This Article Full Text (PDF) Purchase Article View Shopping Cart Alert me when this article is cited Alert me if a correction is posted Services Email this article to a colleague Similar articles in this journal Alert me to new issues of the journal Save to my personal folders Download to citation manager Rights & Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Bates, G. J. Articles by Banham, A. H. Search for Related Content PubMed Articles by Bates, G. J. Articles by Banham, A. H. Related Articles Related Correspondence Social Bookmarking                            What's this?

In Reply

Nuffield Department of Clinical Laboratory Sciences, John Radcliffe Hospital, University of Oxford, Oxford, United Kingdom

Wolf et al¹ propose that real-time polymerase chain reaction (PCR) quantitation of forkhead box protein 3 (FOXP3) mRNA expression may represent a better prognostic marker in breast cancer than regulatory T cell (Treg) numbers defined by immunohistochemistry for FOXP3 protein.² While we agree with the authors that Tregs are clinically relevant in breast cancer patients, the claim that real-time PCR is less time consuming than immunohistochemistry is debatable and there are several further reasons why we do not feel that FOXP3 mRNA is an appropriate surrogate for the number of lymphocytes expressing FOXP3 protein. Firstly, for the two approaches to be comparable, there needs to be a good correlation between FOXP3 mRNA and protein expression levels. This is certainly not always the case, as illustrated by our detection of FOXP3 mRNA expression in the Jurkat T-cell line without FOXP3 protein expression. On generating a stable Jurkat-FOXP3 cell line, we observed little increase in the overall FOXP3 mRNA levels, although the cells expressed the FOXP3 protein, indicating that FOXP3 mRNA levels do not necessarily accurately reflect FOXP3 protein expression (Fig 1). More importantly, while we observed FOXP3 protein expression exclusively in infiltrating lymphocytes,^2,3 a recent article by Zuo et al⁴ reported the expression of both FOXP3 protein and mRNA in human breast epithelial cells. Their FOXP3 protein expression data, obtained using a polyclonal antibody, are contrary to our findings with the anti-FOXP3 236A/E7 monoclonal antibody^2,3 and studies are ongoing to investigate the reasons for this discrepancy. However, using real-time PCR this group have demonstrated FOXP3 mRNA expression in human and murine mammary epithelial cells.⁴ These data thus suggest that the quantification of FOXP3 mRNA levels is not a surrogate marker for Tregs within the breast tumor microenvironment. Moreover, as it is reported that normal breast tissue has high epithelial FOXP3 mRNA expression⁴ and low Treg numbers,² while tumors have reduced epithelial FOXP3 mRNA expression⁴ and increased Treg numbers² then it is possible that these factors may cancel out and obscure any clinical significance dependent on Treg-derived FOXP3 expression. This may also have contributed to the lack of clinical significance provided by this study of FOXP3 mRNA expression in breast cancer patients.¹

View larger version (42K): [in this window] [in a new window] [PowerPoint Slide for Teaching]   Fig 1. Jurkat cells were stably transfected with a pcDNA4His-Max forkhead box protein 3 (FOXP3) coding region containing plasmid and maintained under zeocin selection. Jurkat* refers to activation of the cells with PMA/ionomycin. The FOXP3 and GAPDH mRNA expression levels were determined using semi-quantitative (A) polymerase chain reaction or (B) quantitative polymerase chain reaction (SybrGreenER; Invitrogen, Paisley, Strathclyde, United Kingdom) with the following primers: FOXP3-GXP-pab01F, TCATCCGCTGGGCCATCCTG; FOXP3-GXP-pab01R, GTGGAAACCTCACTTCTTGGTC; GAPDH-GXP-pab02F, GACAACAGCCTCAAGATCATCA; GAPDH-GXP-pab02R, GTCCTTCCACGATACCAAAGTT. No template control (NTC). FOXP3 protein expression was determined by peroxidase immunohistochemistry using the DAKO Envision kit (Ely, Cambridgeshire, United Kingdom) and our (C) 236A/E7 monoclonal antibody.3

The author(s) indicated no potential conflicts of interest.

REFERENCES

1. Wolf AM, Rumpold H, Wolf D, et al: The role of FOXP3 in invasive breast cancer. J Clin Oncol doi:10.1200/JCO.2007.13.2092

2. Bates GJ, Fox SB, Han C, et al: Quantification of regulatory T cells enables the identification of high-risk breast cancer patients and those at risk of late relapse. J Clin Oncol 24:5373-5380, 2006[Abstract/Free Full Text]

3. Roncador G, Brown PJ, Maestre L, et al: Analysis of FOXP3 protein expression in human CD4+CD25+ regulatory T cells at the single-cell level. Eur J Immunol 35:1681-1691, 2005[CrossRef][Medline]

4. Zou T, Wang L, Morrison C, et al: FOXP3 is an X-linked breast cancer suppressor gene and an important repressor of the HER-2/ErbB2 oncogene. Cell Epub ahead of print, 2007

CiteULike    Complore    Connotea    Del.icio.us    Digg    Facebook    Reddit    Technorati    Twitter    What's this?

Related Correspondence

• Role of Forkhead Box Protein 3 Expression in Invasive Breast Cancer
  Anna M. Wolf, Holger Rumpold, Dominik Wolf, Guenther Gastl, Daniel Reimer, Nina Jenewein, Christian Marth, and Alain G. Zeimet
  JCO 2007 25: 4499-4500 [Full Text]

This article has been cited by other articles:

				B. C. Fox, P. A. Bignone, P. J. Brown, and A. H. Banham Defense of the clone: antibody 259D effectively labels human FOXP3 in a variety of applications Blood, April 1, 2008; 111(7): 3897 - 3899. [Full Text] [PDF]

This Article Full Text (PDF) Purchase Article View Shopping Cart Alert me when this article is cited Alert me if a correction is posted Services Email this article to a colleague Similar articles in this journal Alert me to new issues of the journal Save to my personal folders Download to citation manager Rights & Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Bates, G. J. Articles by Banham, A. H. Search for Related Content PubMed Articles by Bates, G. J. Articles by Banham, A. H. Related Articles Related Correspondence Social Bookmarking                            What's this?