Advertisement
Journal of Clinical Oncology  
Search for:
Limit by:
  Browse by Subject or Issue
Home Search or Browse JCO My JCO Subscriptions Customer Service Site Map

Journal of Clinical Oncology, Vol 26, No 2 (January 10), 2008: pp. 177-182
© 2008 American Society of Clinical Oncology.
DOI: 10.1200/JCO.2007.13.2043

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chan, H. L.-Y.
Right arrow Articles by Mok, T. S.-K.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Chan, H. L.-Y.
Right arrow Articles by Mok, T. S.-K.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

High Viral Load and Hepatitis B Virus Subgenotype Ce Are Associated With Increased Risk of Hepatocellular Carcinoma

Henry Lik-Yuen Chan, Chi-Hang Tse, Frankie Mo, Jane Koh, Vincent Wai-Sun Wong, Grace Lai-Hung Wong, Stephen Lam Chan, Winnie Yeo, Joseph Jao-Yiu Sung, Tony Shu-Kam Mok

From the Department of Medicine and Therapeutics, Institute of Digestive Disease; and the Department of Clinical Oncology, The Chinese University of Hong Kong, Shatin, Hong Kong

Corresponding author: Tony S.-K. Mok, MD, Department of Clinical Oncology, Sir YK Pao Center for Cancer, The Chinese University of Hong Kong, Prince of Wales Hospital, Shatin, Hong Kong; e-mail: tony{at}clo.cuhk.edu.hk or mok206551{at}cuhk.edu.hk


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 REFERENCES
 
Purpose We aimed to investigate the impact of hepatitis B virus (HBV) DNA and HBV genotypes/subgenotypes on the risk of hepatocellular carcinoma (HCC).

Patients and Methods A prospective cohort of patients infected with chronic HBV in a surveillance program for HCC since 1997 was studied. Ultrasound and alpha-fetoprotein evaluation were regularly performed to detect HCC. Risk factors for HCC and the relationship between HBV DNA and HBV genotypes were determined.

Results Among 1,006 patients with a median follow-up of 7.7 years, 86 patients (8.5%) developed HCC. With reference to the low HBV DNA stratum (log HBV DNA ≤ 4.5 copies/mL), the hazard ratio for HCC of the intermediate HBV DNA stratum (log HBV DNA > 4.5 to 6.5 copies/mL) was 1.62 (95% CI, 1.05 to 2.48; P = .027) and that of the high HBV DNA stratum (log HBV DNA > 6.5 copies/mL) was 2.73 (95% CI, 1.76 to 4.25; P < .001). Among patients with genotyping results, 330 patients had HBV genotype B and 439 patients had HBV genotype C (94 subgenotype Ce and 345 subgenotype Cs). With reference to HBV genotype B, HBV subgenotype Ce has the highest risk of HCC (hazard ratio = 2.75; 95% CI, 1.66 to 4.56; P < .0001) and HBV subgenotype Cs has intermediate risk (hazard ratio = 1.70; 95% CI, 1.09 to 2.64; P = .020). On multivariate analysis, HBV DNA, HBV genotypes, liver cirrhosis, male sex, older age, and lower serum albumin were independent risk factors of HCC.

Conclusion High HBV DNA level and HBV genotype C, particularly subgenotype Ce, increased the risk of HCC in chronic hepatitis B.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 REFERENCES
 
Chronic hepatitis B virus (HBV) infection is the most common cause of hepatocellular carcinoma (HCC) in Asia.1 To reduce the mortality related to HCC, regular surveillance with abdominal ultrasonography and alpha-fetoprotein evaluation is needed to detect early and operable HCC.2,3 With the huge demand of HCC surveillance in Asian countries, where the prevalence of HBV infection is high, risk stratification of patients is important to guide resource allocation.

Older age, male sex, and liver cirrhosis are well recognized factors associated with increased risk of HCC.4 Recent large-scale population-based studies have shown that patients with higher HBV DNA levels tend to have higher risk of HCC in the subsequent years of follow-up.5,6 In Asia, HBV genotype C infection is associated with a higher risk of HCC compared with HBV genotype B infection.7,8 A case control study in Taiwanese men suggested that HBV genotypes and HBV DNA might have independent effects on increasing the risk of HCC.9 Confirmatory data on the female sex is lacking.

