Originally published as JCO Early Release 10.1200/JCO.2007.15.8808 on June 30 2008

This Article Abstract Full Text (PDF) Purchase Article View Shopping Cart Alert me when this article is cited Alert me if a correction is posted Services Email this article to a colleague Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Save to my personal folders Download to citation manager Rights & Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Oza, A. M. Articles by Fyles, A. Search for Related Content PubMed PubMed Citation Articles by Oza, A. M. Articles by Fyles, A. Social Bookmarking                            What's this?

Phase II Study of Erlotinib in Recurrent or Metastatic Endometrial Cancer: NCIC IND-148

Amit M. Oza, Elizabeth A. Eisenhauer, Laurie Elit, Jean-Claude Cutz, Akira Sakurada, Ming S. Tsao, Paul J. Hoskins, Jim Biagi, Prafull Ghatage, John Mazurka, Diane Provencher, Naomi Dore, Janet Dancey, Anthony Fyles

From the Princess Margaret Hospital, University Health Network, University of Toronto, Toronto; National Cancer Institute of Canada Clinical Trials Group, Queen's University; Cancer Centre of Southeastern Ontario, Kingston; Juravinski Cancer Centre, Hamilton, Ontario; BC Cancer Agency Vancouver Clinic, Vancouver, British Columbia; Tom Baker Cancer Centre, Calgary, Alberta; Centre Hospitalier de L'Université de Montréal, Montreal, Quebec, Canada; and the Cancer Therapy Evaluation Program, National Cancer Institute, Bethesda MD

Corresponding author: Amit M. Oza, MD (Lon), FRCP, FRCPC, Princess Margaret Hospital, University Health Network, Bras Family Drug Development Program, 610 University Avenue, Suite 5-700, Toronto, Ontario, M5G 2M9, Canada; e-mail: amit.oza{at}uhn.on.ca

	ABSTRACT

TOP ABSTRACT INTRODUCTION PATIENTS AND METHODS RESULTS DISCUSSION AUTHORS' DISCLOSURES OF... AUTHOR CONTRIBUTIONS Glossary Terms REFERENCES

 
Purpose Epidermal growth factor receptor (EGFR) overexpression is common in endometrial cancers and may have a major role in tumor growth and progression. Erlotinib is an orally active, selective inhibitor of EGFR tyrosine kinase activity.

Patients and Methods A multinomial design two-stage phase II study was performed to evaluate single-agent activity of erlotinib in women with advanced endometrial cancer with recurrent or metastatic disease who were chemotherapy naïve and had received up to one line of prior hormonal therapy. Erlotinib was administered at daily dose of 150 mg. Archival tumor tissue was analyzed for EGFR expression by immunohistochemistry (IHC) and gene amplification by fluorescent in situ hybridization (FISH). Mutational status of EGFR was determined in responders.

Results Thirty-two of 34 entered patients are assessable for response. Treatment was well tolerated and severe toxicity infrequent, with the only grade 4 toxicity being an elevation of transaminases (AST). There were four confirmed partial responses (PRs; 12.5%; 95% CI, 3.5% to 29%) lasting 2 to 36 months. Fifteen patients had stable disease (SD), with median duration of 3.7 months (range, 2 to 12 months). EGFR expression was analyzed in thirty patients; 19 were positive, nine were negative, and two were not assessable. Of the 19 patients who were EGFR positive, three had PR (16%), seven SD, and eight progressive disease, and one was not assessable. No mutations were identified in responders. FISH showed no correlation of response with gene amplification.

Conclusion Erlotinib is well tolerated with an overall objective response rate of 12.5%. Molecular analysis did not identify EGFR mutations in responders or correlation of response with gene amplification.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION PATIENTS AND METHODS RESULTS DISCUSSION AUTHORS' DISCLOSURES OF... AUTHOR CONTRIBUTIONS Glossary Terms REFERENCES

 
Overexpression of epidermal growth factor receptor (EGFR) in endometrial cancer has been documented in several studies in between 36% and 87% of the patients, with conflicting reports on the impact of EGFR expression/overexpression on prognosis.^1-8 Baguley et al⁹ used a potent tyrosine kinase inhibitor (TKI) on primary cultures from patients with cancer of the lung, ovary, breast, cervix, and endometrium and concluded that EGFR expression was necessary, but not sufficient, for in vitro response. The high levels of EGFR expression and possible association with inferior prognosis would suggest that therapeutically targeting EGFR or its downstream pathway would be logical.

