Advertisement
Journal of Clinical Oncology  
Search for:
Limit by:
  Browse by Subject or Issue
Home Search or Browse JCO My JCO Subscriptions Customer Service Site Map

Journal of Clinical Oncology, Vol 26, No 20 (July 10), 2008: pp. 3418-3425
© 2008 American Society of Clinical Oncology.
DOI: 10.1200/JCO.2007.14.3420

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schilder, R. J.
Right arrow Articles by Vanderhyden, B. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schilder, R. J.
Right arrow Articles by Vanderhyden, B. C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Phase II Evaluation of Imatinib Mesylate in the Treatment of Recurrent or Persistent Epithelial Ovarian or Primary Peritoneal Carcinoma: A Gynecologic Oncology Group Study

Russell J. Schilder, Michael W. Sill, Roger B. Lee, Tanya J. Shaw, Mary K. Senterman, Andres J. Klein-Szanto, Zoe Miner, Barbara C. Vanderhyden

From the Fox Chase Cancer Center, Philadelphia, PA; Gynecologic Oncology Group Statistical and Data Center; University at Buffalo, Buffalo, NY; Tacoma General Hospital, Tacoma, WA; University of Ottawa, Ottawa, Ontario, Canada; Centre for Cancer Therapeutics, Ottawa Health Research Institute, Ottawa, Ontario, Canada

Corresponding author: Russell J. Schilder, MD, Department of Medical Oncology, Fox Chase Cancer Center, 333 Cottman Ave, Philadelphia, PA 19111; e-mail: russell.schilder{at}fccc.edu


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 AUTHORS' DISCLOSURES OF...
 AUTHOR CONTRIBUTIONS
 Appendix
 REFERENCES
 
Purpose This phase II trial assessed the activity and tolerability of an oral dose of imatinib mesylate 400 mg twice daily in patients with recurrent or persistent epithelial ovarian or primary peritoneal carcinoma. The association between the expression of certain markers and clinical outcome was investigated.

Patients and Methods Primary measure of clinical efficacy was progression-free survival (PFS) at 6 months. Mutational analysis of KIT, immunohistochemistry (IHC) and enzyme-linked immunosorbent assay for markers (KIT, platelet-derived growth factor [PDGF] receptor [-R], AKT2, phosphorylated AKT [p-AKT], stem cell factor [SCF], and PDGF) were performed.

Results Fifty-six eligible patients were evaluated. Nine patients were progression free for at least 6 months including one complete responder. The median PFS and survival were 2 and 16 months, respectively. The most common grade 3 and 4 toxicities were neutropenia, GI, dermatologic effects, pain, and electrolyte disturbances. At least one target of imatinib (KIT, PDGFR-{alpha}, or PDGFR-β) was expressed in all tumors, and most tumors expressed all three receptors. Higher expression of p-AKT and PDGFR-β were associated with shorter PFS, and higher IHC scores (% immunopositive cells x staining intensity) of SCF and p-AKT were associated with decreased overall survival. No sequence mutations were detected in the KIT gene. Higher pretreatment plasma concentrations of PDGF-AB, PDGF-BB, and vascular endothelial growth factor (VEGF) were individually associated with shorter PFS and survival.

Conclusion Imatinib mesylate was well tolerated but had minimal single-agent activity in patients with recurrent ovarian or primary peritoneal carcinoma. No marker was identified that would predict activity of imatinib; however, tumor p-AKT and plasma VEGF levels were associated with poor outcome.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 AUTHORS' DISCLOSURES OF...
 AUTHOR CONTRIBUTIONS
 Appendix
 REFERENCES
 
Epithelial ovarian cancer is the fourth leading cause of cancer-related death among women in the United States, with an estimated 22,430 new cases and 15,280 deaths in 2007.1 The long-term survival rate remains approximately 15% to 25% despite improvement in the 5-year survival for patients with stage III disease.2 Most patients are destined to develop recurrent disease, and responses to subsequent treatments are often of short duration. As such, the development of new therapies remains a critical need.

Abnormal expression of KIT has been implicated in the pathogenesis of several cancers,3-12 including myeloid leukemia3,4 and epithelial ovarian tumors.9-12 KIT activation can be achieved by stimulation by its ligand, stem cell factor (SCF),9 or by mutations. Such mutations have been identified as the primary contributing factor to GI stromal tumor formation13 and affect response to treatment,14 but have not been found in ovarian tumors.15,16

Platelet-derived growth factor (PDGF) is a potent mitogen17 expressed in 73% of epithelial ovarian cancers, 50% of which coexpress PDGF receptor (PDGFR)-{alpha},18 enabling autocrine stimulation.19 Ovarian cancers have a six-fold increase in PDGFR-{alpha} expression compared with normal ovarian epithelial cells,20 which is associated with shorter survival.18

Imatinib mesylate is a receptor tyrosine inhibitor with potent activity against Abl, PDGFR, and KIT.21-23 Imatinib impairs KIT and PDGFR phosphorylation, resulting in inhibition of AKT phosphorylation and suppression of the growth and survival of ovarian cancer cells.24,25 On the basis of these observations, the Gynecologic Oncology Group (GOG) launched a phase II trial evaluating imatinib in recurrent epithelial ovarian or primary peritoneal carcinoma. Expression levels of KIT, PDGFR, SCF, PDGF, AKT2, and phosphorylated AKT (p-AKT), and mutational analysis of KIT were evaluated against clinical outcomes.


    PATIENTS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 AUTHORS' DISCLOSURES OF...
 AUTHOR CONTRIBUTIONS
 Appendix
 REFERENCES
 
Patients and Treatment
Eligibility. Eligible patients had a diagnosis of epithelial ovarian or primary peritoneal carcinoma that was histologically confirmed by members of the GOG Pathology Committee. Tumors were not screened for KIT or PDGFR expression before enrollment. Patients were required to have measurable disease as defined by Response Evaluation Criteria in Solid Tumors (RECIST),26 a GOG performance status of 0 to 2, adequate bone marrow (absolute neutrophil count ≥ 1,500/µL, platelet count ≥ 100,000/µL), renal (serum creatinine ≤ 1.5x the upper limit of normal), and hepatic function (total bilirubin ≤ 1.5x the upper limit of normal, and transaminases and alkaline phosphatase ≤ 2x the upper limit of normal). Eligible patients were permitted to have up to two prior cytotoxic regimens and were required to have a platinum-free interval of less than 12 months. Patients with prior imatinib exposure, prior radiation to more than 25% of marrow bearing areas, therapeutic warfarin treatment, or signs or symptoms of bowel obstruction were excluded.

