Advertisement
Journal of Clinical Oncology  
Search for:
Limit by:
  Browse by Subject or Issue
Home Search or Browse JCO My JCO Subscriptions Customer Service Site Map

Journal of Clinical Oncology, Vol 25, No 25 (September 1), 2007: pp. 3837-3845
© 2007 American Society of Clinical Oncology.
DOI: 10.1200/JCO.2007.11.4850

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lim, H.-S.
Right arrow Articles by Ro, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lim, H.-S.
Right arrow Articles by Ro, J.
Related Articles
Right arrowRelated Correspondence
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Clinical Implications of CYP2D6 Genotypes Predictive of Tamoxifen Pharmacokinetics in Metastatic Breast Cancer

Hyeong-Seok Lim, Han Ju Lee, Keun Seok Lee, Eun Sook Lee, In-Jin Jang, Jungsil Ro

From the Research Institute and Hospital, National Cancer Center, Goyang, Gyeonggi; and Department of Pharmacology, Seoul National University College of Medicine, Seoul, Korea

Address reprint requests to Jungsil Ro, MD, Research Institute and Hospital, National Cancer Center, 809 Madu1-dong, Ilsan-gu, Goyang-si, Gyeonggi-do, 411-769, Republic of Korea; e-mail: jungsro{at}ncc.re.kr


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 AUTHORS' DISCLOSURES OF...
 AUTHOR CONTRIBUTIONS
 Appendix
 REFERENCES
 
Purpose The CYP3A and CYP2D6 enzymes play a major role in converting tamoxifen to its active metabolites. CYP3A is a highly inducible enzyme, regulated mainly by pregnane X receptor (PXR). This study assessed the association between genetic polymorphisms of CYP2D6 and PXR, and tamoxifen pharmacokinetics (PK) and clinical outcomes in patients with breast cancer.

Patients and Methods Plasma concentrations of tamoxifen and its metabolites were measured. Common alleles of CYP2D6 and PXR were identified in 202 patients treated with tamoxifen 20 mg daily for more than 8 weeks. Twelve of the 202 patients and an additional nine patients with metastatic breast cancer receiving tamoxifen were assessed for clinical outcome in correlation with genotypes.

Results Patients carrying CYP2D6*10/*10 (n = 49) demonstrated significantly lower steady-state plasma concentrations of 4-hydroxy-N-desmethyltamoxifen and 4-hydroxytamoxifen than did those with other genotypes (n = 153; 4-hydroxy-N-desmethyltamoxifen: 7.9 v 18.9 ng/mL, P < .0001; 4-hydroxytamoxifen: 1.5 v 2.6 ng/mL, P < .0001), whereas no difference by PXR genotypes was found. CYP2D6*10/*10 was significantly more frequent among nonresponders with MBC (100% v 50%, P = .0186). In Cox proportional hazard analysis, CYP2D6 genotype and number of disease sites were significant factors affecting time to progression (TTP). The median TTP for patients receiving tamoxifen was shorter in those carrying CYP2D6*10/*10 than for others (5.0 v 21.8 months, P = .0032)

Conclusion CYP2D6*10/*10 is associated with lower steady-state plasma concentrations of active tamoxifen metabolites, which could possibly influence the clinical outcome by tamoxifen in Asian breast cancer patients.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 AUTHORS' DISCLOSURES OF...
 AUTHOR CONTRIBUTIONS
 Appendix
 REFERENCES
 
Tamoxifen has been widely used for the treatment of patients with hormone-dependent breast cancer. Tamoxifen is converted to the active metabolites 4-hydroxytamoxifen and 4-hydroxy-N-desmethyltamoxifen (endoxifen), which is more than 100 times more potent than tamoxifen in antiestrogen effect.1,2 The majority of tamoxifen is biotransformed to N-desmethyltamoxifen by cytochrome P450 (CYP) 3A enzymes. A portion of the desmethyltamoxifen metabolite is further metabolized to endoxifen by CYP2D6. A minor portion of tamoxifen is converted to 4-hydroxytamoxifen, which is performed mainly by CYP2D6.3

CYP2D6 plays a major role in the biotransformation of many drugs including neuroleptics, antiarrythmics, antidepressants, and selective serotonin reuptake inhibitors and blockers.4 There is a large interindividual and ethnic variability in the metabolism of drugs by CYP2D6 that can be explained largely by genetic polymorphisms affecting the enzyme's function and expression. The typical CYP2D6 phenotype is usually classified into three groups: poor metabolizers (PMs), extensive metabolizers (EMs) and ultrarapid metabolizers. The PM group is characterized by complete absence of CYP2D6 enzyme activity, found in less than 1% of Koreans, Japanese, or Chinese, and in 7% to 10% of whites.5-8 CYP2D6*3, CYP2D6*4, CYP2D6*5, and CYP2D6*6 cause absence of enzyme activity, and 93% to 97.5% of the PMs can be predicted by these genotypes.9 CYP2D6*4 occurs with an allele frequency of 20% to 25% and is responsible for 70% to 90% of all PMs in whites, but is rare in Asians. The allele frequency of CYP2D6*5 in Asians is approximately 5%.10 The CYP2D6*10 is a major variant in Asians, and is associated with decreased CYP2D6 activity resulting from the formation of an unstable enzyme. Approximately 50% of Koreans carry this allele,11,12 whereas only 2% of whites do,13 explaining why the median CYP2D6 enzyme activity is lower in East Asian EMs than in white EMs.10,12 In contrast, hereditary duplication/multiplication of the CYP2D6*2 gene is related to extremely high CYP2D6 activity.14 The various polymorphisms of CYP2D6 could account for a wide range of tamoxifen pharmacokinetics (PK) and efficacies. Recent studies reported the association between CYP2D6 genotypes and the plasma concentration of endoxifen.1,15 However, the study result on the association between CYP2D6 genotypes common in Asian population including *10 and tamoxifen biotransformation have not been reported yet. There have been controversies in the association of CYP2D6 genotypes and the efficacy of tamoxifen.16-18