Erlotinib hydrochloride [6,7-Bis (2-methoxy-ethoxy)-quinazolin-4-yl]-(3-ethynyl-phenyl) amine hydrochloride, also known as CP-358774 and OSI-774] is an orally active potent selective inhibitor of the EGFR tyrosine kinase. It competes with the adenosine triphosphatase (ATP)-binding site in the intracellular tyrosine kinase domain of EGFR with an median inhibition concentration of 2 nmol/L against the kinase. Erlotinib induces apoptosis in in vitro tumor cell lines and has antiproliferative activity against numerous human tumor xenografts in vivo.¹⁰ In clinical trials, erlotinib has shown phase II or III antitumor activity in several malignancies including lung, ovarian, head and neck, and biliary tract cancers.^11-14 It has been found to be safe and well tolerated, with the most common adverse effects being diarrhea, rash, nausea, headache, emesis, and fatigue. The recommended phase II dose is 150 mg orally per day on a continuous schedule.

	PATIENTS AND METHODS

TOP ABSTRACT INTRODUCTION PATIENTS AND METHODS RESULTS DISCUSSION AUTHORS' DISCLOSURES OF... AUTHOR CONTRIBUTIONS Glossary Terms REFERENCES

 
This was a nonrandomized, nonblinded, multicenter phase II trial to investigate the efficacy of erlotinib in patients with locally advanced, recurrent and/or metastatic carcinoma of the endometrium conducted by the National Cancer Institute of Canada (NCIC) Clinical Trials Group. The study was conducted according to Good Clinical Practice guidelines, with full research ethics board approval at each of the participating institutions. All patients signed written informed consent before study entry.

Eligibility
Patients with histologically confirmed metastatic/locally advanced adenocarcinoma or adenosquamous carcinoma of the endometrium, incurable by standard therapies were eligible for this trial. Patients may have had up to one prior hormonal treatment (progestational or aromatase inhibitor) for their disease but may not have had prior chemotherapy or prior therapy with agents targeting the human EGFR (HER)-1/EGFR. Prior radiation therapy was to have been completed at least 28 days before registration was allowed. HER-1/EGFR overexpression was not an inclusion criterion for this study, but all patients had to have had archival tumor specimens available for determination of expression by immunohistochemistry. Presence of clinically and/or radiologically documented disease with at least one site of measurable disease was required for entry. Patients with uterine sarcomas, malignant mixed mullerian tumors, and/or adenosarcomas were excluded as were those with known brain metastases, or a history of other malignancies (except treated nonmelanoma skin cancer and in situ cancer of the cervix).

Other eligibility criteria were age 18 years or older; Eastern Cooperative Oncology Group (ECOG) performance status of 0 to 2 with a life expectancy of at least 12 weeks; adequate hematopoietic (absolute neutrophil count 1.5 x 10⁹/L; platelet count 100 x 10⁹/L); hepatic (bilirubin upper normal limit [UNL]; AST and ALT levels 2.5x UNL) and renal function (serum creatinine 1.5x the UNL).

Study Design and Treatment Plan
Erlotinib was administered without a break at a dose of 150 mg per day orally with up to 200 mL of water before breakfast. Patients fasted for at least 2 hours before and 1 hour after treatment. A cycle of treatment was defined as 4 weeks.

Daily treatment was continued until one of the following criteria was met: disease progression, intercurrent illness that prevented further treatment, unacceptable adverse event(s), patient's decision to withdraw from the study, or inability to continue treatment because of changes in patient's condition.