Patients provided written informed consent consistent with federal, state, and local institutional requirements. The protocol was also approved by the institutional review board at each participating GOG institution and performed in accordance with assurances filed with and approved by the Department of Health and Human Services.

Treatment plan and dose modifications. The initial dose of imatinib mesylate (Novartis, Basel, Switzerland) was a fixed dose of 400 mg orally twice daily until progressive disease or adverse effects prohibited further therapy with this agent. A cycle equaled 28 days. Imatinib was supplied by the Cancer Treatment Evaluation Program of the National Cancer Institute.

Toxicity was graded using the National Cancer Institute Common Toxicity Criteria version 2.0. Patients who experienced grade 2 or worse neutropenia or thrombocytopenia had their dose reduced one dose level to 600 mg daily. If the same toxicity recurred, then the next lower dose level was 400 mg daily, with no further reductions permitted. Patients who experienced grade 4 neutropenia or thrombocytopenia had their daily dose held until counts recovered to at least grade 3. Study medication was then restarted at one dose level lower in the case of grade 4 neutropenia or at two levels lower for neutropenic fever or grade 4 thrombocytopenia. Study drug was resumed once platelet counts recovered to grade 3. In these latter circumstances, the dose could be increased by one dose level once counts were less than grade 2. Asymptomatic grade 4 neutropenia lasting less than 7 days did not require a dose modification. Delay in count recovery lasting more than 14 days required the patient to be removed from the trial. Prophylactic use of myeloid growth factors was not permitted. Use of erythroid growth factors was permitted after the hemoglobin dropped below 10 g/dL. Patients who experienced grade 2 or worse nonhematologic toxicity had therapy held until resolution to grade 1 or better. The imatinib was then restarted at 600 mg daily. If nonhematologic toxicity grade 2 or worse recurred, the dose was decreased to 400 mg daily. There were no further dose reductions below 400 mg daily. Patients who required further dose reductions were taken off study. Once a patient's dose was reduced for nonhematologic toxicity, it was not subsequently increased. Treatment delays of more than 14 days for nonhematologic toxicities also required removal from protocol treatment.

Response assessment. Patients were evaluated clinically every 4 weeks and radiologically every 8 weeks. The same evaluation modality was used throughout for each patient on study. Response criteria used were as defined by RECIST.26

Translational Methodologies
Tumor specimens. Archived paraffin-embedded tissue was obtained from primary tumors to examine immunohistochemical (IHC) expression of KIT and PDGFR and their ligands, AKT and p-AKT, and mutational status of KIT. Plasma was frozen until determination of levels of PDGF-AB, PDGF-BB, SCF, and vascular endothelial growth factor (VEGF).

Immunohistochemistry. IHC was performed on 5-µm sections using standard methodologies and primary antibodies from DAKO (KIT; Glostrup, Denmark), Santa Cruz Biotechnology (PDGFR-{alpha}, PDGFR-β, PDGF-A, PDGF-B, AKT2; Santa Cruz, CA), Assay Designs Inc (SCF; Ann Arbor, MI) and Cell Signaling Technology (p-AKT; Beverly, MA). Sections were incubated for up to 24 hours with primary antibodies and exposed to DAKO Envision System peroxidase-labeled secondary antibody. Positive controls were tissues with established expression of the specific protein. Sections were scored for staining intensity (SI) and percentage of tumor cells with specific staining (PCP) by three individuals blinded to specimen identity. Staining intensity was scored on a 5-point scale: 1 = negative, 2 = light (mild), 3 = moderate, 4 = dark staining equal to the intensity in positive control tissue, 5 = staining intensity greater than positive control tissue. IHC scores (SC) were calculated by multiplying the percentage of positive cells by the intensity of staining [IHC score = PCP x SI].

Mutational analyses. Genomic DNA was extracted from tissue sections, some using laser capture microscopy, and subjected to polymerase chain reaction amplification using primer sets designed to detect the presence of the most common activating mutations reported for KIT (exon 11),27 for mutations in sites that could affect receptor signaling such as the SHP-1 or p85/PI-3-kinase binding sites (exon 14), and for mutations known to impair the ability of imatinib to inactivate KIT (exon 17).28 Primers and conditions are described in the Appendix (online only).

Enzyme-linked immunosorbent assay determination of plasma levels of PDGF-AB, PDGF-BB, SCF, and VEGF. Concentrations of these proteins were determined in plasma collected before treatment began, just before starting cycle 2 of imatinib therapy, and just before starting cycle 3 or at the time the patient was removed from treatment due to disease progression or toxicity. Samples were analyzed in duplicate at two dilutions using enzyme-linked immunosorbent assay (ELISA) kits (R&D Systems, Minneapolis, MN).

Statistical Methods
The primary end point to evaluate treatment efficacy was progression-free survival (PFS) at 6 months. The time at risk was measured from the date of entry. Patients who survived progression free for at least 6 months were classified as positive outcomes. All others were considered treatment failures.

The clinical trial utilized a two-stage optimal and flexible group sequential design based on the patient's PFS status at 6 months as the primary end point.29 The specific decision rules and operating characteristics of the design can be found in the statistical methods of Schilder et al.30 Briefly, 22 to 29 patients were to be entered and evaluated during the first stage of accrual. If more than three of the 22 to 24 patients or four of 25 to 29 patients survived progression free for 6 months or longer, then a cumulative 53 to 60 patients would be accrued in total. The treatment would be considered worthy of further investigation if more than 10 of 53, 11 of 54 to 57, or 12 of 58 to 60 patients survived progression free for 6 months or more. Because five of 26 patients were observed with a PFS of 6 months or longer after the first stage of accrual, the trial proceeded to the second stage. If the true probability of being alive and progression free after 6 months is 15%, these decision rules limit the average probability of designating the treatment as active to 10%, and the average probability of stopping after completing only the first stage of accrual is 59%. If the true probability of this type of response is 30%, then the average probability of correctly classifying the treatment as active is 90%. Secondary clinical objectives included the characterization of the distribution of PFS and overall survival such as quartile estimates and Kaplan-Meier plots. Objective response rate (partial and complete) was also calculated.

To search for potential relationships between biomarkers and PFS or survival, automated model building procedures were used such as the best subset selection algorithms in SAS (SAS Institute, Cary, NC), using the Cox proportional hazards model. Residual analyses and model assumptions were conducted and checked. Observations with undue influence were removed from final descriptive models. To visually assess the impact of a biomarker on the hazard of progression or death, deviance residual31 plots are provided for some of the biomarkers evaluated.

