
 AUTHOR CONTRIBUTIONS
 Appendix
 REFERENCES
 
The quality of life of cancer survivors after chemotherapeutic or radiologic treatments is of growing concern,41 with a particular emphasis on methods for preserving gonadal function and fertility.4,42 Until recently, fertility preservation protocols in females have been constrained by the belief that the oocyte reserve endowed at birth is fixed and irreplaceable. However, recent studies challenging this dogma14,19,22 have offered the possibility of oocyte regeneration as a viable option to revive ovarian function and fertility after exposure to gonadotoxic therapies.22,35 Although this line of reasoning is already indirectly supported by clinical reports linking stem-cell transplantations to a spontaneous and as-yet unexplained return of ovarian function and natural fertility in some women rendered prematurely menopausal by high-dose CTx,10-13,35 this work remains quite controversial.14-19,34

Addressing this issue directly using a preclinical mouse model of CTx-induced ovarian failure, herein, we observed a rescue of long-term fertility in CTx-treated females by BMT that was influenced by several variables. First, the timing of the transplantation was important, in that a maximal benefit was achieved when BMT was performed 1 week (v 2 months) after CTx. The amount of CTx was a key variable as well because BMT was only marginally effective at rescuing fertility when the doses of CTx were increased to LD50 values. A third variable was the timing of mating initiation after BMT. Although a beneficial effect of BMT was observed in CTx-treated females when mating was postponed for 2 months, the percentage of these females that exhibited long-term reproductive potential was considerably less than that observed when females became pregnant shortly after BMT. Because the timing of mating initiation was without effect in females administered CTx alone, a synergistic interaction apparently exists between metabolic or hormonal changes associated with pregnancy and the profertility effects of BMT.

Interestingly, all of the offspring produced by CTx-treated females whose fertility was rescued by BMT were derived from the recipient germline, despite the fact that cell tracking experiments confirmed the presence of donor BM–derived oocytes in their ovaries. However, the number of GFP-positive oocytes was low, in the range of that reported for other models in which donor somatic cell engraftment has been monitored after BMT.43 Furthermore, donor-derived oocytes were only observed in immature follicles up to the preantral stage of development but never observed in maturing antral or Graafian follicles from which ovulated eggs are derived (for more information on mammalian follicular dynamics, see Appendix and Hirshfield44 and Gougeon45). Accordingly, BMT rescues long-term fertility by either protecting existing oocytes from CTx or reinstituting recipient oogenesis. Although we have no direct evidence ruling out the first possibility, it is unlikely for the following reasons.

First, the rescue of fertility by BMT was not transient but sustained long term, even though the follicle reserve in CTx-treated females 2 months after BMT was 25% of that observed in nontreated controls. Because follicle numbers dictate the timing of ovarian failure,46 it is unlikely that the reproductive life span of CTx-treated females after BMT would be similar to nontreated controls unless their compromised follicle reserve was being replenished at some low rate. Second, a near-complete rescue of fertility was achieved when BMT was performed 1 week after CTx, well after the drugs have exerted their detrimental effects and been removed from the body. In fact, a profertility effect of BMT was still observed, albeit diminished, when the transplantations were performed 2 months after the insult. Past studies have shown that fertility preservation in female mice exposed to anticancer therapy can be achieved with a known protective agent if it is administered before the insult.8,9 Furthermore, oocytes exposed to CTx irreversibly commit to fragmentation (death) within 4 hours.47 Given all of this, it is unlikely that BMT rescues fertility by salvaging a sufficient number of existing oocytes 1 week after CTx exposure to sustain normal long-term reproductive potential.