Management of Toxicity
There were specific guidelines for the management of toxicity from diarrhea, rash and keratitis with drug suspension if grade 3 diarrhea or worse (despite optimal loperamide) and rash, or prolonged (> 14 days) grade 2 keratitis. Otherwise, suspension of drug was generally recommended for any grade 2 or higher toxicity. Drug was recommenced if toxicity recovered to grade 1 or better within 2 weeks at a one–dose level reduction. Patients whose rash or diarrhea did not return to a grade 1 or less within 2 weeks were taken off study. Dose reductions were as follows: level –1, 100 mg/d; level –2, 50 mg/d; and level –3, 25 mg/d. Patients requiring a third dose reduction were to be taken off study unless the patient was deriving significant benefit from treatment. Any symptoms or signs of interstitial pneumonitis warranted withholding drug and permanent discontinuation if the diagnosis was confirmed and thought to be related to erlotinib.

The treatment of severe or persistent (grade 2 or higher) erlotinib-related skin rash included several options: the use of oral minocycline or topical antibiotics, oral diphenhydramine, or steroids. In addition, those with grade 3 rash had treatment withheld until it resolved to grade 1 or less. Patients with diarrhea were treated with loperamide 4 mg at first onset, followed by 2 mg every 2 to 4 hours until diarrhea free for 12 hours.

On-Study Evaluation
Tumor response was evaluated using Response Evaluation Criteria in Solid Tumors (RECIST).¹⁵ Stable disease (SD) required a minimum duration of 4 weeks. Chest x-ray and computed tomography (CT) were performed at baseline and after every two cycles or 8 weeks. Assessment was also performed at any time there was clinical suspicion of progressive disease (PD). The best overall response was the best response recorded from the start of treatment until the end of treatment. The duration of response was defined as the time from complete response (CR) or partial response (PR) until the first objective evidence of PD or death resulting from any cause. Time to progression was defined as the time from enrollment onto the study until progression or death. Hematology was evaluated on days 1 and 15 of each cycle. Biochemistry, patient review, and assessment of toxic effects were carried out on day 1 of each cycle and graded according to the NCI Common Toxicity Criteria.

All patients were seen at 4 weeks after completion of protocol therapy. Continued follow-up was not required for patients off protocol treatment with PD, except to document late toxicities and death. Patients who went off protocol treatment with CR, PR, or SD required ongoing follow-up every 3 months until relapse or death.

Molecular Analysis of EGFR Expression and Gene Status
Immunohistochemical staining for HER-1/EGFR of original paraffin-embedded tumor was conducted at a central laboratory (Ontario Cancer Institute/Princess Margaret Hospital, Toronto, Ontario, Canada) using the mouse clone 31G7 monoclonal EGFR antibody (Zymed Laboratory Inc, South San Francisco, CA) at 1:50 dilution, and the rabbit polyclonal Anti-CerbB2 antibody (DAKO, Glostrup, Denmark) at 1:300 dilution. Tumors were scored as positive for EGFR protein expression if there was positive membranous staining (complete or incomplete) in at least 10% of tumor cells.

Mutational analysis of exons 18 to 21 of the EGFR gene was performed as described by Paez et al¹⁶ with modifications for primers. The forward (F) and reverse (R) primer sequences used in the present study are as follows: 18F—GTAGAGAAGGCGTACATTTGTCC; 18R—GATTTCCTCTCAATAACTTGGG; 18F-Nested—TCCAAATGAGCTGGCAAGTG; 18R-Nested TCCCAAACACTCAGTGAAACAAA; 19F—GCAATATCAGCCTTAGGTGCGGCTC;19R:GAAAGGGAAAGACATAGAAAGTGAACATTTAGGA; 19F Nested—GTGCATCGCTGGTAACATCC; 19R-Nested—TGTGGAGATGAGCAGGGTCT; 20F—AGCTTTTCCTCCATGAGTACGTATT; E20R2—TCCCAGGAGCGCAGACCGCAT; 20F-Nested—ATCGCATTCATGCGTCTTCA; 20R-Nested—ATCCCCATGGCAAACTCTTG; 21F—CCAGCCATAAGTCCTCGACGTGGA;21R—GCGAGCTCACCCAGAATGTCTG; 21F-Nested—GCTCAGAGCCTGGCATGAA; 21R-Nested—CATCCTCCCCTGCATGTGT.

After amplification of the respective exons, purified polymerase chain reaction products were sequenced in both directions using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA) and a 3100 Genetic Analyzer (Applied Biosystems). Sequence data were analyzed by SeqScape software 2.1.1 (Applied Biosystems), followed by manual review.