The ELISA data were heavily skewed, so log transformations were taken where appropriate. Changes in concentrations of biomarkers over time were assessed with paired t tests and signed rank tests. Potential associations between IHC biomarker data were examined with Kendall's {tau}-b statistic.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 AUTHORS' DISCLOSURES OF...
 AUTHOR CONTRIBUTIONS
 Appendix
 REFERENCES
 
Patients and Eligibility
Sixty patients were enrolled onto the trial. Four patients were not eligible (n = 1 second primary; n = 2 wrong cell type; n = 1 no histologic diagnosis at entry). Patient characteristics are listed in Table 1. Fifty-five patients had a GOG performance status of 0 or 1. Forty-six patients had ovarian cancer, with 10 patients having primary peritoneal carcinoma. Thirty-seven patients were considered to have platinum-resistant disease (platinum-free interval < 6 months), whereas 19 patients were considered to have platinum-sensitive disease (platinum-free interval of ≥ 6 months).


View this table:
[in this window]
[in a new window]

 
Table 1. Clinical Characteristics

 
Treatment Response
Patients received a median of two cycles (range; one to 13) of protocol therapy. Nine patients were progression free for at least 6 months, including one complete responder (Table 2). Of these nine patients, two had one prior treatment regimen, and seven had two prior treatment regimens. Five of the nine patients with more than 6 months of PFS had platinum-resistant disease, and four patients had platinum-sensitive cancers. Neither the number of prior regimens nor the platinum sensitivity predicted for outcome. The median PFS for the whole group was 1.74 months (first quartile, 1.10; third quartile, 2.66; Fig A1, online only). The complete responder had a PFS of 8.05 months and a duration of response of 6.34 months. The median overall survival was 16.39 months (first quartile 6.24; third quartile 23.52).


View this table:
[in this window]
[in a new window]

 
Table 2. Outcome Statistics

 
Toxicity
The most commonly observed grade 3/4 toxicities in the 56 eligible patients were neutropenia, GI, dermatologic effects, pain, and electrolyte disturbances (Table 3). Grade 3 GI toxicity was primarily nausea and emesis. Major electrolyte imbalances included two cases each of hyponatremia and hypophosphatemia.


View this table:
[in this window]
[in a new window]

 
Table 3. Toxicity (grade ≥ 3, n = 56)

 
Immunohistochemistry
Using archival tumor from 44 patients, IHC expression of KIT, PDGFR-{alpha}, PDGFR-β, SCF, PDGF-A, PDGF-B, AKT2, and p-AKT was detected in the majority of cases, with the percentage of tumor cells staining positive for each protein being generally greater than 85% (Table 4). At least one target of imatinib (KIT, PDGFR-{alpha}, PDGFR-β) was expressed in the tumors of all patients, and the majority of tumors expressed all three. Receptor and ligand expression were largely restricted to epithelial components (Appendix Fig A2, online only), whereas AKT2 was expressed in both epithelial and stromal cells (Appendix Fig A3, online only). Patients with tumors having a higher PCP for AKT2 had longer PFS, but there were no associations between the PCP for any protein and overall survival (Table 5), and no impact of the PCP for KIT, PDGFR-{alpha}, PDGFR-β, or p-AKT on the probability of having a complete response or stable disease.


View this table:
[in this window]
[in a new window]

 
Table 4. Immunohistochemical Detection of the Expression of Target Receptors and Their Ligands, AKT2, and p-AKT

 

View this table:
[in this window]
[in a new window]

 
Table 5. IHC Biomarkers Indicated to Have an Association With the Hazard of Progression or Death Using the Cox Proportional Hazards Model

 
More than 80% of samples expressed at least low levels of all the proteins evaluated (SI > 1); the proportion of samples showing SI more than 2 ranged from 36.6% for PDGF-B to 87.5% for AKT2 (Table 4). Higher SI for PDGFR-β and p-AKT was each associated with shorter PFS, whereas higher SI for AKT2 was associated with longer PFS (Fig 1A and B). More intense staining for SCF and PDGF-B was associated with shorter and longer survival, respectively.


Figure 1
View larger version (12K):
[in this window]
[in a new window]
[PowerPoint Slide for Teaching]
 
Fig 1. Plots of deviance residuals against immunohistochemistry (IHC) scores for (A) AKT2 staining intensity, (B) phosphorylated (p-) AKT staining intensity, (C) SCF IHC score, and (D) p-AKT IHC score. Residual plot for A indicates that the hazard of progression or death decreases as the staining intensity for AKT2 increases whereas in B, the hazard increases as the staining intensity increases for p-AKT. Two cases were excluded from plots in A and B. Residual plots for C and D indicate increasing hazards for death as the respective IHC scores increased. No eligible or assessable cases were excluded from these plots.

 
There was no association between IHC score (percentage of immunopositive cells x intensity) for any protein and PFS, or between the expression levels of the three target receptors in any combination and patient response. Higher IHC scores for SCF and p-AKT were associated with shorter survival (Table 5; Fig 1C-1D). There was good correlation of expression among the target receptors, as well as correlated expression of KIT and PDGFR-β with their respective ligands (Appendix Table A1, online only), and between AKT2 and p-AKT. Seven of the nine patients with PFS of 6 months or greater had samples submitted for IHC evaluation.

Mutational Analyses
Of 42 fixed tumor samples available, DNA was successfully amplified from 37 cases, and no sequence alterations were found in exons 10 to 11, 14, or 17 of the KIT gene, in any sample. Five of the nine patients with PFS six months or greater had specimens available for mutational analysis.

ELISA Determination of Plasma Levels of PDGF-AB, PDGF-BB, SCF, and VEGF
There were no significant changes in the plasma concentrations of these factors over time (Appendix Table A2). Higher pretreatment plasma levels of VEGF, PDGF-AB, and PDGF-BB were each associated with shorter PFS and survival (Appendix Fig A4, online only); however neither PDGF ligand had a stronger association than VEGF alone. A possible explanation of these observations is the degree of correlation between the three factors (Appendix Table A3, online only).