Therefore, we believe that BMT functions primarily by reactivating host oogenesis, which becomes impaired in a BMT-reversible manner after CTx through either direct effects of the drugs on the cells responsible for oogenesis (eg, cell cycle arrest) or indirect effects of the drugs on the microenvironments (niches) that support the aforementioned cells. It is also possible that CTx damages the ovaries such that engraftment or differentiation of germ cells fails to occur unless the gonadal microenvironment is repaired by the transplanted somatic cells or by factors released from the transplanted cells. This line of reasoning fits with recent studies of male germline stem-cell function in mice, in which nongermline-dependent alterations in the testicular microenvironment were identified as being a principal cause of age-related spermatogenic failure and testicular atrophy.48 Indeed, preliminary data from our lab have shown that transplantation of BM harvested from young adult TgOG2 female mice into WT female mice of advanced age does not generate immature oocytes and follicles.49 Although the age-related changes in the ovaries that preclude oocyte formation in aged females after transplantation remain unknown, these findings underscore the need to consider the niche in which new germ cells are made as well as the niche into which these cell engraft and differentiate as equally important issues. In addition, at least for high-dose CTx-exposed females in which BMT reduced post-treatment lethality, BMT might also rescue fertility as part of a more global beneficial effect of BMT on overall health.

In summary, this study supports and extends past work from our lab22 and others23,24,33,33a,33b identifying cells with germline potential in BM of adult mammals. Although Eggan et al34 recently claimed, without supporting data, that donor-derived immature oocytes detected in the ovaries of female mice after transplantation22 actually represent CD45+ immune cells, experiments conducted herein to directly test the validity of this have proven it to be incorrect. Furthermore, as demonstrated in the online Appendix, the use of ß-actin–GFP transgenic mice for donor germ cell tracking, as reported by Eggan et al,34 has considerable limitations. However, our data do indicate that these BM-derived germ cells apparently do not mature for ovulation or fertilization. Nevertheless, the ability of BMT to rescue long-term fertility in CTx-treated female mice and the clinical case studies linking BMT to a return of fertility in female cancer patients10-13 clearly justify additional testing of adult stem-cell–based technologies as a potential new strategy for the management of gonadal failure and infertility in female cancer survivors. In the interim, female cancer patients should still be referred for established fertility preservation protocols as per the recently recommended guidelines from the American Society of Clinical Oncology.4


    AUTHORS’ DISCLOSURES OF POTENTIAL CONFLICTS OF INTEREST
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 AUTHORS' DISCLOSURES OF...
 AUTHOR CONTRIBUTIONS
 Appendix
 REFERENCES
 
The author(s) indicated no potential conflicts of interest.


    AUTHOR CONTRIBUTIONS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 AUTHORS' DISCLOSURES OF...
 AUTHOR CONTRIBUTIONS
 Appendix
 REFERENCES
 
Conception and design: Jonathan L. Tilly

Financial support: Jonathan L. Tilly

Collection and assembly of data: Ho-Joon Lee, Kaisa Selesniemi, Yuichi Niikura, Teruko Niikura, Rachael Klein, David M. Dombkowski

Data analysis and interpretation: Ho-Joon Lee, Kaisa Selesniemi, Yuichi Niikura, Rachael Klein, Jonathan L. Tilly

Manuscript writing: Jonathan L. Tilly

Final approval of manuscript: Ho-Joon Lee, Kaisa Selesniemi, Yuichi Niikura, Teruko Niikura, Rachael Klein, David M. Dombkowski, Jonathan L. Tilly


    Appendix
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 AUTHORS' DISCLOSURES OF...
 AUTHOR CONTRIBUTIONS
 Appendix
 REFERENCES
 