Fluorescent in situ hybridization (FISH) studies were performed using dual-color DNA FISH probes containing the LSI EGFR (Vysis Inc, Downer's Grove, IL) probe specific for EGFR locus (7p12) labeled with Spectrum Orange, and the CEP7 chromosome 7 centromere (7p11.1-q11.1) probe labeled with SpectrumGreen. Slide pretreatment, codenaturation, hybridization, and posthybridization washes were performed as described by Tsao et al.¹⁷ A minimum of 50 intact tumor cell nuclei were scored according to the number of red (EGFR) and green (CEP7) signals observed as well as the pattern of distribution of signals.

Design, End Points, and Statistical Considerations
The primary end points of this study were objective clinical response and progression, according to RECIST criteria. Secondary end points included the relationship between EGFR expression in primary tumor samples and objective response and assessment of EGFR molecular profile in responding patients.

The protocol planned to accrue up to 30 response-assessable patients. A multinomial stopping rule incorporating both response and early progression (< 8 weeks) was employed in a two-stage design.^18,19 In the first stage, 15 response-assessable patients would be entered. Using response hypotheses of H0 no greater than 5% and Ha of at least 20% and progression hypotheses of H0 of at least 70% and Ha no greater than 50%, the drug would be rejected at the end of the first stage of accrual if one of the following was observed: No responses were seen with none or more early progressions or 12 or more early progressions. If neither of the above criteria were met, 15 more response-assessable patients, for a total of 30 patients, would be accrued in the second stage. The drug would be accepted as active if one of the following was observed: One or more responses with 16 or fewer early progressions, three or more responses with 17 or fewer early progressions, or four or more responses and 19 or fewer early progressions.

This modified multivariate procedure tested the null hypothesis that the response rate was 5% and a treatment failure/progression rate of 70%, versus the alternative hypothesis that the response rate was 20% and the progression rate of 50%. The significance level was = .074 and the power β = .901.

The criteria for moving to stage 2 were fulfilled because results from the first 16 patients (patients 15 and 16 enrolled on same day) demonstrated one PR, nine SDs, and six patients with PD. We therefore passed to stage 2 on both counts: one response (> 0), only six PDs (< 9).

	RESULTS

TOP ABSTRACT INTRODUCTION PATIENTS AND METHODS RESULTS DISCUSSION AUTHORS' DISCLOSURES OF... AUTHOR CONTRIBUTIONS Glossary Terms REFERENCES

 
This phase II study enrolled 34 patients with recurrent and/or metastatic endometrial cancer from eight participating centers across Canada between January 2002 and March 2004. One patient was withdrawn from the trial before beginning treatment, leaving 33 patients treated. At the time of this analysis, all 33 patients were off study, 21 with documented progression, six with symptomatic progression, three because of erlotinib toxicity, one disease-related death, and two for other reasons. All 33 patients were eligible and assessable for toxicity; 32 were assessable for response.

Patient Characteristics
Table 1 summarizes the pretreatment patient and disease characteristics in the 33 eligible patients. Six patients had received prior hormonal therapy and 19 prior radiation.

Toxicity
Table 3 displays the nonhematologic adverse events considered to be at least possibly drug related. The most common event was rash, generally grade 1 or 2 in severity, which affected 29 of the 33 patients. Only one patient had a grade 3 rash documented. Dry skin was the next most common adverse event reported in 20 patients (61%), followed by diarrhea in 19 (58%), including four patients (13%) with grade 3 severity. Other grade 3 toxicities included one patient with non-neutropenic infection and dyspnea, plus single reports of fatigue, arthralgia, keratitis/conjunctivitis, nausea, dehydration, and hypertension. One patient was hospitalized for dehydration and diarrhea, deemed probably related to trial therapy. No drug-related deaths were reported.

EGFR Analyses
Of the 33 patients treated, 30 had archival tumor samples submitted for analysis by immunohistochemistry. Two samples were indeterminate, 19 (63.3%) were positive for EGFR protein expression, and nine were negative (Table 5). Three of the four responders had tumor that was EGFR positive.