Subgenotypes of HBV genotypes B (Ba and Bj) and C (Ce and Cs) have been identified on the basis of 4% to 8% heterogeneity of the entire HBV genome.10,11 These HBV subgenotypes may have different clinical and virologic characteristics.12,13 In a previous case controlled study including 172 patients from Japan and 156 patients from Hong Kong infected by HBV genotype C, HBV subgenotype Ce (v Cs) was found to be an independent risk factor of HCC in addition to male sex, older age, and positive hepatitis B e antigen (HBeAg) status.14 The study was limited by the potential confounding effect of patient ethnicity because majority (82%) of patients infected by HBV genotype Ce were recruited in Japan, whereas all patients infected by HBV subgenotype Cs were recruited in Hong Kong. Moreover, the status of liver cirrhosis, which may be the most important risk factor for HCC, was not evaluated. Therefore, we aimed to investigate the independent impact of HBV DNA and HBV genotypes/subgenotypes on the risk of HCC based on the follow-up of a large cohort of Chinese chronic hepatitis B patients in a HCC surveillance program.


    PATIENTS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 REFERENCES
 
Patients
This study was based on a prospective cohort of chronic hepatitis B patients recruited from the Hepatology Clinic, Prince of Wales Hospital (Shatin, Hong Kong) from October 1997 to November 2000.15 The study was approved by the Clinical Research Ethics Committee of the Chinese University of Hong Kong, and written informed consent was obtained from all patients before entry into the program. The Hepatology Clinic received referrals from community screening programs as well as family doctors and specialists, with a catchments area of approximately one sixth of the Hong Kong population.16 At the time of recruitment, all patients were age 40 to 70 with life expectancy of more than 2 years. Regular abdominal ultrasound examination was performed and serum alpha-fetoprotein levels monitored every 6 months in the initial 2 years, and patients underwent intensive surveillance with lipiodol computed tomography and/or liver biopsy if there was any suspicious abnormality on ultrasound or the alpha-fetoprotein level was greater than 20 µg/L.15 After the initial 2 years, patients were followed up every 6 months, or more frequently if clinically indicated, with monitoring of liver biochemistry as well as alpha-fetoprotein levels in the Hepatology Clinic. Ultrasound abdomen and other investigations including computed tomography, hepatic angiogram and/or liver biopsy would be performed whenever alpha-fetoprotein level was on a rising trend greater than 20 µg/L to confirm the diagnosis of HCC.8 For patients with normal alpha-fetoprotein levels, ultrasound abdomen was performed every 1 to 2 years.

Laboratory Tests
Residual serum samples were stored in a –80°C freezer. HBV DNA and genotyping were performed in the initial serum sample at patient enrollment. HBV DNA was extracted by QIAamp DNA Mini Kit (Qiagen Inc, Chatsworth, CA) according to manufacturer instructions.

HBV DNA
HBV DNA was quantified by TaqMan real-time polymerase chain reaction (PCR) assay as described previously (Applied Biosystems, Foster City, CA).17,18 This assay was standardized by serial dilution of EuroHEP (www.eurohep.net) genotype D HBV standard, which contained 2.7 x 109 viral copies/mL. The range of HBV DNA detection was 102 to 109 copies/mL with correlation coefficient of the standard curve routinely greater than 0.990.

HBV Genotyping
Five microliters of extracted HBV DNA was amplified by the PicoMaxx High Fidelity PCR (polymerase chain reaction) System (Stratagene, La Jolla, CA) using primers 5'TTTTTCACCTCTGCCTAATCA3' (sense 1821-1841) and 5'AAAAAGTTGCATGGTGCTGG3' (antisense 1825-1806). PCR amplification was conducted with initial denaturation at 94°C for 3 minutes, followed by 40 cycles of amplification (94°C for 1 minute, 60°C for 30 second and 72°C for 4 minutes) and final extension at 72°C for 7 minutes. PCR products were purified using ExoSAP-IT (USB, Cleveland, OH) following the manufacturer's protocol. The purified PCR products at the S gene were directly sequenced on ABI PRISM 3100 Genetic Analyzer using BigDye Terminator 3.1 cycle sequencing kit (Applied Biosystems). The HBV sequences were submitted to the comparative sequence program BLAST (www.ncbi.nlm.nih.gov/blast/) for searching other sequences with the highest degree of similarity to identify the genotype. The distance tree was calculated based on pairwise alignment on the BLAST server.