CYP3A is a highly xenobiotic-inducible enzyme,19 and transcription of the gene is regulated by nuclear hormone receptors. Pregnane X receptor (PXR) is a major transcriptional regulator of many drug-metabolizing enzymes including CYP3A.20 PXR is highly expressed in liver and intestine and activated by endogenous and exogenous compounds.21 A previous study showed that three genetic variants of PXR, 7635G>A, 8055C>T, and –25385C>T, are functional ones.22 These variant alleles are frequently observed with ethnic differences.22 Tamoxifen and 4-hydroxytamoxifen are ligands for PXR and were shown to markedly increase the expression and activity of CYP3A4 through activation of PXR.23 Hypothetically, the extent of induction of CYP3A by tamoxifen and its metabolite after repeated administration of tamoxifen could influence the conversion of tamoxifen to N-desmethyltamoxifen, a major metabolite mediated by CYP3A, thus the subsequent formation of endoxifen. Furthermore, extent of the induction might be different according to PXR genotypes, which could be ultimately associated with the plasma concentrations of N-desmethyltamoxifen and endoxifen.

In this study, we evaluated the association of CYP2D6 and PXR genetic polymorphisms common in Asian populations and the steady-state concentration of tamoxifen and its metabolites in breast cancer patients taking tamoxifen and subsequently applied to look for an association of this effect with the efficacy of tamoxifen in metastatic breast cancer (MBC) as a pilot trial.


    PATIENTS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 AUTHORS' DISCLOSURES OF...
 AUTHOR CONTRIBUTIONS
 Appendix
 REFERENCES
 
Participants and Study Design
All of the participants in this study had histologically or cytologically diagnosed breast cancer. All patients were Korean females with a median age of 47 years (range, 25 to 73 years) with estrogen- or progesterone-receptor–positive tumors.

The current study consists of two parts. First, we evaluated the association between genotypes involving tamoxifen biotransformation and pharmacokinetics (genotype-PK study). On the basis of the results of the genotype-PK study, we evaluated the association between genotypes and efficacy of tamoxifen (genotype-efficacy study) in patients with MBC (Fig 1).


Figure 1
View larger version (23K):
[in this window]
[in a new window]
[PowerPoint Slide for Teaching]
 
Fig 1. Study flow diagram. PK, pharmacokinetics; MBC, metastatic breast cancer.

 
In genotype-PK study, venous blood (8 mL) was collected in sodium heparinized tubes from breast cancer patients taking tamoxifen 20 mg daily for more than 8 weeks as treatment at National Cancer Center Hospital (Gyeonggi, Korea). Patients who had taken known CYP2D6 inhibitors or inducers within 28 days of the study were excluded. Patients with a previous history of GI disorders or surgery that may affect the absorption of tamoxifen were excluded from the study.

Subsequently, we performed a genotype-efficacy study. Additional consecutive patients who were taking tamoxifen for MBC were enrolled. These patients were genotyped without PK analysis, and their clinical characteristics were analyzed together with those of patients with MBC in the genotype-PK study. The response was evaluated according to the Response Evaluation Criteria in Solid Tumors guidelines.24

All samples were centrifuged at 2,000 x g for 10 minutes. Plasma and leukocyte portions of blood were separated into cryovials and stored at –70°C until analysis.

The study protocol was approved by the institutional review board of the National Cancer Center Hospital. All patients gave written informed consent before participating in the study.

Genotype Analysis
Genomic DNA was extracted from the peripheral whole blood of each patient using Qiagen DNA extraction kit (Qiagen, Hilden, Germany). CYP2D6*2xN, CYP2D6*5, and CYP2D6*10 were identified by polymerase chain reaction (PCR) methods as reported previously.10,25,26 CYP2D6*2xN allele was determined by long PCR using two primer sets, 2D6-F/-R and 2D6dupl-F/-R, according to the method of Lundqvist et al.25 CYP2D6*5 allele was detected in a similar fashion using long PCR with two primer sets, 2D6-F/-R and 2D6*5-F/-R, according to the method of Gaedigk et al.26 For detection of CYP2D6*10 allele, PCR products were amplified using primers 9, 10, and 10B, and then digested with the restriction enzyme Hph I.10,26 Two PXR alleles, 7635G>A and 8055C>T, were determined by single base extension method. Primers for the detection of 7635G>A were GAGAGGCAGCCAGACAGCA (forward), TGAATGAGGAGCAAGGCCAT (reverse), and ATGGGAAAGGAGCCATCCTCCCTCTTCCTCTC (extension), and for 8055C>T were GAGAGGCAGCCAGACAGCA (forward), TGAATGAGGAGCAAGGCCAT (reverse), and CTTGCTGAGAAGCTGCCCCTCCAT (extension). Amplification was carried out in a GeneAmp PCR System 9700 thermal cycler (Applied Biosystems, Foster City, CA).27 Primer extension reactions were performed with the SNaPshot ddNTP Primer Extension Kit (Applied Biosystems).