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 AUTHORS' DISCLOSURES OF...
 AUTHOR CONTRIBUTIONS
 Appendix
 REFERENCES
 
Imatinib mesylate was well tolerated, but had minimal activity in patients with recurrent ovarian or primary peritoneal carcinoma in this study. Although patients were not preselected for expression of imatinib target receptors, several reports have identified KIT and PDGFR expression in the majority of ovarian cancers,9,12,16 which is substantiated by this study. All ovarian cancers expressed at least one of the target receptors for imatinib mesylate. These receptors promote both proliferation and survival of ovarian cancer cells,18 which may explain why patients with tumors with higher staining intensity for PDGFR-β had shorter PFS. Although frequent expression of these receptors renders them reasonable targets for therapeutic intervention, expression is not necessarily sufficient to confer sensitivity to the drug, as was seen in the present study and in previous studies with thyroid and lung cancer cells.32,33 Two smaller trials have evaluated imatinib in recurrent ovarian cancer34,35 in patients who were heavily pretreated (median of four prior regimens). In the National Cancer Institute trial, two of 16 patients had stable disease.34 Most patients had to stop therapy because of toxicity at the 400-mg-twice-daily dose. At the University of Texas M.D. Anderson Cancer Center (Houston, TX), treatment of 16 patients with imatinib 600 mg daily was well tolerated, but there were no responses in 12 patients, and four had stable disease for 3.8 to 8+ months.35 Expression of PDGFR-β and c-Abl were seen in 94% and KIT in 50% of patients' tumors, with no relationship between best response and target expression. The lack of response to imatinib observed in our trial agrees with these smaller trials.

Elevated growth factor receptor activity can be achieved by overexpression of the receptors and/or their ligands and by certain genetic mutations. In this study, more intense staining for PDGFR-β was associated with shorter PFS, and a higher IHC score for SCF was associated with a shorter survival, suggesting that both increased receptor expression and increased stimulation by ligands may enhance receptor activity. We hypothesized that plasma concentrations of these ligands may reflect tumor burden; however, there was no significant change in their levels during the course of treatment, which perhaps is not surprising given the few patients who responded to treatment. Higher pretreatment levels of VEGF, PDGF-AB and -BB were individually associated with poor PFS, and these factors should be investigated as potential biomarkers of tumor burden or of aggressive biology. VEGF is a potent proangiogenic growth factor that is critically involved in ovarian carcinogenesis.36-38 There is strong evidence for its expression in ovarian tumors39,40 and the prognostic impact of serum VEGF.41-45 Our results confirm that higher pretreatment plasma levels of VEGF are associated with both shorter PFS and survival.

There are two classes of KIT mutations that have distinct consequences on the response to KIT inhibitors. Activating mutations in the juxtamembrane domain (exon 11) often lead to constitutive activation that can be strongly inhibited by imatinib. However, exon 17 mutations46 modify the kinase binding pocket to which imatinib binds,28 impairing its ability to inhibit KIT activity. Although there is one report of exon 17 mutations in a small number of ovarian tumors,47 the results of the current study found no mutations that would render the tumors more or less responsive to imatinib treatment.

The signaling cascades initiated by KIT and PDGFR affect the activity of numerous proteins,48,49 including AKT, which regulates cell survival.50 Amplification of AKT2 in ovarian cancers is associated with a poor prognosis51 and is regarded as a potential therapeutic target.52 In the current study, patients with tumors that had a higher staining intensity or PCP for AKT2 showed longer PFS. More intense staining and higher IHC score for p-AKT were both associated with shorter PFS. Thus, expression levels of AKT2 may not be predictive of poor patient outcome, whereas AKT activity as measured by p-AKT detection may have negative prognostic significance for both PFS and survival.

High levels of AKT activity have been identified as a mechanism of resistance to various chemotherapeutics,53,54 including imatinib.24,55 In in vitro experiments, suppression of AKT activity rendered ovarian cancer cells more responsive to imatinib,25 and thus future directions should include evaluation of combination treatments of imatinib with drugs that suppress AKT activity. One such AKT inhibitor, API-2, has recently been reported as an effective treatment in animal models of ovarian cancer56 and is currently in phase I clinical trials. Preclinical studies have also shown the therapeutic potential in combining imatinib with chemotherapeutic agents.57-59 In clinical studies, combination of imatinib with chemotherapy shows promise in patients with acute lymphoblastic leukemia60,61 and ovarian cancer patients,62 although a randomized trial would be required to determine whether the response rate of ovarian cancer patients can be increased by combinations of imatinib with chemotherapeutic drugs.

In conclusion, this study has shown that imatinib mesylate is well tolerated but has minimal activity in patients with recurrent ovarian or primary peritoneal carcinoma, despite tumor expression of the receptors targeted by imatinib. Although KIT mutations do not appear to play a major role in the development of ovarian or peritoneal cancers, tumor expression of p-AKT and plasma levels of VEGF are predictive of poor outcome for these patients.


    AUTHORS' DISCLOSURES OF POTENTIAL CONFLICTS OF INTEREST
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 AUTHORS' DISCLOSURES OF...
 AUTHOR CONTRIBUTIONS
 Appendix
 REFERENCES
 
Although all authors completed the disclosure declaration, the following author(s) indicated a financial or other interest that is relevant to the subject matter under consideration in this article. Certain relationships marked with a "U" are those for which no compensation was received; those relationships marked with a "C" were compensated. For a detailed description of the disclosure categories, or for more information about ASCO's conflict of interest policy, please refer to the Author Disclosure Declaration and the Disclosures of Potential Conflicts of Interest section in Information for Contributors.

Employment or Leadership Position: None Consultant or Advisory Role: None Stock Ownership: None Honoraria: Russell J. Schilder, Eli Lilly & Co, Ortho Biotech Research Funding: Russell J. Schilder, Bristol-Meyers Squibb Expert Testimony: None Other Remuneration: None


    AUTHOR CONTRIBUTIONS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 AUTHORS' DISCLOSURES OF...
 AUTHOR CONTRIBUTIONS
 Appendix
 REFERENCES
 
Conception and design: Russell J. Schilder, Michael W. Sill, Tanya J. Shaw, Barbara C. Vanderhyden

Financial support: Barbara C. Vanderhyden

Provision of study materials or patients: Roger B. Lee

Collection and assembly of data: Roger B. Lee, Tanya J. Shaw, Zoe Miner, Barbara C. Vanderhyden

Data analysis and interpretation: Russell J. Schilder, Michael W. Sill, Tanya J. Shaw, Mary K. Senterman, Andres J. Klein-Szanto, Barbara C. Vanderhyden

Manuscript writing: Russell J. Schilder, Michael W. Sill, Tanya J. Shaw, Andres J. Klein-Szanto, Barbara C. Vanderhyden

Final approval of manuscript: Russell J. Schilder, Michael W. Sill, Roger B. Lee, Tanya J. Shaw, Mary K. Senterman, Andres J. Klein-Szanto, Barbara C. Vanderhyden


    Appendix
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 AUTHORS' DISCLOSURES OF...
 AUTHOR CONTRIBUTIONS
 Appendix
 REFERENCES
 