Statistical Analysis
Statistical analysis was performed by SAS version 8.2 (SAS Institute, Cary, NC). Continuous variables were expressed as mean with standard deviation or median with range as appropriate. Baseline continuous variables were compared by t test or Mann-Whitney U test as appropriate, and categoric variables were compared by {chi}2 test. Time to HCC diagnosis was defined as the date of recruitment from screening project to the date of HCC diagnosis or excluded at the date of last follow-up if patients were still alive without disease at the time of analysis. The database was frozen in August 2006. We used the Cox proportional hazards model to determine the relationship of HBV DNA, HBV genotypes and other clinical variables with the development of HCC. Stepwise multivariate analysis was performed to determine the independent risk factors associated with HCC among factors with P value less than .05 on univariate analysis. All statistical tests were two sided, and P values less than .05 were considered statistically significant.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 REFERENCES
 
Patients
One thousand six patients had residual serum samples for HBV DNA measurement. After a median follow-up of 4.3 years, we last reported 56 cases of HCC.15 Now, after a median follow-up of 7.7 (95% CI, 7.6 to 7.8) years, an additional of 30 patients (total 86 patients, 8.5%) developed HCC. The clinical characteristics of patients at baseline were shown in Table 1. Majority of patients had compensated liver disease with unremarkable serum bilirubin, serum albumin, and clotting profile. Eight hundred fifty-one patients (84.6%) had ALT levels below 1.5x the upper limit of normal (ULN), and the mean log HBV DNA was 4.72 ± 1.84 copies/mL. During the follow-up period, 144 patients (14.3%) have received nucleoside/nucleotide analogs, six (0.6%) have received interferon alfa, and two (0.2%) patients have received both modalities as antiviral treatment.


View this table:
[in this window]
[in a new window]

 
Table 1. Clinical Characteristics of Patients at Baseline.

 
HBV DNA and HCC
Higher HBV DNA was associated with increased risk of HCC. The hazard ratio of each log step increase in HBV DNA was 1.38 (95% CI, 1.23 to 1.55; P < .0001). On univariate analysis, older age, male sex, elevated ALT, low serum albumin, presence of ascites, ultrasonic features of liver cirrhosis, use of antiviral treatment and high HBV DNA were associated with increased risk of HCC (Table 1). When we divided the patients into three strata, 500 patients had low HBV DNA (log HBV DNA ≤ 4.5 copies/mL), 313 patients had intermediate HBV DNA (log HBV DNA > 4.5 to 6.5 copies/mL), and 193 patients had high HBV DNA (log HBV DNA > 6.5 copies/mL). During the follow-up period, 19 (3.8%), 36 (11.5%), and 31 (16.1%) patients developed HCC among patients in the low HBV DNA, intermediate HBV DNA, and high HBV DNA strata, respectively (Fig 1). With reference to the low HBV DNA stratum, the hazard ratio for HCC of the intermediate HBV DNA stratum was 1.62 (95% CI, 1.05 to 2.48; P = .027), and that of the high HBV DNA stratum was 2.73 (95% CI, 1.76 to 4.25; P < .001). On multivariate analysis, higher HBV DNA stratum remained an independent risk factor associated with HCC with a hazard ratio of 2.01 (95% CI, 1.49 to 2.71; Table 2). Presence of liver cirrhosis was the most important risk factor associated with HCC. Other independent factors of HCC included low serum albumin, older age, and male sex.


Figure 1
View larger version (16K):
[in this window]
[in a new window]
[PowerPoint Slide for Teaching]
 
Fig 1. Cumulative probability of hepatocellular carcinoma (HCC) among patients in the three hepatitis B virus (HBV) DNA strata.

 

View this table:
[in this window]
[in a new window]

 
Table 2. Multivariate Analysis of Factors Associated With Hepatocellular Carcinoma in All Patients and Patients With HBV Genotyping Results Available

 
HBV Genotypes and HCC
Seven hundred seventy (77%) patients had positive PCR for HBV genotyping. One patient had genotype A HBV, 330 patients (42%) had HBV genotype B (all belonged to subgenotype Ba), and 439 patients (57%) had HBV genotype C (94 subgenotype Ce and 345 subgenotype Cs). Only patients infected by genotypes B and C HBV were included in the subsequent analysis.