Measurement of Plasma Concentration of Tamoxifen and Its Metabolites
Tamoxifen and its metabolites, N-desmethyltamoxifen, Z-4-hydroxy-N-desmethyltamoxifen, and Z-4-hydroxytamoxifen, in plasma were measured by high-performance liquid chromatography with online photocyclization as described previously with modification.28 Z-4-hydroxytamoxifen (purity, 98%) and propranolol were purchased from Sigma-Aldrich (St Louis, MO). N-desmethyltamoxifen and tamoxifen were purchased from Toronto Research Chemicals (Toronto, Ontario, Canada). A mixture of E and Z isomers of Z-4-hydroxy-N-desmethyltamoxifen was provided by D.A. Flockhart at Indiana University School of Medicine (Indianapolis, IN), and the Z isomer was separated with a preparative column (5-µm particle size, 21.2 x 150 mm ID; Agilent Technologies, Palo Alto, CA) with a mobile phase of 35% acetonitrile in 20 mmol/L ammonium formate buffer (pH 3) at a flow rate of 5 mL/min. The compounds were separated through an analytic column (Capcell Pak C18: 5-µm particle size, 4.6 x 150 mm; Shiseido, Tokyo, Japan) with a mobile phase of 35% acetonitrile in 20 mmol/L potassium phosphate buffer (pH 3) at a flow-rate of 1 mL/min. A PHRED Photochemical Reactor (Sigma-Aldrich) supplied with a 20-m knitted reactor coil (0.25 mm ID; Sigma-Aldrich) and a 254-nm UV lamp (Sigma-Aldrich) was used to amplify the fluorescence. The fluorescence detector was set at an excitation wavelength of 256 nm and emission wavelength of 380 nm. The method was validated for each compound over 1 to approximately 40 ng/mL (Z-4-hydroxy N-desmethyltamoxifen), 0.5 to approximately 10 ng/mL (Z-4-hydroxytamoxifen), 15 to approximately 450 ng/mL (N-desmethyltamoxifen), and 15 to 450 ng/mL (tamoxifen) with the linearity established (r2 > 0.9998 for each compound).

Statistical Analysis
The differences in plasma concentrations of tamoxifen and its metabolites by genotypes were compared using Wilcoxon rank sum test or analysis of variance. The association between patients' genotypes and clinical benefit, which was defined as complete response (CR), partial response (PR), or stable disease (SD) lasting as least 24 weeks during tamoxifen treatment, was tested with Fisher's exact test. Cox proportional hazard model analysis was performed to identify the significant factors associated with time to disease progression (TTP) during tamoxifen administration, defined as the time from the first day of tamoxifen to progression of the cancer. Kaplan-Meier estimates and log-rank test were used in univariate analysis of TTP.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 AUTHORS' DISCLOSURES OF...
 AUTHOR CONTRIBUTIONS
 Appendix
 REFERENCES
 
Overall Study Flow
In the genotype-PK study, 212 patients who were taking tamoxifen, either for MBC or as adjuvant therapy at the National Cancer Center Hospital, Korea, were assessed to determine their eligibility for the study between June 2004 and June 2006. Of these, 202 were assessable for the genotype-PK association with tamoxifen. In the genotype-efficacy study, an additional nine patients with MBC were enrolled. These nine patients were genotyped without PK analysis, and their medical records were retrospectively reviewed together with those of the 12 MBC patients in the genotype-PK study (a total of 21 MBC patients) to evaluate the association between genotype and tamoxifen efficacy (Fig 2).


Figure 2
View larger version (20K):
[in this window]
[in a new window]
[PowerPoint Slide for Teaching]
 
Fig 2. Steady-state plasma concentrations of endoxifen and 4-hydroxytamoxifen according to CYP2D6 genotypes (Box-Whisker plots). (A, B) Comparison by homozygous variant for *10 (*10/*10), heterozygote (Wt/*10) and homozygous wild-type (Wt/Wt) genotypes. (C, D) Comparison by homozygous variant for *10 and *5 (V/V), heterozygote (W/V) and homozygous wild (W/W) genotypes.

 
Patient Characteristics
In the genotype-PK study, there were no statistically significant differences in the demographic characteristics (Table 1). In 21 patients of genotype-efficacy study, median age was 46.5 years (range, 31 to 70 years) and median duration of tamoxifen therapy was 9.0 months (range, 2.1 to 23.2+ months). Patients began tamoxifen therapy from April 2002 to October 2005, with a median follow-up of 19.6 months (range, 6.6 to 53.8 months). All tumors were estrogen receptor–or progesterone receptor–positive by immunohistochemistry. Nine metastatic patients had three or more disease sites (Table 1).