Immunohistochemistry
Five-micron unstained serial sections were deparaffinized, incubated in 3% hydrogen peroxide in distilled water for 10 minutes, and rinsed in tap water followed by distilled water. Immunohistochemical assays were carried out with commercially available primary antibodies as follows: KIT (1:10; DAKO, Cytomation, Carpinteria, CA), PDGFR-{alpha} (1:25; Santa Cruz Biotechnology, Santa Cruz, CA), PDGFR-β (1:40; Santa Cruz), SCF (1:25; Assay Designs Inc, Ann Arbor, MI), PDGF-A (1:40; Santa Cruz), PDGF-B (1:40; Santa Cruz), AKT2 (1:100; Santa Cruz), and phosphorylated AKT (p-AKT; 1:50; Cell Signaling Technologies, Beverly, MA). Nonspecific binding sites were blocked using either DAKO Cytomation Protein Block, Serum Free for 10 minutes in a humidified chamber or 4% bovine serum albumin/10% sucrose/1% fetal bovine serum for 30 minutes in a humidified chamber. Sections were then incubated for up to 24 hours at room temperature with primary antibodies. Sections were subsequently exposed to DAKO Envision System peroxidase-labeled secondary antibody. Negative controls included processing samples without exposure to primary antibodies, and specificity was ensured with the use of peptide-blocking antibodies, where available. Positive controls were tissues with established expression of the specific protein: breast cancer (PDGF-A and PDGFR-β), GI stromal tumor (KIT), skin (SCF), basal cell carcinoma (PDGFR-{alpha}), and ovarian adenocarcinoma (AKT2 and p-AKT).

Tissue sections were scored for staining intensity (SI) and percentage of tumor cells with specific staining (PCP) independently by three individuals who were blinded to specimen identity. The intensity of staining was scored on a 5-point scale: 1 for negative staining, 2 for light brown (mild) staining, 3 for moderate brown staining, 4 for dark brown staining equal to the intensity observed in the positive control tissue, and 5 when the staining intensity was greater than observed in the positive control tissue. The percentage of positive cells was determined by counting the number of positive cells in three random fields of view for every slide. Each field contained approximately 300 cells.

Mutational Analyses
Genomic DNA extraction was performed on cells retrieved from deparaffinized and rehydrated 10-µm tissue sections. In a subset of patients (10 for exons 10 to 11, 10 for exon 14), DNA was extracted from approximately 1,000 cells isolated from tissue sections using an Arcturus Laser Capture Microscopy (LCM) System (Arcturus Engineering Inc, Mountain View, CA) and CapSure HS caps (Molecular Devices Corporation, Sunnyvale, CA). In this case, DNA from two independent samples per patient was extracted using the Arcturus Picopure DNA extraction kit. DNA was subjected to polymerase chain reaction (PCR) amplification using primer sets designed to detect mutations that impair KIT signaling or responsiveness to imatinib (exons 11, 14, and 17). For DNA extracted from whole sections, PCR reactions for both primer sets exon 10 to 11 (forward: GGTTTCGTAATCGTAGCTGGC; reverse: GCCTGTTTCTGGGAAACTCCC) and exon 14 (forward: ATGGCCATGACCACCCTTGGG; reverse: ATTGCAAACCCTTATGACCCC; Sigma Genosys, Oakville, ON, Canada) were carried out using the Advantage HF-2 Polymerase Kit (BD Biosciences, Mississauga, ON, Canada). Exon 17 primers were those reported previously32 and used with the FailSafe PCR system (Epicenter, Madison, WI).

Four microliters of isolated DNA was amplified in a 10-µL reaction comprising 1X HF-2 buffer, 1.5 or 3.0 mmol/L MgCl2 (for exon 14 and exons 10 to 11, respectively), 1 mmol/L dNTPs, 0.4 pM primers, and 1X HF-2 Polymerase. In addition, 3% DMSO (final concentration) was added to all exon 10 to 11 PCR reactions. For samples collected by LCM, PCR reactions for both exon 10 to 11 and exon 14 were performed using the Advantage 2 Polymerase Kit (Clontech, Mountain View, CA) and 2 µL of tissue sample DNA in a 10-µL reaction (1X Advantage 2 Buffer, 1 mmol/L dNTPs, 0.4 pM primers, and 1X Advantage 2 Polymerase). Exon 17 PCR reactions were carried out on 2 µL of gDNA in a 10 µL reaction comprising 1X Buffer C, 1 µmol/L each forward and reverse primers, and 1 unit FS enzyme (final concentrations). Cycling parameters for all exon 10 to 11 and exon 14 reactions were 94°C for 3 minutes, five cycles of 94°C for 5 seconds and 72°C for 1 minute, five cycles of 94°C for 5 seconds and 70°C for 1 minute, 30 cycles of 94°C for 5 seconds, 68°C for 1 minute, and 72°C for 10 minutes. The exon 17 PCR cycling parameters were 94°C for 5 minutes, five cycles of 94°C for 30 seconds and 60°C for 30 seconds, five cycles of 94°C for 30 seconds and 58°C for 30 seconds, five cycles of 94°C for 30 seconds and 55°C for 30 seconds, and 25 cycles of 94°C for 30 seconds and 51°C for 30 seconds followed by 72°C for 10 minutes. PCR products were sequenced by the Ontario Genomics Innovation Centre, and sequences for each exon were aligned to the KIT gene sequence using the Vector NTI 8.0 software program (Invitrogen, Burlington, ON, Canada) followed by manual editing where necessary.

Participating Institutions
The following Gynecologic Oncology Group member institutions participated in this study: Abington Memorial Hospital; University of Pennsylvania Cancer Center; University of North Carolina School of Medicine; Wake Forest University School of Medicine; Rush-Presbyterian-St Luke's Medical Center; SUNY Downstate Medical Center; The Cleveland Clinic Foundation; State University of New York at Stony Brook; Cooper Hospital/University Medical Center; Fox Chase Cancer Center; Tacoma General Hospital; Thomas Jefferson University Hospital; Case Western Reserve University; Ellis Fischel Cancer Center; and the Community Clinical Oncology Program.

Go


Figure 2
View larger version (12K):
[in this window]
[in a new window]
[PowerPoint Slide for Teaching]
 
Fig A1. Kaplan-Meier estimates of overall survival (Surv) and progression-free survival (PFS) of patients included in the study.