The clinical characteristics of 769 patients infected by genotype B and C HBV were shown in Table 3. Compared with patients infected by HBV genotype B, a larger proportion of patients infected by HBV genotype C were female; had elevated ALT levels, lower serum albumin, and ultrasonic features of liver cirrhosis; and received antiviral treatment. Patients infected by HBV genotype C also had higher HBV DNA levels than did those infected by HBV genotype B. Comparing patients infected by the two HBV subgenotypes C, patients infected by HBV subgenotype Ce were older, had lower albumin levels, and had a higher proportion of antiviral treatment (Table 3).


View this table:
[in this window]
[in a new window]

 
Table 3. Clinical Characteristics of 769 Patients Infected by Genotype B and C HBV

 
HBV genotype C was associated with a higher risk of HCC than HBV genotype B (hazard ratio = 3.83; 95% CI, 2.15 to 6.81; P < .0001). With referent to HBV genotype B, HBV subgenotype Ce has the highest risk of HCC (hazard ratio = 2.75; 95% CI, 1.66 to 4.56; P < .0001) and HBV subgenotype Cs has the intermediate risk (hazard ratio = 1.70; 95% CI, 1.09 to 2.64; P = .020; Fig 2). Patients infected by HBV subgenotype Ce also had significantly higher risk of developing HCC than did those infected by HBV subgenotype Cs (hazard ratio = 1.78; 95% CI, 1.06 to 3.02; P = .031).


Figure 2
View larger version (15K):
[in this window]
[in a new window]
[PowerPoint Slide for Teaching]
 
Fig 2. Cumulative probability of hepatocellular carcinoma (HCC) among patients infected by different hepatitis B virus genotypes/subgenotypes.

 
On multivariate analysis of the 769 patients with available genotyping results, HBV genotype and HBV DNA strata were independent risk factors for HCC (Table 2). Other risk factors of HCC remained liver cirrhosis, low serum albumin, older age, and male sex. Using HBV genotype B and low HBV DNA stratum as the reference, patients infected by HBV genotype Cs with intermediate and high HBV DNA strata had increased risk of HCC, and patients infected by HBV genotype Ce had the highest risk of HCC (Table 4). Among patients infected by HBV subgenotypes Cs and Ce, the risk of HCC was higher among those with high HBV DNA stratum than those with intermediate HBV DNA stratum.


View this table:
[in this window]
[in a new window]

 
Table 4. Relationship Between HBV Genotype and HBV DNA

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 REFERENCES
 
In this large longitudinal cohort of chronic hepatitis B patients followed up for more than 7 years, we have demonstrated that higher serum HBV DNA level at enrollment into the screening program was associated with increased risk of HCC, and this effect was independent of the presence of liver cirrhosis as well as other demographic characteristics. HBV genotype C, particularly subgenotype Ce, was associated with higher risk of HCC than was HBV genotype B. Patients who were infected by HBV genotype C with high HBV DNA (> 6.5 logs copies/mL) had the highest risk of developing HCC.

HBV DNA has become the most important clinical criterion for the decision of antiviral treatment in chronic hepatitis B. The latest US guidelines recommend for treatment HBV DNA greater than 6 log copies/mL in patients with chronic active hepatitis and even lower HBV DNA levels among patients with liver cirrhosis.4,19 Because the ultimate goal of treatment is to reduce HBV-related complications, including HCC, evidence on the association of higher HBV DNA and risk of HCC is important to support these guidelines. In line with the findings of previous large-scald population-based studies in Taiwan and Haimen, HBV DNA greater than 4 to 5 logs was associated with higher risks of HCC and mortality regardless of the ALT levels.5,6 Although HBV DNA may fluctuate with time, a single high HBV DNA can already predict a higher future risk of HCC. Patients who have persistently high HBV DNA are expected to have the highest cancer risk.5 Our study population was composed of higher-risk patients followed up in a hospital clinic. One of the major strengths of our study was the availability of more detailed assessment of the liver function and the cirrhotic status at patient entry. In fact, ultrasonic evidence of liver cirrhosis stood out as the most important risk factor of HCC in our patient cohort. Although ultrasound might have bias to diagnose liver cirrhosis compared with liver biopsy, it tends to underestimate rather than overestimate.20 Low serum albumin, which reflected more advanced liver cirrhosis, was also found to be an independent risk factor of HCC. Previously, we have also shown that low serum albumin is an important predictor of mortality among patients with HBV-related liver cirrhosis.21 Therefore, our study has provided supporting evidence that higher HBV DNA is an independent risk factor of HCC in addition to liver cirrhosis.