View this table:
[in this window]
[in a new window]

 
Table 1. Demographic and Clinical Characteristics of Patients

 
Genotype Profiles
The allele frequencies of CYP2D6*10, *5 and *2N were 46.3%, 5.2% and 1.0%, respectively. Forty-nine patients (24.3%) were homozygous for the CYP2D6*10 variant. Only two patients carried the CYP2D6*5 homozygous variant, and four were heterozygous for the CYP2D6*2N variant. PXR 7635G>A and 8055C>T allele frequencies were 49.0% and 39.6%, respectively (Table A1, online only).

On the other hand, 21 metastatic patients in genotype-efficacy study showed a significantly higher proportion of CYP2D6*10/*10 genotypes, where 57.1% (n = 12) of patients were homozygous for CYP2D6*10 variant compared with 24.3% in the genotype-PK study (P = .0019).

Steady-State Plasma Concentrations of Tamoxifen and Its Metabolites by Genotypes
To analyze the effect of CYP2D6 genotypes on the plasma concentration of tamoxifen and its metabolites, we combined *10 and *5 into a variant genotype (V) such that the participants who carried *1/*10 or *1/*5 were grouped together into a wild-type/variant (W/V, where W is defined as a CYP2D6 allele not containing *5 and *10) group. However, considering the much higher frequency of the *10 allele among Koreans, we tested the effect of this once we grouped the participants according to *10 allele into homozygous (*10/*10), heterozygous (wild-type/*10 [wt/*10] where Wt is defined as a CYP2D6 allele not containing *10) and homozygous wild (wild-type/wild-type [Wt/Wt]) variants. The steady-state plasma concentrations of both endoxifen and 4-hydroxytamoxifen were significantly lower in patients carrying the CYP2D6*10/*10 genotype than in those with Wt/*10 or Wt/Wt (endoxifen, 7.9 v 19.9 or 18.1 ng/mL, P < .0001; 4-hydroxytamoxifen, 1.5 v 2.5 or 2.8 ng/mL, P < .0001; Table 2; Fig 2). The concentrations were comparable between Wt/*10 and Wt/Wt. The patients who were homozygous for *10 or *5 (V/V) also showed lower concentrations than those with W/V or W/W (endoxifen, 8.1 v 18.0 or 20.7 ng/mL, P < .0001; 4-hydroxytamoxifen, 1.5 v 2.5 or 2.9 ng/mL, P < .0001; Table 2; Fig 2). The mean concentrations of endoxifen and 4-hydroxytamoxifen in patients carrying the CYP2D6*2N allele (n = 4) were 18.2 and 2.4 ng/mL, respectively, which were not significantly different compared with the other genotypes for both compounds (data not shown). There was no significant association between the CYP2D6 genotype and the concentration of tamoxifen and N-desmethyltamoxifen.


View this table:
[in this window]
[in a new window]

 
Table 2. Steady-State Plasma Concentrations of Endoxifen and 4-Hydroxy-Tamoxifen by CYP2D6 or PXR Genotypes (n = 202)

 
Genetic polymorphisms of PXR (7635G>A and 8055C>T) showed neither an association with N-desmethyltamoxifen and endoxifen nor the other compounds (Table 2).

Clinical Efficacy of Tamoxifen According to CYP2D6 Genotypes
Although patients with *10/*10 or who were homozygous variants for *10 or *5 showed distinctively lower concentrations of the active metabolites of tamoxifen, the frequency of *5/*5 or *10/*5 is low among Koreans. Therefore, the genotype-efficacy association study focused on the *10/*10, Wt/*10, and Wt/Wt genotype groups. Fifteen of the 21 patients with MBC achieved clinical benefit (CR + PR + SD ≥ 24 weeks) while receiving tamoxifen, whereas the remaining nine experienced progressive disease (PD) or SD with duration less than 24 weeks, with an overall TTP of 8.7 months (range, 2.1 to approximately 23.2+ months). All nine patients (100%) with CYP2D6 Wt/Wt or Wt/*10 genotypes, and six (50%) of the 12 patients with *10/*10 genotypes experienced clinical benefit (P = .0186). Nineteen patients had measurable lesions for response. All six patients with PD or SD lasting less than 24 weeks carried the *10/*10 genotype. One patient who experienced PR and eight patients with SD lasting at least 24 weeks had Wt/Wt or Wt/*10 (Table 3). With a median follow-up of 19.6 months (range, 6.6 to 53.8 months), the median TTP by Kaplan-Meier analysis was much shorter in patients who were CYP2D6*10/*10 homozygotes compared with the other genotypes evaluated (TTP: 5.03 v 21.8 months, P = .0032; Fig 3).


View this table:
[in this window]
[in a new window]

 
Table 3. CYP2D6 Genotypes Profiles by Clinical Outcomes in 21 Patients With Metastatic Breast Cancer Receiving Tamoxifen

 

Figure 3
View larger version (12K):
[in this window]
[in a new window]
[PowerPoint Slide for Teaching]
 
Fig 3. Time to disease progression in patients treated with tamoxifen for metastatic breast cancer.

 
In univariate Cox proportional hazard analysis for TTP, CYP2D6 genotype (Wt/Wt and *Wt/*10 v *10/*10) and number of disease sites (≥ 3 v < 3) were significant variables after examining the following variables: CYP2D6 genotype, age, intensity of estrogen receptor and progesterone receptor status, number of disease sites, organ of disease sites, and prior receipts of aromatase inhibitor. In multivariate analysis with the significant variables in univariate analysis, the CYP2D6 genotype and number of disease sites still remained the significant variables (P = .016 and .012, respectively; Table 4).