 
Go


Figure 3
View larger version (126K):
[in this window]
[in a new window]
[PowerPoint Slide for Teaching]
 
Fig A2. Levels of expression of target receptors and their ligands in ovarian cancers. Paraffin-embedded cancers were analyzed by immunohistochemistry for expression of KIT, SCF, PDGFR-{alpha}, PDGF-A, PDGFR-β, and PDGF-B (brown stain represents a positive signal). Representative fields of view are shown for each antibody. All photographs were taken at 10x magnification except for PDGFR-β and PDGF-B, which are 40x. Insets are negative controls processed without primary antibody. Mild to moderate levels (staining intensity = 2.5 in this case) of KIT expression are found primarily in the cytoplasm of epithelial tumor cells, with no expression in the stromal compartment. PDGFR-{alpha} shows moderate staining in both the cytoplasm and nuclei of papillary projections of epithelial cells; most of the stromal cells are negative. A malignant gland shows moderate levels of cytoplasmic expression of PDGFR-β, and numerous malignant glands show dark cytoplasmic staining for SCF. Dark PDGF-A staining is found in sheets of poorly differentiated epithelial cells. Mild to moderate staining of PDGF-B is found in malignant epithelial cells, whereas a central fibrous core is negative for expression. PDGF, platelet-derived growth factor; R, receptor.

 
Go


Figure 4
View larger version (150K):
[in this window]
[in a new window]
[PowerPoint Slide for Teaching]
 
Fig A3. Levels of phosphorylated AKT relative to AKT2 in ovarian tumor samples. Ovarian tumors were analyzed by immunohistochemistry for phosphorylated AKT (p-AKT) and AKT2 content. Representative fields of view are shown for two cases that differ dramatically in p-AKT content (ie, negative for case 1, dark staining for case 2) despite staining for AKT2 that was as dark (case 2) or darker (case 1) than the positive control (not shown).

 
Go


Figure 5
View larger version (8K):
[in this window]
[in a new window]
[PowerPoint Slide for Teaching]
 
Fig A4. Plots of deviance residuals against concentration of vascular endothelial growth factor (VEGF). (A) Residual plot indicates increasing hazard of progression or death as the concentration of VEGF increases (two cases were excluded for being influential on the analysis, see Patients and Methods for details). (B) Residual plot indicates increasing hazard of death as the concentration of VEGF increases (two cases excluded).

 
Go


View this table:
[in this window]
[in a new window]

 
Table A1. Kendall's {tau}-b Correlation Coefficients for the Immunohistochemical Staining Intensity Values of the Biomarkers Examined During the Study

 
Go


View this table:
[in this window]
[in a new window]

 
Table A2. First, Second, and Third Quartiles of the Concentrations of SCF, PDGF-AA, PDGF-BB, and VEGF in Plasma Samples Collected Before and During Treatment With Imatinib Mesylate

 
Go


View this table:
[in this window]
[in a new window]

 
Table A3. Pearson Correlation Coefficients for Log*-Transformed ELISA Data

 


    ACKNOWLEDGMENTS
 
We thank Colleen Crane, Elizabeth Macdonald, and Lisa Vandermeer for their excellent technical assistance; Dr Joseph Testa for his help in arranging some of the AKT immunohistochemistry studies; Nathan Stolch and Deborah Altomare for their assistance with the performance of the ELISAs and sample handling; and Sandra Dascomb for management of clinical information.


    NOTES
 
Supported by National Cancer Institute Grants No. CA27469 (Gynecologic Oncology Group) and CA37517 (Gynecologic Oncology Group Statistical and Data Center). The translational research elements of this study were supported in part by the National Cancer Institute of Canada, with funds from the Terry Fox Foundation (B.C.V.) and the Betty Irene West Doctoral Research Scholarship from the Canadian Institutes of Health Research (T.J.S.), and by the National Cancer Institute Specialized Program of Research Excellence (SPORE) in Ovarian Cancer awarded to Fox Chase Cancer Center (Grant No. CA83638).

Authors' disclosures of potential conflicts of interest and author contributions are found at the end of this article.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 AUTHORS' DISCLOSURES OF...
 AUTHOR CONTRIBUTIONS
 Appendix
 REFERENCES
 
1. Jemal A, Murray T, Ward E, et al: Cancer statistics, 2005. CA Cancer J Clin 55:10-30, 2007[CrossRef]

2. Ozols RF, Rubin SC, Thomas GM, et al: Epithelial ovarian cancer, in Hoskins WJ, Young RC, Markman M, et al (eds): Principles and Practice of Gynecologic Oncology (ed 4). Lippincott Williams & Wilkins, Philadelphia, 2005, p 895

3. Wang C, Curtis JE, Geissler EN, et al: The expression of the proto-oncogene C-kit in the blast cells of acute myeloblastic leukemia. Leukemia 3:699-702, 1989[Medline]

4. Ikeda H, Kanakura Y, Tamaki T, et al: Expression and functional role of the proto-oncogene c-kit in acute myeloblastic leukemia cells. Blood 78:2962-2968, 1991[Abstract/Free Full Text]

5. Hines SJ, Organ C, Kornstein MJ, et al: Coexpression of the c-kit and stem cell factor genes in breast carcinomas. Cell Growth Differ 6:769-779, 1995[Abstract]

6. Hibi K, Takahashi T, Sekido Y, et al: Coexpression of the stem cell factor and the c-kit genes in small-cell lung cancer. Oncogene 6:2291-2296, 1991[Medline]

7. Krystal GW, Hines SJ, Organ CP: Autocrine growth of small cell lung cancer mediated by coexpression of c-kit and stem cell factor. Cancer Res 56:370-376, 1996[Abstract/Free Full Text]

8. Kindblom LG, Remotti HE, Aldenborg F, et al: Gastrointestinal pacemaker cell tumor (GIPACT): Gastrointestinal stromal tumors show phenotypic characteristics of the interstitial cells of Cajal. Am J Pathol 152:1259-1269, 1998[Abstract]

9. Tonary AM, Macdonald EA, Faught W, et al: Lack of expression of c-KIT in ovarian cancers is associated with poor prognosis. Int J Cancer 89:242-250, 2000[CrossRef][Medline]

10. Parrott JA, Mosher R, Kim G, et al: Autocrine interactions of keratinocyte growth factor, hepatocyte growth factor, and kit-ligand in the regulation of normal ovarian surface epithelial cells. Endocrinology 141:2532-2539, 2000[Abstract/Free Full Text]

11. Parrott JA, Kim G, Skiller MK: Expression and action of kit ligand stem cell factor in normal human and bovine ovarian surface epithelium and ovarian cancer. Biol Reprod 62:1600-1609, 2000[Abstract/Free Full Text]

12. Schmandt RE, Broaddus R, Lu KH, et al: Expression of c-abl, c-kit, and platelet-derived growth factor receptor-beta in ovarian serous carcinoma and normal ovarian surface epithelium. Cancer 98:758-764, 2003[CrossRef][Medline]

13. de Silva CM, Reid R: Gastrointestinal stromal tumors (GIST): C-kit mutations, CD117 expression, differential diagnosis and targeted cancer therapy with imatinib. Pathol Oncol Res 9:13-19, 2003[Medline]