In our cohort, only 15.6% of patients had ALT levels higher than 1.5x ULN. Although higher ALT was associated with HCC on univariate analysis, the proportion of patients who had ALT greater than 1.5x ULN and subsequently developed HCC was only 25.6%. This finding concurs with previous observations that high ALT level is not a prerequisite for liver-related complications, including HCC.5 In chronic hepatitis B, low ALT levels cannot be equated to mild liver histology. In 652 patients recruited in a therapeutic trial with ALT less than 2x the upper limit of laboratory normal, approximately 70% of patients had significant histologic necroinflammation, and 15% of patients had severe liver fibrosis.22 In the REVEAL study cohort, patients with normal ALT levels still have significant high risks of developing liver cirrhosis if the HBV DNA was high.20 We believe that ALT assessment is not important in the risk estimation of HCC as far as the level of HBV DNA and the presence of liver cirrhosis have been taken into consideration. On the other hand, it becomes important to determine the presence of liver cirrhosis among patients who have high HBV DNA but low ALT levels.4

There is increasing evidence that HBV genotype C is associated with higher risk of HCC than is HBV genotype B.7-9 This is probably related to the more aggressive disease activity and delayed HBeAg seroconversion among patients infected by HBV genotype C.23-25 In line with the results of a previously conducted case control study, our longitudinal follow-up data also suggested that HBV subgenotype Ce was associated with a higher risk of HCC than was HBV subgenotype Cs.14 In fact, HBV genotype/subgenotype, HBV DNA and liver cirrhosis have independent impacts on the risk of development of HCC.9 The higher proportion of patients infected by HBV subgenotype Ce on antiviral treatment during the follow-up period in our study supported more active liver disease among these patients. Basal core promoter mutations have been suggested to associate with hepatocarcinogenesis, but they are less often found in HBV subgenotype Ce than HBV subgenotype Cs.11,26 On the other hand, T1653 mutation located at the alpha box, which is more associated with HBV subgenotype Ce, has been reported to increase the risk of HCC among Japanese patients.14,27

One limitation of our study is the lack of data on HBeAg status. In a population-based study in Taiwan, a single positive HBeAg was associated with dramatic increased risk of HCC in the subsequent 12 years of follow-up.28 This observation could be explained by the higher HBV DNA levels among patients with positive HBeAg. In this study, there was no information on the change of HBeAg status during the follow-up. In fact, HCC is less common among patients who have sustained HBeAg seroconversion.29 On the other hand, some patients may have fluctuating HBeAg status or active liver disease after HBeAg seroconversion as a result of persistent viremia, and these patients have increased risk of liver cirrhosis and HCC.30,31 Therefore, HBV DNA is probably a more important marker for HCC risk stratification than is the HBeAg status.

In conclusion, we have shown that viral factors have a important impact on the risk of HCC development compared with other factors. Higher serum HBV DNA and HBV subgenotype Ce are associated with higher risk of HCC in a follow-up of more than 7 years. HBV DNA higher than 4.5 log copies/mL starts to have increased risk of HCC and HBV DNA higher than 6.5 logs has a further incremental risk of HCC. Patients with HBV subgenotype Ce and/or high HBV DNA stratum should undergo vigorous HCC surveillance to detect early, potentially resectable HCC, particularly if other clinical factors including older age, male sex, and liver cirrhosis are also present. In the current treatment guidelines, antiviral treatments should be started among cirrhotic patients despite lower HBV DNA levels.4,19 Future studies focusing on the need to lower the threshold of commencing antiviral treatment based on HBV subgenotype are warranted.


    Authors' Disclosures of Potential Conflicts of Interest
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 REFERENCES
 
The author(s) indicated no potential conflicts of interest.