Sequence Information for Polymerase Chain Reaction Primers (Gene Expression Analyses)
Forward and reverse primers used (5'-3') for reverse transcriptase polymerase chain reaction analysis were as follows, with GenBank accession numbers and references (where appropriate) provided: murine Mvh (NM_010029) (Fujiwara Y, Komiya T, Kawabata H, et al. Proc Natl Acad Sci U S A 91:12258-12262, 1994): GGAAACCAGCAGCAAGTGAT and TGGAGTCCTCATCCTCTGG; murine Nohma (AY626343) (Pangas SA, Yan W, Matzuk MM, et al. Gene Expr Patterns 5:257-263, 2004): GTCCCAACACCTTTTCACA and AGACACATCAAGTTCAGATG; murine Oog3 (NM_201258) (Dade S, Callebaut I, Mermillod P, et al. FEBS Lett 555:533-538, 2003): TCACAGATTCCCTCAGTATG and GCATTTTTATTGTTTATCTCA; murine Tex101/Ts101rp (NM_019981) (Kurita A, Takizawa T, Takayama T, et al. Biol Reprod 64:935-945, 2001; Takayama T, Mishima T, Mori M, et al. Biol Reprod 72:1315-1323, 2005): TAGACCGTTCCCAGGTCTTG and AGCACTGAGTTGTGCCATTG; murine Nobox (AY061761) (Suzumori N, Yan C, Matzuk MM, et al. Mech Dev 111:137-141, 2002; Rajkovic A, Pangas SA, Ballow D, et al. Science 305:1157-1159, 2004): CCCTTCAGTCACAGTTTCCGT and GTCTCTACTCTAGTGCCTTCG; murine Stella (AY082485) (Saitou M, Barton SC, Surani MA. Nature 418:293-300, 2002): CCCAATGAAGGACCCTGAAAC and AATGGCTCACTGTCCCGTTCA; murine Dazl (NM_010021) (Cooke HJ, Lee M, Kerr S, et al. Hum Mol Genet 5:513-516, 1996): GTGTGTCGAAGGGCTATGGAT and ACAGGCAGCTGATATCCAGTG; green fluorescent protein (GFP): TCCTTGAAGAAGATGGTGCG and AAGTTCATCTGCACCACCG; and murine ß-actin (X03672): GATGACGATATCGCTGCGCTG and GTACGACCAGAGGCATACAGG.

Germline Markers Remain Detectable in Bone Marrow After Chemotherapy
Quantitative assessment of the number of transgenic (TgOG2) donor bone marrow (BM) –derived oocytes contained within immature follicles in the ovaries of wild-type (WT) recipients after transplantation revealed a low incidence (see Results of article) in the range of that reported for other models in which donor somatic cell engraftment has been monitored after BM transplantation (BMT; Krause DS. Ann N Y Acad Sci 1044:117-124, 2005). This outcome is consistent with one of several possibilities. First, the conditioning protocol may not eliminate the recipient's regenerative germ cells to allow for efficient donor germ cell engraftment. In support of this, BM expression of early germline markers remained detectable after drug exposure (Appendix Fig A1), suggesting that germline-committed cells are still present in BM even 2 months after combination chemotherapy. This is perhaps not surprising in light of work showing that busulfan compromises hematopoietic potential by inducing replicative senescence, rather than apoptotic death (namely, deletion), of hematopoietic stem cells (Meng A, Wang Y, Van Zant G, et al. Cancer Res 63:5414-5419, 2003). Furthermore, past studies using hematopoietic stem-cell and male germline stem-cell transplantation have shown that effective recipient conditioning is required to alleviate competition between host and donor cells for rare engraftment sites or niches (Tomita Y, Sachs DH, Sykes M. Blood 83:939-948, 1994; Brinster CJ, Ryu B-Y, Avarbock MR, et al. Biol Reprod 69:412-420, 2003). Our route of transplantation may also preclude high levels of donor germ cell formation in the ovaries, in that we use a systemic tail vein injection, whereas comparable studies with male mice inject cell fractions (either donor BM or testis derived) directly into the testes of recipients (Brinster CJ, Ryu B-Y, Avarbock MR, et al. Biol Reprod 69:412-420, 2003; Nayernia K, Lee JH, Drusenheimer N, et al. Lab Invest 86:654-663, 2006). Lastly, the low incidence of donor-derived oocytes may simply reflect a low frequency of cells in BM with germline potential, as has recently been suggested from studies of spermatogonial cell derivation from BM (Nayernia K, Lee JH, Drusenheimer N, et al. Lab Invest 86:654-663, 2006). Studies are underway to examine each of these possibilities in detail so that future work might be facilitated by a protocol that maximizes formation of new follicles containing donor-derived germ cells.


Figure 4
View larger version (20K):
[in this window]
[in a new window]
[PowerPoint Slide for Teaching]
 
Fig A1. Representative expression of markers of early germ cells (Mvh, Nohma), postmeiotic female germ cells (Oog 3) or male germ cells (Tex101) in bone marrow collected from adult female mice 2 months after treatment with vehicle or chemotherapy. Actin expression was used to confirm the fidelity of the cDNA synthesis reaction and polymerase chain reaction amplification. Adult ovary and adult testis were used as positive controls for expression of the indicated germline marker genes. Similar results were obtained in three independent experiments. Mock, mock reverse-transcribed RNA; BM, bone marrow; VEH, vehicle; CTx, chemotherapy.