14. Heinrich MC, Corless CL, Demetri GD, et al: Kinase mutations and imatinib response in patients with metastatic gastrointestinal stromal tumor. J Clin Oncol 21:4342-4349, 2003[Abstract/Free Full Text]

15. Singer G, Schraml P, Belgard C, et al: KIT in ovarian carcinoma: Disillusion about a potential therapeutic target. J Natl Cancer Inst 95:1009-1010, 2003[Free Full Text]

16. Wilczynski SP, Chen YY, Chen W, et al: Expression and mutational analysis of tyrosine kinase receptors c-kit, PDGFRalpha, and PDGFRbeta in ovarian cancers. Hum Pathol 36:242-249, 2005[CrossRef][Medline]

17. Heldin CH, Westermark B: Mechanism of action and in vivo role of platelet derived growth factor. Physiol Rev 79:1283-1316, 1999[Abstract/Free Full Text]

18. Henriksen R, Funa K, Wilander E, et al: Expression and prognostic significance of platelet-derived growth factor and its receptors in epithelial ovarian neoplasms. Cancer Res 53:4550-4554, 1993[Abstract/Free Full Text]

19. Matei D, Emerson RE, Lai Y-C, et al: Autocrine activation of PDGFRa promotes the progression of ovarian cancer. Oncogene 25:2060-2069, 2006[CrossRef][Medline]

20. Matei D, Sanchez K, Kelley M, et al: PDGFR A is overexpressed in ovarian carcinomas and represents a potential therapeutic target. Proc Am Soc Clin Oncol 22:867, 2003 (abstr 3485)

21. Heinrich MC, Griffith DJ, Druker BJ, et al: Inhibition of c-kit receptor tyrosine kinase activity by STI 571, a selective tyrosine kinase inhibitor. Blood 96:925-932, 2000[Abstract/Free Full Text]

22. Carroll M, Ohno-Jones S, Tamura S, et al: CGP 57148, a tyrosine kinase inhibitor, inhibits the growth of cells expressing BCR-ABL, TEL-ABL, and TEL-PDGFR fusion proteins. Blood 90:4947-4952, 1997[Abstract/Free Full Text]

23. Druker BJ, Taipaz M, Resta DJ, et al: Efficacy and safety of a specific inhibitor of the bcr-abl tyrosine kinase in chronic myeloid leukemia. N Engl J Med 344:1031-1037, 2001[Abstract/Free Full Text]

24. Matei D, Chang DD, Jeng MH: Imatinib mesylate (Gleevec) inhibits ovarian cancer cell growth through a mechanism dependent on platelet-derived growth factor receptor alpha and Akt inactivation. Clin Cancer Res 10:681-690, 2004[Abstract/Free Full Text]

25. Shaw TJ, Vanderhyden BC: AKT mediates the pro-survival effects of KIT in ovarian cancer cells and is a determinant of sensitivity to imatinib mesylate. Gynecol Oncol 105:122-131, 2007[CrossRef][Medline]

26. Therasse P, Arbuck SG, Eisenhauer EA, et al: New guidelines to evaluate the response to treatment in solid tumors: European Organization for Research and Treatment of Cancer, National Cancer Institute of Canada. J Natl Cancer Inst 92:205-216, 2000[Abstract/Free Full Text]

27. Hirota S, Isozaki K, Moriyama Y, et al: Gain-of-function mutations of c-kit in human gastrointestinal stromal tumors. Science 279:577-580, 1998[Abstract/Free Full Text]

28. Ma Y, Zeng S, Metcalfe DD, et al: The c-KIT mutation causing human mastocytosis is resistant to STI571 and other KIT kinase inhibitors: Kinases with enzymatic site mutations show different inhibitor sensitivity profiles than wild-type kinases and those with regulatory-type mutations. Blood 99:1741-1744, 2002[Abstract/Free Full Text]

29. Chen TT, Ng TH: Optimal flexible designs in phase II clinical trials. Stat Med 17:2301-2312, 1998[CrossRef][Medline]

30. Schilder R, Sill M, Chen X, et al: Phase II study of gefitinib in patients with relapsed or persistent ovarian or primary peritoneal carcinoma and evaluation of epidermal growth factor receptor mutations and immunohistochemical expression: A gynecologic oncology group study. Clin Cancer Res 11:5539-5548, 2005[Abstract/Free Full Text]

31. Collett D: Modelling Survival Data in Medical Research (ed 2). Boca Raton, FL, Chapman & Hall/CRC, 2003, pp 116-117

32. Dziba JM, Ain KB: Imatinib mesylate (gleevec; STI571) monotherapy is ineffective in suppressing human anaplastic thyroid carcinoma cell growth in vitro. J Clin Endocrinol Metab 89:2127-2135, 2004[Abstract/Free Full Text]

33. Krug LM, Crapanzano JP, Azzoli CG, et al: Imatinib mesylate lacks activity in small cell lung carcinoma expressing c-kit protein: A phase II clinical trial. Cancer 103:2128-2131, 2005[CrossRef][Medline]

34. Posadas EM, Hussain MM, Espina V, et al: A phase II clinical trial with proteomic profiling of imatinib mesylate in patients with refractory or relapsed epithelial ovarian cancer (EOC). J Clin Oncol 22:872s, 2004 (suppl; abstr 9651)[CrossRef]

35. Coleman RL, Broaddus RR, Bodurka DC, et al: Phase II trial of imatinib mesylate in patients with recurrent platinum- and taxane-resistant epithelial ovarian and primary peritoneal cancers. Gynecol Oncol 101:126-131, 2006[CrossRef][Medline]

36. Borgström P, Hillan KJ, Sriramarao P, et al: Complete inhibition of angiogenesis and growth of microtumors by anti-vascular endothelial growth factor neutralizing antibody: Novel concepts of angiostatic therapy from intravital videomicroscopy. Cancer Res 56:4032-4039, 1996[Abstract/Free Full Text]

37. Mu J, Abe Y, Tsutsui T, et al: Inhibition of growth and metastasis of ovarian carcinoma by administering a drug capable of interfering with vascular endothelial growth factor activity. Jpn J Cancer Res 87:963-971, 1996[CrossRef]

38. Abu-Jawdeh GM, Faix JD, Niloff J, et al: Strong expression of vascular permeability factor (vascular endothelial growth factor) and its receptors in ovarian borderline and malignant neoplasms. Lab Invest 74:1105-1115, 1996[Medline]

39. Raspollini MR, Amunni G, Villanucci A, et al: Prognostic significance of microvessel density and vascular endothelial growth factor expression in advanced ovarian serous carcinoma. Int J Gynecol Cancer 14:815-823, 2004[CrossRef][Medline]