    Author Contributions
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 REFERENCES
 
Conception and design: Henry Lik-Yuen Chan, Chi-Hang Tse, Frankie Mo, Tony S.-K. Mok

Financial support: Joseph Jao-Yiu Sung

Administrative support: Jane Koh, Tony S.-K. Mok

Provision of study materials or patients: Henry Lik-Yuen Chan, Vincent Wai-Sun Wong, Grace Lai-Hung Wong, Stephen Lam Chan

Collection and assembly of data: Henry Lik-Yuen Chan, Chi-Hang Tse, Jane Koh, Vincent Wai-Sun Wong, Grace Lai-Hung Wong, Stephen Lam Chan, Winnie Yeo

Data analysis and interpretation: Henry Lik-Yuen Chan, Chi-Hang Tse, Frankie Mo, Winnie Yeo, Joseph Jao-Yiu Sung, Tony S.-K. Mok

Manuscript writing: Henry Lik-Yuen Chan, Chi-Hang Tse, Frankie Mo, Tony S.-K. Mok

Final approval of manuscript: Henry Lik-Yuen Chan, Chi-Hang Tse, Frankie Mo, Joseph Jao-Yiu Sung, Tony S.-K. Mok


    NOTES
 
Supported by Michael Kadoorie Cancer Genetics Research Programme and Research Fund for the Control of Infectious Diseases (RFCID; application number 06060122; H.L.-Y.C); and Hong Kong Cancer Fund.

Authors' disclosures of potential conflicts of interest and author contributions are found at the end of this article.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 Authors' Disclosures of...
 Author Contributions
 REFERENCES
 
1. Chan HLY, Sung JJY: Hepatocellular carcinoma and hepatitis B virus. Semin Liver Dis 26:153-161, 2006[CrossRef][Medline]

2. McMahon BJ, Bulkow L, Harspter A, et al: Screening for hepatocellular carcinoma in Alaska Natives infected with chronic hepatitis B: A 16-year population-based study. Hepatology 32:842-846, 2000[CrossRef][Medline]

3. Wong GLH, Ip KI, Kwan LW, et al: Screening program for hepatocellular carcinoma can improve survival in patients with chronic viral hepatitis. Hepatology 44:496A, 2006 (supp 1; abstr 827)

4. Lok ASF, McMahon BJ: Chronic hepatitis B. Hepatology 45:507-539, 2007[CrossRef][Medline]

5. Chen CJ, Yang HI, Su J, et al: Risk of hepatocellular carcinoma across a biological gradient of serum hepatitis B virus DNA level. JAMA 295:65-73, 2006[Abstract/Free Full Text]

6. Chen G, Lin W, Shen F, et al: Past HBV viral load as predictor of mortality and morbidity from HCC and chronic liver disease in a prospective study. Am J Gastroenterol 101:1797-1803, 2006[CrossRef][Medline]

7. Kao JH, Chen PJ, Lai MY, et al: Basal core promoter mutations of hepatitis B virus increase the risk of hepatocellular carcinoma in hepatitis B carriers. Gastroenterology 124:327-334, 2003[CrossRef][Medline]

8. Chan HLY, Hui AY, Wong ML, et al: Genotype C hepatitis B virus infection is associated with increased risk of hepatocellular carcinoma. Gut 53:1494-1498, 2004[Abstract/Free Full Text]

9. Yu MW, Yeh SH, Chan PJ, et al: Hepatitis B virus genotype and DNA level and hepatocellular carcinoma: A prospective study in men. J Natl Cancer Inst 97:265-272, 2005[Abstract/Free Full Text]

10. Sugauchi F, Orito E, Ichida T, et al: Hepatitis B virus of genotype B with or without recombination with genotype C over the precore region plus the core gene. J Virol 76:5985-5992, 2002[Abstract/Free Full Text]

11. Chan HLY, Tsui SKW, Tse CH, et al: Epidemiological and virological characteristics of two subgroups of genotype C hepatitis C virus. J Infect Dis 191:2022-2032, 2005[CrossRef][Medline]

12. Sugauchi F, Orito E, Ichida T, et al: Epidemiologic and virologic characteristics of hepatitis B virus genotype B having the recombination with genotype C. Gastroenterology 124:925-932, 2003[CrossRef][Medline]