 
Oocytes of ß-actin–GFP Transgenic Mice Exhibit Heterogeneity in Reporter Expression
During the course of analyzing CD45+ cells from the ß-actin–GFP line (Fig 3 in article), we noted that approximately one third of circulating CD45+ cells did not express GFP. Because the strength of conclusions drawn from cell tracking experiments in transplanted animals using this transgenic line as a reporter (Eggan K, Jurga S, Gosden RG, et al. Nature 441:1109-1114, 2006) is dependent on uniform expression of the marker in the cell lineage of interest, we tested the fidelity of GFP expression in immature and mature oocytes of adult ß-actin–GFP transgenic female mice. First, ovaries were removed and analyzed for GFP expression by immunohistochemistry, as detailed in the accompanying article. Similar to the variability in GFP expression observed in CD45+ cells in blood (Fig 3 in article), a wide range of transgene expression was detected in immature oocytes in the ovaries, with highly positive oocytes found adjacent to other oocytes that exhibited minimal or no detectable GFP expression (Appendix Figs A2A to A2C). Second, epifluorescence analysis of oocytes obtained from oviducts of adult ß-actin–GFP transgenic female mice after superovulation revealed a somewhat more uniform expression of the transgene, although one ovulated oocyte of a total of 55 analyzed required digital image enhancement to visualize a low level of GFP expression (Appendix Figs A2D to A2F).


Figure 5
View larger version (66K):
[in this window]
[in a new window]
[PowerPoint Slide for Teaching]
 
Fig A2. (A, B) Representative immunohistochemical analysis of green fluorescent protein (GFP) expression (brown) in ovaries of ß-actin GFP transgenic mice (Jackson Laboratory), with examples of positive oocytes (asterisks) adjacent to negative oocytes (arrows) indicated. (C) Expression of GFP in ovaries of ß-actin GFP transgenic mice obained from A.J. Wagers (Eggan K, Jurga S, Gosden RG, et al: Nature 441:1109-1114, 2006), showing minimal to no detectable reporter expression in a cluster of immature oocytes (boxed, highlighted inset). (D-F) Brightfield and epifluorescence analysis of oocytes collected from oviducts of ß-actin GFP transgenic mice following superovulation. Note that expression of GFP in (D) one of the oocytes (arrow) visible under brightfield microscopy (E) is almost nondetectable by standard epifluorescence analysis, (F) even after the image is digitally enhanced.

 
In our earlier experiments (Johnson J, Bagley J, Skaznik-Wikiel M, et al. Cell 122:303-315, 2005) and those shown herein, we used donor transgenic mice with germline-specific expression of GFP (TgOG2) to maximize reliable detection of donor-derived germ cells after transplantation. Indeed, the GFP-positive immature oocytes detected in the ovaries of transplanted WT females after BMT were found to coexpress a suite of markers confirming their phenotype as both germ cells (ie, Mvh) and immature oocytes (ie, Nobox, Gdf9) (Johnson J, Bagley J, Skaznik-Wikiel M, et al. Cell 122:303-315, 2005). In a recent study (Eggan K, Jurga S, Gosden RG, et al. Nature 441:1109-1114, 2006) that has questioned our past work (Johnson J, Bagley J, Skaznik-Wikiel M, et al. Cell 122:303-315, 2005), a ß-actin–GFP transgenic line was used to monitor donor-derived cells after parabiotic blood exchange or BMT. These authors concluded that there was no evidence for mature ovulated eggs being derived from BM or peripheral blood (Eggan K, Jurga S, Gosden RG, et al. Nature 441:1109-1114, 2006). However, our data indicate that the ß-actin–GFP transgene is not uniformly expressed in either somatic (CD45+ leukocytes) or germ (oocytes) cell lineages. Therefore, an absence of detectable GFP expression in a given cell does not necessarily equate to that cell being of WT origin.