EGFR molecular analysis was performed on the four patients who had an objective PR to erlotinib. The EGFR sequence in these patients’ tumor tissue was found to be wild type, with no mutations on exons 18 to 21.

Thirty-one patients had tumor samples submitted for FISH analysis (Table 6). Of these, in five there was no tumor/failure of the analysis. Of the remaining 26, the majority¹⁷ had balanced disomy,¹⁷ and nine specimens demonstrated either trisomy or polysomy. There was no evidence of amplification at the EGFR locus in any of the specimens.

	DISCUSSION

TOP ABSTRACT INTRODUCTION PATIENTS AND METHODS RESULTS DISCUSSION AUTHORS' DISCLOSURES OF... AUTHOR CONTRIBUTIONS Glossary Terms REFERENCES

Erlotinib was generally well tolerated, and toxicities included rash, diarrhea, nausea, and fatigue. There was no relationship between response and severity of treatment-induced rash.

EGFR expression (> 10% membranous staining) was seen in the archival tissue of 19 patients (63%). This rate of positivity is consistent with that seen in other studies.²⁰ Responses were seen in both the EGFR-positive (three cases) and -negative (one case) subsets. There appeared to be no difference in the rate of SD among EGFR-positive and -negative groups (although numbers are limited).

Mutation of tyrosine kinase domain of EGFR has been associated with tumor response in non–small-cell lung cancer (NSCLC),^16,17,21 although not all studies have clearly shown that this is the only subset that can benefit from therapy.¹⁷ EGFR mutations predominantly affect a few specific amino acids in exons 19 to 21, likely resulting in specific gain of function properties mediated by these alterations. In NSCLC, these mutations are associated with increased responsiveness to TKIs, although the situation is less clear cut in other cancers.²² Our results in this study demonstrated that EGFR was wild type only in responders, with no mutations in the tyrosine kinase domain seen in exons 18 to 21. Furthermore, no amplifications of the EGFR gene were detected by FISH in any patient. Thus, in this study, response was not related to either EGFR gene mutation or amplification, which raises an interesting question as to the mechanism of response in responders.

Recent data in lung cancer cell lines indicate a complex interplay between EGFR mutations and other signaling cascades.^22,23 Engelman reported that ErbB-3 receptor mediates phosphoinositide-3 kinase (PI3K) activity in gefitinib sensitive NSCLC lines. Gefitinib dissociates the ErbB-3/PI3K complex in sensitive cell lines to decreased Akt activity. Mellinghoff²⁴ has also reported phosphate and tensin homolog (PTEN)-mediated resistance to EGFR TKIs by dissociating EGFR/EGFRvIII inhibition from the downstream inhibition of the PI3K signaling pathway. Activation of PKB/AKT, with or without PTEN mutation, is a prominent feature of relapsed endometrial cancer, as documented in our previous phase II trial in these women,²⁵ and the demonstration that low baseline Akt is required for activity of the EGFR antibody EMD 72000²⁶ further supports that the activity of erlotinib may be related to PKB/AKT and other downstream proteins in the PI3K pathway.

Clinical response did not really correlate with putative molecular predictors, including immunohistochemical EGFR positivity, EGFR mutations, or gene amplification. Additional correlative studies with other molecular markers in this disease are needed, particularly with components of the PTEN-PI3K-Akt pathway.

The demonstrated activity of single-agent erlotinib in endometrial cancer suggests that this should be developed in the context of clinical trials that build on available information of the biology of EGFR, its interactions with chemotherapy, hormonal therapy, or other targeted agents. For example, EGFR and downstream elements such as PKB/AKT may modulate chemotherapy resistance and apoptosis.²⁷ Zhao et al²⁸ have demonstrated that cells resistant to medroxyprogesterone acetate had higher expression of EGFR, transforming growth factor and EGFR tyrosine kinase, and these cells were sensitive to EGFR tyrosine kinase inhibition (with AG1478). The interaction with PI3K pathway detailed herein, and the evidence that perturbation of this pathway is of critical importance in endometrial cancer, also make it appropriate to combine EGFR inhibitors and targeted agents directed at PI3K proteins such as PKB/AKT or mammalian target of rapamycin (mTOR).