View this table:
[in this window]
[in a new window]

 
Table 4. Univariate and Multivariate Cox Proportional Hazards Analyses for Time to Disease Progression in Patients With Metastatic Breast Cancer Receiving Tamoxifen (n = 21)

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 AUTHORS' DISCLOSURES OF...
 AUTHOR CONTRIBUTIONS
 Appendix
 REFERENCES
 
Tamoxifen still plays a major therapeutic role in hormone-responsive breast cancer, specifically in premenopausal women. In postmenopausal women with breast cancer, aromatase inhibitors have recently tended to replace tamoxifen as the preferred hormone therapy owing to their superior efficacy and favorable toxicity profiles in both the metastatic and adjuvant settings. Tamoxifen will continue to have a substantial role in Asian countries including Korea, where, unlike in Western countries, more than half of breast cancers develop in premenopausal women.29 It was only very recently disclosed by Flockhart et al1 that genotypic differences of CYP2D6 among patients could affect tamoxifen metabolism. Indeed, in a clinical study, the patients with the CYP2D6*4/*4 genotype had poorer clinical outcomes with shorter relapse-free (P = .023) and disease-free survival (P = .012), and it was also shown that the 5-year disease-free survival for CYP2D6*4/*4 homozygous patients was only 46%, compared with 83% for patients who were not carriers of the CYP2D6*4 allele.18

Recently, a few additional studies concerning genetic polymorphisms of CYP2D6 in association with tamoxifen metabolism have been reported. These data ought to be applied clinically to verify whether patients with a certain genotype cannot achieve clinical benefit with tamoxifen because of low plasma concentrations of the active metabolite. This study demonstrated that CYP2D6*10/*10 was significantly associated with lower plasma concentrations of endoxifen and 4-hydroxytamoxifen, two active metabolites of tamoxifen. We then applied this result to the small number of patients as a pilot study who took tamoxifen for MBC so that clinical outcomes could be readily evaluated in association with these polymorphisms. Indeed, the data demonstrated significant associations between the CYP2D6 genetic polymorphisms and the clinical outcomes of patients, where the CYP2D6*10/*10 genotype, along with the number of disease sites, was a significant factor affecting TTP by Cox proportional hazard analysis. The median TTP for patients with CYP2D6*10/*10 was shorter according to the Kaplan-Meier method, and the frequency of the CYP2D6*10/*10 genotype was higher in MBC patients with poor clinical outcomes. However, other genetic variants and clinical factors as well could affect the efficacy of tamoxifen in breast cancer patients.

Although the difference of efficacy on tamoxifen by CYP2D6 genotypes in the current study could be possibly explained by the differences in the rate of formation of tamoxifen active metabolites, it was previously reported that the efficacy of tamoxifen was not different between daily doses of 20 mg and 40 mg, although the serum concentration of tamoxifen was significantly higher in patients receiving 40 mg.31 Although one could not fully explain this disparity, one possible explanation might be that in dose ranges from 20 mg to 40 mg, the steady-state plasma concentration of tamoxifen active metabolites are within the plateau (ie, maximal effect in the concentration-response curve of maximum effect model30), whereas those according to the CYP2D6 genotypes evaluated in this study on 20 mg/d of tamoxifen are within the rapidly changing region in the curve. In this case, we could observe the difference according to the CYP2D6 genotypes treated with 20 mg/d of tamoxifen, but not the significant difference between 20 mg/d and 40 mg/d of tamoxifen.

In a few randomized trials, the third-generation aromatase inhibitors have demonstrated superior efficacy compared with tamoxifen when used as adjuvant therapy in postmenopausal women with hormone receptor–positive breast cancer.32-34 It could be assumed that the poorer outcome in tamoxifen arms may reflect the poorer outcome of patients carrying CYP2D6 variants that lead to a poor metabolizing phenotype.

In summary, our study suggests that the CYP2D6*10/*10 genotype is a marker that is associated with lower steady-state plasma concentrations of tamoxifen active metabolites, that could lead to reduced clinical benefits in Asian breast cancer patients on tamoxifen. Future research is warranted to compare tamoxifen at a higher dose or a different antiestrogen independent of the CYP2D6 genotype or aromatase inhibitors for the PM group of patients.


    AUTHORS' DISCLOSURES OF POTENTIAL CONFLICTS OF INTEREST
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 AUTHORS' DISCLOSURES OF...
 AUTHOR CONTRIBUTIONS
 Appendix
 REFERENCES
 
The author(s) indicated no potential conflicts of interest.