One way to minimize the impact of this variability in transgene expression on the interpretation of experimental outcomes using ß-actin–GFP mice as reporters is to analyze a large number of samples. To this end, it is noteworthy that, although the total cumulative number of superovulated eggs analyzed by Eggan et al (Eggan K, Jurga S, Gosden RG, et al. Nature 441:1109-1114, 2006) from many different experimental paradigms was in the hundreds, very small numbers of eggs were actually studied on a per-mouse basis. In fact, some of the more critical evidence put forth by Eggan et al (Eggan K, Jurga S, Gosden RG, et al. Nature 441:1109-1114, 2006) was, quite surprisingly, based on analysis of only two mice per group from which a total of either four (chemotherapy [CTx]- treated mice at 2 months after parabiotic blood exchange) or seven (CTx-treated mice at 2 months after BMT) eggs were examined. Accordingly, we believe that, despite a current lack of data showing the production of fertilization-competent eggs being derived from adult female BM after transplantation, it is premature to dismiss this or the potential utility of adult stem-cell–based technologies in fertility preservation as a possibility in the future.

Outcome Differences in Preclinical (Mouse) and Clinical Studies
After low-dose CTx, the rescue of fertility achieved in adult female mice by BMT was dramatic (Fig 1 in article). Similar observations have been reported for some women rendered prematurely menopausal by high-dose CTx who, years later, exhibited an unexpected and, to date, unexplained return of fertility after BMT. However, unlike the preclinical mouse data shown in this study, the return of ovarian function (menstrual cycles) and fertility in female cancer survivors after treatment occurs in a relatively small percentage of those patients administered stem-cell transplantations (Salooja N, Chatterjee R, McMillan AK, et al. Bone Marrow Transplant 13:431-435, 1994; Sanders JE, Hawley J, Levy W, et al. Blood 87:3045-3052, 1996; Salooja N, Szydlo R, Socie G, et al. Lancet 358:271-276, 2001; Hershlag A, Schuster MW. Fertil Steril 77:419-421, 2002). The reasons for this are unknown but may be related to one or more of the following considerations, some of which have been discussed recently by others (Oktay K. Hum Reprod 21:1345-1348, 2006). The first relates to the amount of CTx used because the percentage of female mice that exhibited a rescue of long-term fertility after BMT dropped precipitously when the dose of combination chemotherapy was increased to median lethal dose levels (Fig 1C in article). Second, many patients receiving stem-cell transplantations are preconditioned with a combination of CTx and radiotherapy. This is significant because our past work has shown that BMT does not resurrect ovarian function in adult female mice rendered sterile by ionizing radiation (Johnson J, Bagley J, Skaznik-Wikiel M, et al. Cell 122:303-315, 2005). Third, there are a number of fundamental differences in the transplantation protocols used for these preclinical mouse studies versus those performed in patients, including the fact that the majority of clinical stem-cell transplantation protocols use cell fractions highly enriched for specifically hematopoietic cell reconstitution. Furthermore, our work uses only female donors, whereas in the clinic, the stem cells used for allogeneic transplantation are derived from both female and male donors, the latter of which may not replicate the profertility effects of female donor bone marrow reported herein. Finally, the inbred nature of the mouse lines used for these studies precludes the need for immunosuppression before allogeneic transplantation; this is obviously not the case for clinical allogeneic stem-cell transplantations, which thus adds the variable of a potential, if not likely, negative impact of immunosuppressive therapy on fertility in female patients after treatment. Nonetheless, the fact that a spontaneous return of menstrual cyclicity and natural fertility has been reported in at least some female stem-cell transplantation survivors, even after being in a clinically menopausal state for several years, supports our primary conclusion drawn from the preclinical mouse data shown herein. Additional testing of adult stem-cell–based technologies as a potential new strategy for the management of gonadal failure and infertility in female cancer survivors is needed and clearly warranted.


    ACKNOWLEDGMENTS
 
We thank D.T. Scadden for helpful discussions and guidance regarding stem-cell transplantation and K.J. MacLaughlin for TgOG2 transgenic mice.


    NOTES
 
Supported by Grant No. R37-AG012279 from the National Institutes of Health, Sea Breeze Foundation, JM Foundation, and Vincent Memorial Research Funds.