13. Chan HLY, Tse CH, Ng EYT, et al: Phylogenetic, virological and clinical characteristics of genotype C hepatitis B virus with TCC at codon 15 of the precore region. J Clin Microbiol 44:681-687, 2006[Abstract/Free Full Text]

14. Tanaka Y, Mukaide M, Orito E, et al: Specific mutations in enhancer II/core promoter of hepatitis B virus subgenotypes C1/2 increase the risk of hepatocellular carcinoma. J Hepatol 45:646-653, 2006[CrossRef][Medline]

15. Mok TSK, Yeo W, Yu S, et al: An intensive surveillance program detected a high incidence of hepatocellular carcinoma amongst hepatitis B virus carriers with abnormal alpha-fetoprotein or abdominal ultrasonography. J Clin Oncol 23:8041-8047, 2005[Abstract/Free Full Text]

16. Chan HLY, Hui Y, Leung NWY, et al: Risk factors for active liver disease in HBeAg-negative chronic hepatitis B virus (HBV) infected patients. Am J Gastroenterol 95:3547-3551, 2000[Medline]

17. Loeb KR, Jerome KR, Goddard J, et al: High-throughput quantitative analysis of hepatitis B virus DNA in serum using the TaqMan fluorogenic detection system. Hepatology 32:626-629, 2000[CrossRef][Medline]

18. Chan HLY, Chui AKK, Lau WY, et al: Factors associated with viral breakthrough in lamivudine monoprophylaxis of hepatitis B virus recurrence after liver transplantation. J Med Virol 68:182-187, 2002[CrossRef][Medline]

19. Keeffe EB, Dieterich DT, Han SH, et al: A treatment of algorithm for the management of chronic hepatitis B virus infection in the United States: An update. Clin Gastroenterol Hepatol 4:936-962, 2006[CrossRef][Medline]

20. Iloeje UH, Yang HI, Su J, et al: Predicting cirrhosis risk based on the level of circulating hepatitis viral load. Gastroenterology 130:678-686, 2006[CrossRef][Medline]

21. Hui AY, Chan HLY, Leung NWY, et al: Survival and prognostic indicators in patients with hepatitis B virus-related cirrhosis after onset of hepatic decompensation. J Clin Gastroenterol 34:569-572, 2002[CrossRef][Medline]

22. Terrault N, Kin R, Schalm S, et al: Presence of biopsy-proven histologic damage (necroinflammation and fibrosis) is common even when ALT is less than 2 x ULN in patients with chronic hepatitis B (CHB). J Hepatol 46:S184 (supp 1; abstr 483)

23. Chu CJ, Hussain M, Lok ASF: Hepatitis B virus genotype B is associated with earlier HBeAg seroconversion compared with hepatitis B virus genotype C. Gastroenterology 122:1756-1762, 2002[CrossRef][Medline]

24. Chan HLY, Tsang SWC, Liew CT, et al: Viral genotype and hepatitis B virus DNA levels are correlated with histological liver damage in HBeAg-negative chronic hepatitis B virus infection. Am J Gastroenterol 97:406-412, 2002[CrossRef][Medline]

25. Chan HLY, Wong ML, Hui AY, et al: Genotype C hepatitis B virus takes a more aggressive disease course before hepatitis B e antigen seroconversion as compared to genotype B hepatitis B virus. J Clin Microbiol 41:1277-1279, 2003[Abstract/Free Full Text]

26. Kuang SY, Jackson PE, Wang JB, et al: Specific mutations of hepatitis B virus in plasma predict liver cancer development. Proc Natl Acad Sci U S A 101:3575-3580, 2004[Abstract/Free Full Text]

27. Ito K, Tanaka Y, Orito E, et al: T1653 mutation in the box alpha increases the risk of hepatocellular carcinoma in patients with chronic hepatitis B virus genotype C infection. Clin Infect Dis 42:1-7, 2006[CrossRef][Medline]

28. Yang HI, Lu SN, Liaw YF, et al: Hepatitis B e antigen and the risk of hepatocellular carcinoma. N Engl J Med 347:168-174, 2002[Abstract/Free Full Text]