40. Goodheart MJ, Ritchie JM, Rose SL, et al: The relationship of molecular markers of p53 function and angiogenesis to prognosis of stage I epithelial ovarian cancer. Clin Cancer Res 11:3733-3742, 2005[Abstract/Free Full Text]

41. Tempfer C, Obermair A, Hefler L, et al: Vascular endothelial growth factor serum concentrations in ovarian cancer. Obstet Gynecol 92:360-363, 1998[CrossRef][Medline]

42. Gadducci A, Ferdeghini M, Fanucchi A, et al: Serum preoperative vascular endothelial growth factor (VEGF) in epithelial ovarian cancer: Relationship with prognostic variables and clinical outcome. Anticancer Res 19:1401-1405, 1999[Medline]

43. Chen CA, Cheng WF, Lee CN, et al: Serum vascular endothelial growth factor in epithelial ovarian neoplasms: Correlation with patient survival. Gynecol Oncol 74:235-240, 1999[CrossRef][Medline]

44. Oehler MK, Caffier H: Prognostic relevance of serum vascular endothelial growth factor in ovarian cancer. Anticancer Res 20:5109-5112, 2000[Medline]

45. Hefler LA, Zeillinger R, Grimm C, et al: Preoperative serum vascular endothelial growth factor as a prognostic parameter in ovarian cancer. Gynecol Oncol 103:512-517, 2006[CrossRef][Medline]

46. Nagata H, Worobec AS, Oh CK, et al: Identification of a point mutation in the catalytic domain of the protooncogene c-kit in peripheral blood mononuclear cells of patients who have mastocytosis with an associated hematologic disorder. Proc Natl Acad Sci U S A 92:10560-10564, 1995[Abstract/Free Full Text]

47. Kim DJ, Lee MH, Park TI, et al: Expression and mutational analysis of c-kit in ovarian surface epithelial tumors. J Korean Med Sci 21:81-85, 2006[Medline]

48. Tallquist M, Kazlauskas A: PDGF signaling in cells and mice. Cytokine Growth Factor Rev 15:205-213, 2004[CrossRef][Medline]

49. Hong L, Munugalavadla V, Kapur R: C-Kit-mediated overlapping and unique functional and biochemical outcomes via diverse signaling pathways. Mol Cell Biol 24:1401-1410, 2004[Abstract/Free Full Text]

50. Song G, Ouyang G, Bao S: The activation of Akt/PKB signaling pathway and cell survival. J Cell Mol Med 9:59-71, 2005[Medline]

51. Bellacosa A, de Feo D, Godwin AK, et al: Molecular alterations of the AKT2 oncogene in ovarian and breast carcinomas. Int J Cancer 64:280-285, 1995[Medline]

52. Mitsiades CS, Mitsiades N, Koutsilieris M: The Akt pathway: Molecular targets for anti-cancer drug development. Curr Cancer Drug Targets 4:235-256, 2004[CrossRef][Medline]

53. Knuefermann C, Lu Y, Liu B, et al: HER2/PI-3K/Akt activation leads to a multidrug resistance in human breast adenocarcinoma cells. Oncogene 22:3205-3212, 2003[CrossRef][Medline]

54. Yuan ZQ, Feldman RI, Sussman GE, et al: AKT2 inhibition of cisplatin-induced JNK/p38 and Bax activation by phosphorylation of ASK1: Implication of AKT2 in chemoresistance. J Biol Chem 278:23432-23440, 2003[Abstract/Free Full Text]

55. Tsurutani J, West KA, Sayyah J, et al: Inhibition of the phosphatidylinositol 3-kinase/Akt/mammalian target of rapamycin pathway but not 325 the MEK/ERK pathway attenuates laminin-mediated small cell lung cancer cellular survival and resistance to imatinib mesylate or chemotherapy. Cancer Res 65:8423-8432, 2005[Abstract/Free Full Text]

56. Yang L, Dan HC, Sun M, et al: Akt/Protein Kinase B Signaling Inhibitor-2, a selective small molecule inhibitor of Akt signaling with antitumor activity in cancer cells overexpressing Akt. Cancer Res 64:4394-4399, 2004[Abstract/Free Full Text]

57. Pietras K, Rubin K, Sjoblom T, et al: Inhibition of PDGFR signaling in tumor stroma enhances antitumor effect of chemotherapy. Cancer Res 62:5476-5484, 2002[Abstract/Free Full Text]

58. Apte SM, Fan D, Killion JJ, et al: Targeting the platelet-derived growth factor receptor in antivascular therapy for human ovarian carcinoma. Clin Cancer Res 10:897-908, 2004[Abstract/Free Full Text]

59. Pietras K, Stumm M, Hubert M, et al: STI571 enhances the therapeutic index of epothilone by a tumor selective increase of drug uptake. Clin Cancer Res 9:3779-3787, 2003[Abstract/Free Full Text]

60. Yanada M, Takeuchi J, Sugiura I, et al: High complete remission rate and promising outcome by combination of imatinib and chemotherapy for newly diagnosed BCR-ABL-positive acute lymphoblastic leukemia: A phase II study by the Japan Adult Leukemia Study Group. J Clin Oncol 24:460-466, 2006[Abstract/Free Full Text]

61. de Labarthe A, Rousselot P, Huguet-Rigal F, et al: Imatinib combined with induction or consolidation chemotherapy in patients with de novo Philadelphia chromosome-positive acute lymphoblastic leukemia - Results of the GRAAPH-2003 study. Blood 109:1408-1413, 2007[Abstract/Free Full Text]

62. Matei D, Emerson RE, Menning N, et al: Clinical activity of imatinib mesylate in combination with docetaxel in patients with advance platinum-resistant ovarian cancer- Hoosier Oncology Group GYN03-62. J Clin Oncol 24:278s, 2006 (suppl; abstr 5091)

Submitted September 6, 2007; accepted November 29, 2007.


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Facebook Facebook   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
Veterinary PathologyHome page
J. Halper
Growth Factors as Active Participants in Carcinogenesis: A Perspective
Veterinary Pathology, January 1, 2010; 47(1): 77 - 97.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schilder, R. J.
Right arrow Articles by Vanderhyden, B. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schilder, R. J.
Right arrow Articles by Vanderhyden, B. C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

About
JCO
 Editorial
Roster
 Advertising
Information
 Librarians &
Institutions
 Rights &
Permissions
 PDA Services

Copyright © 2008 by the American Society of Clinical Oncology, Online ISSN: 1527-7755. Print ISSN: 0732-183X
Terms and Conditions of Use
  HighWire Press HighWire Press™ assists in the publication of JCO Online