Authors’ disclosures of potential conflicts of interest and author contributions are found at the end of this article.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 AUTHORS' DISCLOSURES OF...
 AUTHOR CONTRIBUTIONS
 Appendix
 REFERENCES
 
1. Jemal A, Murray T, Ward E, et al: Cancer statistics, 2005. CA Cancer J Clin 55:10-30, 2005[Abstract/Free Full Text]

2. Meirow D, Nugent D: The effects of radiotherapy and chemotherapy on female reproduction. Hum Reprod Update 7:535-543, 2001[Abstract/Free Full Text]

3. Wenzel L, Dogan-Ates A, Habbal R, et al: Defining and measuring reproductive concerns of female cancer survivors. J Natl Cancer Inst Monogr 34:94-98, 2005[Abstract/Free Full Text]

4. Lee SJ, Schover LR, Partridge AH, et al: American Society of Clinical Oncology recommendations on fertility preservation in cancer patients. J Clin Oncol 24:2917-2931, 2006[Abstract/Free Full Text]

5. Tilly JL: Commuting the death sentence: How oocytes strive to survive. Nat Rev Mol Cell Biol 2:838-848, 2001[CrossRef][Medline]

6. Zuckerman S: The number of oocytes in the mature ovary. Recent Prog Horm Res 6:63-108, 1951[Medline]

7. Zuckerman S, Baker TG: The development of the ovary and the process of oogenesis, in Zuckerman S, Weir BL (eds): The Ovary. New York, NY, Academic Press, 1977, pp 41-67

8. Morita Y, Perez GI, Paris F, et al: Oocyte apoptosis is suppressed by disruption of the acid sphingomyelinase gene or by sphingosine-1-phosphate therapy. Nat Med 6:1109-1114, 2000[CrossRef][Medline]

9. Paris F, Perez GI, Fuks Z, et al: Sphingosine-1-phosphate preserves fertility in irradiated female mice without propagating genomic damage in offspring. Nat Med 8:901-902, 2002[CrossRef][Medline]

10. Salooja N, Chatterjee R, McMillan AK, et al: Successful pregnancies in women following single autotransplant for acute myeloid leukemia with a chemotherapy ablation protocol. Bone Marrow Transplant 13:431-435, 1994[Medline]

11. Sanders JE, Hawley J, Levy W, et al: Pregnancies following high-dose cyclophosphamide with or without high-dose busulfan or total-body irradiation and bone marrow transplantation. Blood 87:3045-3052, 1996[Abstract/Free Full Text]

12. Salooja N, Szydlo R, Socie G, et al: Pregnancy outcomes after peripheral blood or bone marrow transplantation: A retrospective study. Lancet 358:271-276, 2001[CrossRef][Medline]

13. Hershlag A, Schuster MW: Return of fertility after autologous stem cell transplantation. Fertil Steril 77:419-421, 2002[CrossRef][Medline]

14. Johnson J, Canning J, Kaneko T, et al: Germline stem cells and follicular renewal in the postnatal mammalian ovary. Nature 428:145-150, 2004[CrossRef][Medline]

15. Byskov AG, Faddy MJ, Lemmen JG, et al: Eggs forever? Differentiation 73:438-446, 2005[CrossRef][Medline]

16. Telfer EE, Gosden RG, Byskov AG, et al: On regenerating the ovary and generating controversy. Cell 122:821-822, 2005[CrossRef][Medline]

17. Kerr JB, Duckett R, Myers M, et al: Quantification of healthy follicles in the neonatal and adult mouse ovary: Evidence for maintenance of primordial follicle supply. Reproduction 132:95-109, 2006[Abstract/Free Full Text]

18. Johnson J, Skaznik-Wikiel M, Lee H-J, et al: Setting the record straight on data supporting postnatal oogenesis in female mammals. Cell Cycle 4:1471-1477, 2005[Medline]

19. Skaznik-Wikiel M, Tilly JC, Lee H-J, et al: Serious doubts over "Eggs forever?" Differentiation 75:93-99, 2007[CrossRef][Medline]

20. Allen E: Ovogenesis during sexual maturity. Am J Anat 31:439-482, 1923[CrossRef]

21. Vermande-Van Eck G: Neo-ovogenesis in the adult monkey. Anat Rec 125:207-224, 1956[CrossRef][Medline]

22. Johnson J, Bagley J, Skaznik-Wikiel M, et al: Oocyte generation in adult mammalian ovaries by putative germ cells derived from bone marrow and peripheral blood. Cell 122:303-315, 2005[CrossRef][Medline]