    AUTHOR CONTRIBUTIONS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 AUTHORS' DISCLOSURES OF...
 AUTHOR CONTRIBUTIONS
 Appendix
 REFERENCES
 
Conception and design: Hyeong-Seok Lim, In-Jin Jang, Jungsil Ro

Administrative support: Hyeong-Seok Lim, Jungsil Ro

Provision of study materials or patients: Hyeong-Seok Lim, Han Ju Lee, Keun Seok Lee, Eun Sook Lee, Jungsil Ro

Collection and assembly of data: Hyeong-Seok Lim, Han Ju Lee

Data analysis and interpretation: Hyeong-Seok Lim, Jungsil Ro

Manuscript writing: Hyeong-Seok Lim, Jungsil Ro

Final approval of manuscript: Jungsil Ro


    Appendix
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 AUTHORS' DISCLOSURES OF...
 AUTHOR CONTRIBUTIONS
 Appendix
 REFERENCES
 
Go


View this table:
[in this window]
[in a new window]

 
Table A1. Genotype Profiles of CYP2D6 and PXR Polymorphisms

 


    ACKNOWLEDGMENTS
 
We acknowledge Kyun-Seop Bae at Asan Medical Center, Ji-Young Park, Kyoung-Ah Kim at Korea University College of Medicine, and Ka Heon Song at Seoul National University Hospital for their technical assistances with the HPLC analysis.


    NOTES
 
Supported by NCC Grants No. 0410590 and 0210150.

Presented in part at the 42nd Annual Meeting of the American Society of Clinical Oncology, June 2-6, 2006, Atlanta, GA, and the 29th Annual San Antonio Breast Cancer Symposium, December 14-17, 2006, San Antonio, TX.

Authors' disclosures of potential conflicts of interest and author contributions are found at the end of this article.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 AUTHORS' DISCLOSURES OF...
 AUTHOR CONTRIBUTIONS
 Appendix
 REFERENCES
 
1. Stearns V, Johnson MD, Rae JM, et al: Active tamoxifen metabolite plasma concentrations after coadministration of tamoxifen and the selective serotonin reuptake inhibitor paroxetine. J Natl Cancer Inst 95:1758-1764, 2003[Abstract/Free Full Text]

2. Lim YC, Li L, Desta Z, et al: Endoxifen, a secondary metabolite of tamoxifen, and 4-OH-tamoxifen induce similar changes in global gene expression patterns in MCF-7 breast cancer cells. J Pharmacol Exp Ther 318:503-512, 2006[Abstract/Free Full Text]

3. Desta Z, Ward BA, Soukhova NV, et al: Comprehensive evaluation of tamoxifen sequential biotransformation by the human cytochrome P450 system in vitro: Prominent roles for CYP3A and CYP2D6. J Pharmacol Exp Ther 310:1062-1075, 2004[Abstract/Free Full Text]

4. Eichelbaum M, Gross AS: The genetic polymorphism of debrisoquine/sparteine metabolism-clinical aspects, in Kalow W (ed) Pharmacogenetics of Drug Metabolism. New York, NY, Pergamon Press Inc, 1992, pp 625-648

5. Alván G, Bechtel P, Iselius L, et al: Hydroxylation polymorphisms of debrisoquine and mephenytoin in European populations. Eur J Clin Pharmacol 39:533-537, 1990[CrossRef][Medline]

6. Sohn DR, Shin SG, Park CW, et al: Metoprolol oxidation polymorphism in a Korean population: Comparison with native Japanese and Chinese populations. Br J Clin Pharmacol 32:504-507, 1991[Medline]

7. Nakamura K, Goto F, Ray WA, et al: Interethnic differences in genetic polymorphism of debrisoquin and mephenytoin hydroxylation between Japanese and Caucasian populations. Clin Pharmacol Ther 38:402-408, 1985[Medline]

8. Horai Y, Nakano M, Ishizaki T, et al: Metoprolol and mephenytoin oxidation polymorphisms in Far Eastern Oriental subjects: Japanese versus mainland Chinese. Clin Pharmacol Ther 46:198-207, 1989[Medline]

9. Sachse C, Brockmoller J, Hildebrand M, et al: Correctness of prediction of the CYP2D6 phenotype confirmed by genotyping 47 intermediate and poor metabolizers of debrisoquine. Pharmacogenetics 8:181-185, 1998[Medline]

10. Johansson I, Oscarson M, Yue QY, et al: Genetic analysis of the Chinese cytochrome P4502D locus: Charaterization of variant CYP2D6 gene present in subjects with diminished capacity for debreisoquine hydroxylation. Mol Pharmacol 46:452-459, 1994[Abstract]

11. Yoon YR, Cha IJ, Shon JH, et al: Relationship of paroxetine disposition to metoprolol metabolic ratio and CYP2D6*10 genotype of Korean subjects. Clin Pharmacol Ther 67:567-576, 2000[CrossRef][Medline]

12. Roh HK, Dahl ML, Johansson I, et al: Debrisoquine and S-mephenytoin hydroxylation phenotypes and genotypes in a Korean population. Pharmacogenetics 6:441-447, 1996[CrossRef][Medline]

13. Gaedigk A, Gotschall RR, Forbes NS, et al: Optimization of cytochrome P4502D6 (CYP2D6) phenotype assignment using a genotyping algorithm based on allele frequency data. Pharmacogenetics 9:669-682, 1999[Medline]

14. Bertilsson L, Dahl ML, Sjoqvist F, et al: Molecular basis for rational megaprescribing in ultrarapid hydroxylators of debrisoquine. Lancet 341:63, 1993[Medline]

15. Borges S, Desta Z, Li L, et al: Quantitative effect of CYP2D6 genotype and inhibitors on tamoxifen metabolism: Implication for optimization of breast cancer treatment. Clin Pharmacol Ther 80:61-74, 2006[CrossRef][Medline]