	AUTHORS’ DISCLOSURES OF POTENTIAL CONFLICTS OF INTEREST

TOP ABSTRACT INTRODUCTION PATIENTS AND METHODS RESULTS DISCUSSION AUTHORS' DISCLOSURES OF... AUTHOR CONTRIBUTIONS Glossary Terms REFERENCES

 
Although all authors completed the disclosure declaration, the following author(s) indicated a financial or other interest that is relevant to the subject matter under consideration in this article. Certain relationships marked with a "U" are those for which no compensation was received; those relationships marked with a "C" were compensated. For a detailed description of the disclosure categories, or for more information about ASCO's conflict of interest policy, please refer to the Author Disclosure Declaration and the Disclosures of Potential Conflicts of Interest section in Information for Contributors.

Employment or Leadership Position: Elizabeth A. Eisenhauer, OSI Pharmaceutical (C) Consultant or Advisory Role: None Stock Ownership: None Honoraria: Elizabeth A. Eisenhauer, OSI Pharmaceutical Advisory Board; Ming S. Tsao, Roche Pharma Research Funding: Amit M. Oza, Roche Pharma Expert Testimony: None Other Remuneration: Amit M. Oza, Roche Pharma

	AUTHOR CONTRIBUTIONS

TOP ABSTRACT INTRODUCTION PATIENTS AND METHODS RESULTS DISCUSSION AUTHORS' DISCLOSURES OF... AUTHOR CONTRIBUTIONS Glossary Terms REFERENCES

 
Conception and design: Amit M. Oza, Elizabeth A. Eisenhauer, Janet Dancey, Anthony Fyles

Administrative support: Elizabeth A. Eisenhauer, Naomi Dore, Janet Dancey

Provision of study materials or patients: Amit M. Oza, Laurie Elit, Paul J. Hoskins, Jim Biagi, Prafull Ghatage, John Mazurka, Diane Provencher, Anthony Fyles

Collection and assembly of data: Amit M. Oza, Elizabeth A. Eisenhauer, Jean-Claude Cutz, Akira Sakurada, Naomi Dore

Data analysis and interpretation: Amit M. Oza, Elizabeth A. Eisenhauer, Jean-Claude Cutz, Akira Sakurada, Ming S. Tsao, Naomi Dore, Anthony Fyles

Manuscript writing: Amit M. Oza, Elizabeth A. Eisenhauer, Ming S. Tsao, Janet Dancey, Anthony Fyles

Final approval of manuscript: Amit M. Oza, Elizabeth A. Eisenhauer, Laurie Elit, Ming S. Tsao, Paul J. Hoskins, Jim Biagi, Prafull Ghatage, John Mazurka, Diane Provencher, Janet Dancey, Anthony Fyles

	Glossary Terms

TOP ABSTRACT INTRODUCTION PATIENTS AND METHODS RESULTS DISCUSSION AUTHORS' DISCLOSURES OF... AUTHOR CONTRIBUTIONS Glossary Terms REFERENCES

 

PTEN (phosphatase and tensin homolog):

PTEN is a tumor suppressor gene with a gamut of regulatory activities. The gene product is a multifunctional molecule. The predominant activity identified for PTEN is its lipid phosphatase activity that converts inositol trisphosphates into inositol bisphosphates, thus inhibiting survival and proliferative pathways that are activated by inositol trisphosphates. PTEN acts to maintain arrest in the G1 phase of the cell cycle and enable apoptosis through an AKT-dependent mechanism.

mTOR:

The mammalian target of rapamycin belongs to a protein complex (along with raptor and GL) that is used by cells to sense nutrients in the environment. mTOR is a serine/threonine kinase that is activated by Akt and regulates protein synthesis on the basis of nutrient availability. It was discovered when rapamycin, a drug used in transplantation, was shown to block cell growth presumably by blocking the action of mTOR.

PI3K:

Phosphatidylinositol-3 phosphate kinase (PI3K) adds a phosphate group to PI3, which is a downstream signaling molecule involved in survival/proliferative pathways mediated by growth factors such as the EGF and the PDGFs.