23. Logothetou-Rella H: Meiosis in hematological malignancies: In situ cytogenetic morphology. Histol Histopathol 11:943-963, 1996[Medline]

24. Logothetou-Rella H: Description of primordial germ cells, oogonia, oocytes and embryo-like growth in squash preparations of tissues from hematological malignancies. Histol Histopathol 11:965-984, 1996[Medline]

25. Hübner K, Fuhrmann G, Christenson LK, et al: Derivation of oocytes from mouse embryonic stem cells. Science 300:1251-1256, 2003[Abstract/Free Full Text]

26. Toyooka Y, Tsunekawa N, Akasu R, et al: Embryonic stem cells can form germ cells in vitro. Proc Natl Acad Sci U S A 100:11457-11462, 2003[Abstract/Free Full Text]

27. Geijsen N, Horoshak M, Kim K, et al: Derivation of embryonic germ cells and male gametes from embryonic stem cells. Nature 427:148-154, 2004[CrossRef][Medline]

28. Novak I, Lightfoot DA, Wang H, et al: Mouse embryonic stem cells form follicle-like ovarian structures but do not progress through meiosis. Stem Cells 24:1931-1936, 2006[CrossRef][Medline]

29. Lacham-Kaplan O, Chy H, Trounson A: Testicular cell conditioned medium supports differentiation of embryonic stem cells into ovarian structures containing oocytes. Stem Cells 24:266-273, 2006[CrossRef][Medline]

30. Nayernia K, Nolte J, Michaelmann HW, et al: In vitro-differentiated embryonic stem cells give rise to male gametes that can generate offspring mice. Dev Cell 11:125-132, 2006[CrossRef][Medline]

31. Dyce PW, Wen L, Li J: In vitro germline potential of stem cells derived from fetal porcine skin. Nat Cell Biol 8:384-390, 2006[CrossRef][Medline]

32. Danner S, Kajahn J, Geismann C, et al: Derivation of oocyte-like cells from a clonal pancreatic stem cell line. Mol Hum Reprod 13:11-20, 2007[Abstract/Free Full Text]

33. Nayernia K, Lee JH, Drusenheimer N, et al: Derivation of male germ cells from bone marrow stem cells. Lab Invest 86:654-663, 2006[CrossRef][Medline]

33. Lue Y, Erkkila K, Liu PY, et al: Fate of bone marrow stem cells transplanted into the testis: Potential implication for men with testicular failure. Am J Pathol 170:899-908, 2007[Abstract/Free Full Text]

33. Drusenheimer N, Wulf G, Nolte J, et al: Putative human male germ cells from bone marrow stem cells. Soc Reprod Fertil 63:69-76, 2007 (suppl)

34. Eggan K, Jurga S, Gosden RG, et al: Ovulated oocytes in adult mice derive from non-circulating germ cells. Nature 441:1109-1114, 2006[CrossRef][Medline]

35. Oktay K: Spontaneous conceptions and live birth after heterotopic ovarian transplantation: Is there a germline stem cell connection? Hum Reprod 21:1345-1348, 2006[Abstract/Free Full Text]

36. Yeom YI, Fuhrmann G, Ovitt CE, et al: Germline regulatory element of Oct-4 specific for the totipotent cycle of embryonal cells. Development 122:881-894, 1996[Abstract]

37. Yoshimizu T, Sugiyama N, De Felice M, et al: Germline-specific expression of the Oct-4/green fluorescent protein (GFP) transgene in mice. Dev Growth Differ 41:675-684, 1999[CrossRef][Medline]

38. Szabo PE, Hübner K, Schöler HR, et al: Allele-specific expression of imprinted genes in mouse migratory primordial germ cells. Mech Dev 115:157-160, 2002[CrossRef][Medline]

39. Reference deleted by author.

40. Reference deleted by author.

41. Partridge AH, Bunnell CA, Winer EP: Quality of life issues among women undergoing high-dose chemotherapy for breast cancer. Breast Dis 14:41-50, 2001[Medline]

42. Partridge AH, Gelber S, Peppercorn J, et al: Web-based survey of fertility issues in young women with breast cancer. J Clin Oncol 22:4174-4183, 2004[Abstract/Free Full Text]