16. Wegman P, Elingarami S, Carstensen J, et al: Genetic variants of CYP3A5, CYP2D6, SULT1A1, UGT2B15 and tamoxifen response in postmenopausal patients with breast cancer. Breast Cancer Res 9:R7, 2007[CrossRef][Medline]

17. Wegman P, Vainikka L, Stal O, et al: Genotype of metabolic enzymes and the benefit of tamoxifen in postmenopausal breast cancer patients. Breast Cancer Res 7:R284-R290, 2005[CrossRef][Medline]

18. Goetz MP, Rae JM, Suman VJ, et al: Pharmacogenetics of tamoxifen biotransformation is associated with clinical outcomes of efficacy and hot flashes. J Clin Oncol 23:9312-9318, 2005[Abstract/Free Full Text]

19. Denison MS, Whitlock JP Jr: Xenobiotic-inducible transcription of cytochrome P450 genes. J Biol Chem 270:18175-18178, 1995[Free Full Text]

20. Bertilsson G, Heidrich J, Svensson K, et al: Identification of a human nuclear receptor defines a new signaling pathway for CYP3A induction. Proc Natl Acad Sci U S A 95:12208-12213, 1998[Abstract/Free Full Text]

21. Kliewer SA, Goodwin B, Willson TM: The nuclear pregnane X receptor: A key regulator of xenobiotic metabolism. Endocr Rev 23:687-702, 2002[Abstract/Free Full Text]

22. Zhang J, Kuehl P, Green ED, et al: The human pregnane X receptor: Genomic structure and identification and functional characterization of natural allelic variants. Pharmacogenetics 11:555-572, 2001[CrossRef][Medline]

23. Desai PB, Nallani SC, Sane RS, et al: Induction of cytochrome P450 3A4 in primary human hepatocytes and activation of the human pregnane X receptor by tamoxifen and 4-hydroxytamoxifen. Drug Metab Dispos 30:608-612, 2002[Abstract/Free Full Text]

24. Therasse P, Arbuck SG, Eisenhauer EA, et al: New guidelines to evaluate the response to treatment in solid tumors: European Organization for Research and Treatment of Cancer, National Cancer Institute of the United States, National Cancer Institute of Canada. J Natl Cancer Inst 92:205-216, 2000[Abstract/Free Full Text]

25. Lundqvist E, Johansson I, Ingelman-Sundberg M: Genetic mechanisms for duplication and multiplication of the human CYP2D6 gene and methods for detection of duplicated CYP2D6 genes. Gene 226:327-338, 1999[CrossRef][Medline]

26. Fukuda T, Yamamoto I, Nishida Y, et al: Effect of the CYP2D6*10 genotype on venlafaxine pharmacokinetics in healthy adult volunteers. Br J Clin Pharmacol 47:450-453, 1999[CrossRef][Medline]

27. Don RH, Cox PT, Wainwright BJ, et al: ‘Touchdown’ PCR to circumvent spurious priming during gene amplification. Nucleic Acids Res 19:4008, 1991[Free Full Text]

28. Lee KH, Ward BA, Desta Z, et al: Quantification of tamoxifen and three metabolites in plasma by high-performance liquid chromatography with fluorescence detection: Application to a clinical trial. J Chromatogr B Analyt Technol Biomed Life Sci 791:245-253, 2003[Medline]

29. Shin HR, Jung KW, Won YJ, et al: 2002 annual report of the Korean Central Cancer Registry: Based on registered data from 139 hospitals. Cancer Res Treat 36:103-114, 2004

30. Bratherton DG, Brown CH, Buchanan R, et al: A comparison of two doses of tamoxifen (Nolvadex) in postmenopausal women with advanced breast cancer: 10 mg bd versus 20 mg bd. Br J Cancer 50:199-205, 1984[Medline]

31. Katzung Bertram G: Basic & Clinical Pharmacology,(ed 9). New York, NY, McGraw-Hill Press Inc, 2004, pp 28-30

32. Howell A, Cuzick J, Baum M, et al: Results of the ATAC (Arimidex, Tamoxifen, Alone or in Combination) trial after completion of 5 years' adjuvant treatment for breast cancer. Lancet 365:60-62, 2005[CrossRef][Medline]

33. Goss PE, Ingle JN, Martino S, et al: A randomized trial of letrozole in postmenopausal women after five years of tamoxifen therapy for early-stage breast cancer. N Engl J Med 349:1793-1802, 2003[Abstract/Free Full Text]

34. Coombes RC, Hall E, Gibson LJ, et al: A randomized trial of exemestane after two to three years of tamoxifen therapy in postmenopausal women with primary breast cancer. N Engl J Med 350:1081-1092, 2004[Abstract/Free Full Text]

Submitted March 6, 2007; accepted June 8, 2007.


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Facebook Facebook   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?