EGFR (epidermal growth factor receptor):

Also known as HER-1, EGFR belongs to a family of receptors (HER-2, HER-3, HER-4 are other members of the family) and binds to theEGF,TGF-β, and other related proteins, leading to the generation of proliferative and survival signals within the cell. It also belongs to the larger family of tyrosine kinase receptors and is generally overexpressed in several solid tumors of epithelial origin.

Tyrosine kinase inhibitors:

Molecules that inhibit the activity of tyrosine kinase receptors. They are small molecules developed to inhibit the binding of ATP to the cytoplasmic region of the receptor (eg, gefitinib), thus further blocking the cascade of reactions that is activated by the pathway.

FISH (fluorescent in situ hybridization):

In situ hybridization is a sensitive method that is generally used to detect specific gene sequences in tissue sections or cell preparations by hybridizing the complementary strand of a nucleotide probe to the sequence of interest. FISH uses a fluorescence probe to increase the sensitivity of in situ hybridization.

Exon:

Segment of a gene that consists of a sequence of nucleotides that encodes amino acids in the protein. Genes are often made up of multiple exons separated by introns that do not encode amino acids in the protein.

Amplification:

The increase of the copy number of a relatively narrow region of the genome, with the magnitude of the increase being large enough so that its generation requires more than a single aberrant event (eg, typically more than the gain of a single copy of the region).

AKT:

A transforming serine/threonine kinase involved in cell survival.

	ACKNOWLEDGMENTS

 
We thank the following investigators who, in addition to the authors, contributed patients to this study: Hal Hirte, Juravinski Cancer Centre Hamilton, Ontario, Canada; G. Dundas, Cross Cancer Institute, Edmonton, Alberta, Canada; and P. Gauthier, J. Dubuc-Lissoir, and P. Drouin, CHUM, Montreal, Quebec, Canada.

	NOTES

 
published online ahead of print at www.jco.org on June 30, 2008.

Supported by grants from the National Cancer Institute of Canada with funds received from the Canadian Cancer Society; correlative translational studies were supported by research grants (A.M.O.) and the Bras Drug Development Program.

Authors’ disclosures of potential conflicts of interest and author contributions are found at the end of this article.

Clinical trial information can be found for the following: NCT00030485 [ClinicalTrials.gov] .

	REFERENCES

TOP ABSTRACT INTRODUCTION PATIENTS AND METHODS RESULTS DISCUSSION AUTHORS' DISCLOSURES OF... AUTHOR CONTRIBUTIONS Glossary Terms REFERENCES

 
1. Niikura H, Sasano H, Matsunaga G, et al: Prognostic value of epidermal growth factor receptor expression in endometrioid endometrial carcinoma. Hum Pathol 26:892-896, 1995[CrossRef][Medline]

2. Khalifa MA, Mannel RS, Haraway SD, et al: Expression of EGFR, HER-2/neu, P53, and PCNA in endometrioid, serous papillary, and clear cell endometrial adenocarcinomas. Gynecol Oncol 53:84-92, 1994[CrossRef][Medline]

3. Nagai N, Oshita T, Fujii T, et al: Prospective analysis of DNA ploidy, proliferative index and epidermal growth factor receptor as prognostic factors for pretreated uterine cancer. Oncol Rep 7:551-559, 2000[Medline]

4. Athanassiadou P, Petrakakou E, Liossi A, et al: Prognostic significance of p53, bcl-2 and EGFR in carcinoma of the endometrium. Acta Cytol 43:1039-1044, 1999[Medline]

5. Gershtein ES, Bocharova LB, Ermilova VD, et al: Epidermal growth factor receptors and their ligands in endometrial carcinoma: Correlation with clinico-morphologic factors and steroid receptors. Vopr Onkol 46:180-186, 2000[Medline]

6. Reinartz JJ, George E, Lindgren BR, et al: Expression of p53, transforming growth factor alpha, epidermal growth factor receptor, and c-erbB-2 in endometrial carcinoma and correlation with survival and known predictors of survival. Hum Pathol 25:1075-1083, 1994[CrossRef][Medline]