43. Krause DS: Engraftment of bone marrow-derived epithelial cells. Ann N Y Acad Sci 1044:117-124, 2005[CrossRef][Medline]

44. Hirshfield AN: Development of follicles in the mammalian ovary. Int Rev Cytol 124:43-101, 1991[Medline]

45. Gougeon A: Regulation of ovarian follicular development in primates: Facts and hypotheses. Endocr Rev 17:121-155, 1996[Abstract/Free Full Text]

46. Gosden RG, Faddy MJ: Biological bases of premature ovarian failure. Reprod Fertil Dev 10:73-78, 1998[CrossRef][Medline]

47. Jurisicova A, Lee H-J, D'Estaing SG, et al: Molecular requirements for doxorubicin-mediated death in murine oocytes. Cell Death Differ 13:1466-1474, 2006[CrossRef][Medline]

48. Ryu B-Y, Orwig KE, Oatley JM, et al: Effects of aging and niche microenvironment on spermatogonial stem cell self-renewal. Stem Cells 24:1505-1511, 2006[CrossRef][Medline]

49. Niikura Y, Skaznik-Wikiel M, Johnson J, et al: Germline stem cell transplantation does not reverse age-related ovarian failure. J Soc Gynecol Investig 13:187A, 2006 (abstr 372)

Submitted December 7, 2006; accepted February 23, 2007.


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Facebook Facebook   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?

Related Editorial

  • Regeneration of Oocytes After Chemotherapy: Connecting the Evidence From Mouse to Human
    Kutluk Oktay and Ozgur Oktem
    JCO 2007 25: 3185-3187 [Full Text]


This article has been cited by other articles:


Home page
Mol Hum ReprodHome page
J. L. Tilly and E. E. Telfer
Purification of germline stem cells from adult mammalian ovaries: a step closer towards control of the female biological clock?
Mol. Hum. Reprod., July 1, 2009; 15(7): 393 - 398.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
A.I. Marques-Mari, O. Lacham-Kaplan, J.V. Medrano, A. Pellicer, and C. Simon
Differentiation of germ cells and gametes from stem cells
Hum. Reprod. Update, May 1, 2009; 15(3): 379 - 390.
[Abstract] [Full Text] [PDF]


Home page
Reproductive SciencesHome page
Hongling Du and H. S. Taylor
Reviews: Stem Cells and Female Reproduction
Reproductive Sciences, February 1, 2009; 16(2): 126 - 139.
[Abstract] [PDF]


Home page
ReproductionHome page
E. A McLaughlin and S. C McIver
Awakening the oocyte: controlling primordial follicle development
Reproduction, January 1, 2009; 137(1): 1 - 11.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
J. L. Tilly, Y. Niikura, and B. R. Rueda
The Current Status of Evidence for and Against Postnatal Oogenesis in Mammals: A Case of Ovarian Optimism Versus Pessimism?
Biol Reprod, January 1, 2009; 80(1): 2 - 12.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
S. Begum, V.E. Papaioannou, and R.G. Gosden
The oocyte population is not renewed in transplanted or irradiated adult ovaries
Hum. Reprod., October 1, 2008; 23(10): 2326 - 2330.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. L. Tilly and B. R. Rueda
Stem Cell Contribution to Ovarian Development, Function, and Disease
Endocrinology, September 1, 2008; 149(9): 4307 - 4311.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
K. Oktay and O. Oktem
Regeneration of Oocytes After Chemotherapy: Connecting the Evidence From Mouse to Human
J. Clin. Oncol., August 1, 2007; 25(22): 3185 - 3187.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, H.-J.
Right arrow Articles by Tilly, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, H.-J.
Right arrow Articles by Tilly, J. L.
Related Articles
Right arrowRelated Editorial
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

About
JCO
 Editorial
Roster
 Advertising
Information
 Librarians &
Institutions
 Rights &
Permissions
 PDA Services

Copyright © 2007 by the American Society of Clinical Oncology, Online ISSN: 1527-7755. Print ISSN: 0732-183X
Terms and Conditions of Use
  HighWire Press HighWire Press™ assists in the publication of JCO Online