Related Correspondence

  • CYP2D6 and Ockham's Razor
    Francois Eisinger
    JCO 2008 26: 686-687 [Full Text]


This article has been cited by other articles:


Home page
JAMAHome page
W. Schroth, M. P. Goetz, U. Hamann, P. A. Fasching, M. Schmidt, S. Winter, P. Fritz, W. Simon, V. J. Suman, M. M. Ames, et al.
Association Between CYP2D6 Polymorphisms and Outcomes Among Women With Early Stage Breast Cancer Treated With Tamoxifen
JAMA, October 7, 2009; 302(13): 1429 - 1436.
[Abstract] [Full Text] [PDF]


Home page
Jpn J Clin OncolHome page
T. Toyama, H. Yamashita, H. Sugiura, N. Kondo, H. Iwase, and Y. Fujii
No Association Between CYP2D6*10 Genotype and Survival of Node-negative Japanese Breast Cancer Patients Receiving Adjuvant Tamoxifen Treatment
Jpn. J. Clin. Oncol., October 1, 2009; 39(10): 651 - 656.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
H. Brauch, T. E. Murdter, M. Eichelbaum, and M. Schwab
Pharmacogenomics of Tamoxifen Therapy
Clin. Chem., October 1, 2009; 55(10): 1770 - 1782.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
T. L. Lash and S. R. Cole
Immortal Person-Time in Studies of Cancer Outcomes
J. Clin. Oncol., August 10, 2009; 27(23): e55 - e56.
[Full Text] [PDF]


Home page
Ann OncolHome page
T. Saeki, S. Noguchi, K. Aogi, H. Inaji, T. Tabei, and T. Ikeda
Evaluation of the safety and tolerability of oral TAS-108 in postmenopausal patients with metastatic breast cancer
Ann. Onc., May 1, 2009; 20(5): 868 - 873.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
V. O. Dezentje, H.-J. Guchelaar, J. W.R. Nortier, C. J.H. van de Velde, and H. Gelderblom
Clinical Implications of CYP2D6 Genotyping in Tamoxifen Treatment for Breast Cancer
Clin. Cancer Res., January 1, 2009; 15(1): 15 - 21.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S.-H. Tan, S.-C. Lee, B.-C. Goh, and J. Wong
Pharmacogenetics in Breast Cancer Therapy
Clin. Cancer Res., December 15, 2008; 14(24): 8027 - 8041.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
K. Sakuyama, T. Sasaki, S. Ujiie, K. Obata, M. Mizugaki, M. Ishikawa, and M. Hiratsuka
Functional Characterization of 17 CYP2D6 Allelic Variants (CYP2D6.2, 10, 14A-B, 18, 27, 36, 39, 47-51, 53-55, and 57)
Drug Metab. Dispos., December 1, 2008; 36(12): 2460 - 2467.
[Abstract] [Full Text] [PDF]


Home page
Am. J. PsychiatryHome page
N. L. Henry, V. Stearns, D. A. Flockhart, D. F. Hayes, and M. Riba
Drug Interactions and Pharmacogenomics in the Treatment of Breast Cancer and Depression
Am J Psychiatry, October 1, 2008; 165(10): 1251 - 1255.
[Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. P. Goetz, V. J. Suman, F. J. Couch, M. M. Ames, J. M. Rae, M. G. Erlander, X.-J. Ma, D. C. Sgroi, C. A. Reynolds, W. L. Lingle, et al.
Cytochrome P450 2D6 and Homeobox 13/Interleukin-17B Receptor: Combining Inherited and Tumor Gene Markers for Prediction of Tamoxifen Resistance
Clin. Cancer Res., September 15, 2008; 14(18): 5864 - 5868.
[Abstract] [Full Text] [PDF]


Home page
BMJHome page
N. C Turner and A. L Jones
Management of breast cancer--Part II
BMJ, July 11, 2008; 337(jul11_2): a540 - a540.
[Full Text]


Home page
JNCI J Natl Cancer InstHome page
D. F. Hayes, V. Stearns, J. Rae, D. Flockhart, and on behalf of the Consortium on Breast Cancer Pharm
A Model Citizen? Is Tamoxifen More Effective Than Aromatase Inhibitors if We Pick the Right Patients?
J Natl Cancer Inst, May 7, 2008; 100(9): 610 - 613.
[Full Text] [PDF]


Home page
JCOHome page
Z. Desta and D. A. Flockhart
In Reply
J. Clin. Oncol., April 1, 2008; 26(10): 1765 - 1766.
[Full Text] [PDF]


Home page
JCOHome page
N. U. Lin and E. P. Winer
Advances in Adjuvant Endocrine Therapy for Postmenopausal Women
J. Clin. Oncol., February 10, 2008; 26(5): 798 - 805.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
F. Eisinger
CYP2D6 and Ockham's Razor
J. Clin. Oncol., February 1, 2008; 26(4): 686 - 687.
[Full Text] [PDF]


Home page
JCOHome page
Z. Desta and D. A. Flockhart
Germline Pharmacogenetics of Tamoxifen Response: Have We Learned Enough?
J. Clin. Oncol., November 20, 2007; 25(33): 5147 - 5149.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lim, H.-S.
Right arrow Articles by Ro, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lim, H.-S.
Right arrow Articles by Ro, J.
Related Articles
Right arrowRelated Correspondence
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

About
JCO
 Editorial
Roster
 Advertising
Information
 Librarians &
Institutions
 Rights &
Permissions
 PDA Services

Copyright © 2007 by the American Society of Clinical Oncology, Online ISSN: 1527-7755. Print ISSN: 0732-183X
Terms and Conditions of Use
  HighWire Press HighWire Press™ assists in the publication of JCO Online