29. Hsu YS, Chien RN, Yeh CT, et al: Long-term outcome after spontaneous HBeAg seroconversion in patients with chronic hepatitis B. Hepatology 35:1522-1527, 2002[CrossRef][Medline]

30. Di Marco V, Iacono OL, Camma C, et al: The long-term course of chronic hepatitis B. Hepatology 30:257-264, 1999[CrossRef][Medline]

31. McMahon BJ, Holck P, Bulkow L, et al: Serologic and clinical outcome of 1536 Alaska natives chronically infected with hepatitis B virus. Ann Intern Med 135:759-768, 2001[Abstract/Free Full Text]

Submitted July 9, 2007; accepted October 5, 2007.


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Facebook Facebook   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
J Antimicrob ChemotherHome page
K. Lacombe, J. Bottero, M. Lemoine, A. Boyd, and P. M. Girard
HIV/hepatitis B virus co-infection: current challenges and new strategies
J. Antimicrob. Chemother., November 8, 2009; (2009) dkp414v1.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
S. Liu, H. Zhang, C. Gu, J. Yin, Y. He, J. Xie, and G. Cao
Associations Between Hepatitis B Virus Mutations and the Risk of Hepatocellular Carcinoma: A Meta-Analysis
J Natl Cancer Inst, August 5, 2009; 101(15): 1066 - 1082.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
J. Luan, J. Yuan, X. Li, S. Jin, L. Yu, M. Liao, H. Zhang, C. Xu, Q. He, B. Wen, et al.
Multiplex Detection of 60 Hepatitis B Virus Variants by MALDI-TOF Mass Spectrometry
Clin. Chem., August 1, 2009; 55(8): 1503 - 1509.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
H. L.-Y. Chan, V. W.-S. Wong, G. L.-H. Wong, A. M.-L. Chim, L. H. Lai, and J. J.-Y. Sung
Evaluation of Impact of Serial Hepatitis B Virus DNA Levels on Development of Hepatocellular Carcinoma
J. Clin. Microbiol., June 1, 2009; 47(6): 1830 - 1836.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
S. F. Altekruse, K. A. McGlynn, and M. E. Reichman
Hepatocellular Carcinoma Incidence, Mortality, and Survival Trends in the United States From 1975 to 2005
J. Clin. Oncol., March 20, 2009; 27(9): 1485 - 1491.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
G L-H Wong, V W-S Wong, P C-L Choi, A W-H Chan, A M-L Chim, K K-L Yiu, H-Y Chan, F K-L Chan, J J-Y Sung, and H L-Y Chan
Metabolic syndrome increases the risk of liver cirrhosis in chronic hepatitis B
Gut, January 1, 2009; 58(1): 111 - 117.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
J. M. Llovet and A. Lok
Hepatitis B Virus Genotype and Mutants: Risk Factors for Hepatocellular Carcinoma
J Natl Cancer Inst, August 20, 2008; 100(16): 1121 - 1123.
[Full Text] [PDF]


Home page
J. Virol.Home page
J. J. Y. Sung, S. K. W. Tsui, C.-H. Tse, E. Y. T. Ng, K.-S. Leung, K.-H. Lee, T. S. K. Mok, A. Bartholomeusz, T. C. C. Au, K. K. F. Tsoi, et al.
Genotype-Specific Genomic Markers Associated with Primary Hepatomas, Based on Complete Genomic Sequencing of Hepatitis B Virus
J. Virol., April 1, 2008; 82(7): 3604 - 3611.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
M. B. Thomas, M. Davila, and J. L. Abbruzzese
Stemming the Tide of Hepatitis B Virus-Related Hepatocellular Carcinoma?
J. Clin. Oncol., January 10, 2008; 26(2): 172 - 174.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chan, H. L.-Y.
Right arrow Articles by Mok, T. S.-K.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Chan, H. L.-Y.
Right arrow Articles by Mok, T. S.-K.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

About
JCO
 Editorial
Roster
 Advertising
Information
 Librarians &
Institutions
 Rights &
Permissions
 PDA Services

Copyright © 2008 by the American Society of Clinical Oncology, Online ISSN: 1527-7755. Print ISSN: 0732-183X
Terms and Conditions of Use
  HighWire Press HighWire Press™ assists in the publication of JCO Online