7. Miturski R, Semczuk A, Postawski K, et al: Epidermal growth factor receptor immunostaining and epidermal growth factor receptor-tyrosine kinase activity in proliferative and neoplastic human endometrium. Tumour Biol 21:358-366, 2000[CrossRef][Medline]

8. Scambia G, Benedetti Panici P, Ferrandina G, et al: Significance of epidermal growth factor receptor expression in primary human endometrial cancer. Int J Cancer 56:26-30, 1994[Medline]

9. Baguley BC, Marshall ES, Holdaway KM, et al: Inhibition of growth of primary human tumor cell cultures by a 4-anilinoquinazoline inhibitor of the epidermal growth factor receptor family of tyrosine kinases. Eur J Cancer 34:1086-1090, 1998[CrossRef][Medline]

10. Pollack VA, Savage DM, Baker DA, et al: Inhibition of epidermal growth factor receptor associated tyrosine autophosphorylation in human carcinomas with CP-358,774: Dynamics of receptor inhibition in situ and antitumor effects in athymic mice. J Pharmacol Exp Ther 291:739-748, 1999[Abstract/Free Full Text]

11. Soulieres D, Senzer NN, Vokes EE, et al: Multicenter phase II study of erlotinib, an oral epidermal growth factor receptor tyrosine kinase inhibitor, in patients with recurrent or metastatic squamous cell cancer of the head and neck. J Clin Oncol 22:77-85, 2004[Abstract/Free Full Text]

12. Finkler N, Gordon A, Crozier M, et al: Phase 2 evaluation of OSI-774, a potent oral antagonist of the EGFR-TK in patients with advanced ovarian carcinoma. Proc Am Soc Clin Oncol 20:208a, 2001 (abstr 831)

13. Philip P, Mahoney M, Thomas J, et al: Phase II trial of erlotinib (OSI-774) in patients with hepatocellular or biliary cancer. J Clin Oncol 22:14S, 2004 (suppl; abstr 4025)

14. Shepherd FA, Rodrigues Pereira J, Ciuleanu T, et al: Erlotinib in previously treated non-small-cell lung cancer. N Engl J Med 353:123-132, 2005[Abstract/Free Full Text]

15. Therasse P, Arbuck S, Eisenhauer EA, et al: New guidelines to evaluate the response to treatment in solid tumors; European Organization for Research and Treatment of Cancer, National Cancer Institute of the United States, National Cancer Institute of Canada. J Natl Cancer Inst 92:205-216, 2000[Abstract/Free Full Text]

16. Paez JG, Janne PA, Lee JC, et al: EGFR mutations in lung cancer: Correlation with clinical response to gefitinib therapy. Science 304:1497-1500, 2004[Abstract/Free Full Text]

17. Tsao MS, Sakurada A, Cutz JC, et al: Erlotinib in lung cancer - molecular and clinical predictors of outcome. N Engl J Med 353:133-144, 2005[Abstract/Free Full Text]

18. Zee B, Melnychuk D, Dancey J, et al: Multinomial phase II cancer trials incorporating response and early progression. J Biopharm Stat 9:351-363, 1999[CrossRef][Medline]

19. Dent S, Zee B, Dancey J, et al: Application of a new multinomial phase II stopping rule using response and early progression. J Clin Oncol 19:785-791, 2001[Abstract/Free Full Text]

20. Bigsby RM, Li AX, Bomalaski J, et al: Immunohistochemical study of HER-2/neu, epidermal growth factor receptor, and steroid receptor expression in normal and malignant endometrium. Obstet Gynecol 79:95-100, 1992[Medline]

21. Lynch TJ, Bell DW, Sordella R, et al: Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. N Engl J Med 350:2129-2139, 2004[Abstract/Free Full Text]

22. Engelman JA, Janne PA, Mermel C, et al: ErbB-3 mediates phosphoinositide 3-kinase activity in gefitinib-sensitive non-small cell lung cancer cell lines. Proc Natl Acad Sci U S A 102:3788-3793, 2005[Abstract/Free Full Text]

23. Sequist LV, Bell DW, Lynch TJ, et al: Molecular predictors of response to epidermal growth factor receptor antagonists in non-small cell lung cancer. J Clin Oncol 25:587-595, 2007[Abstract/Free Full Text]

24. Mellinghoff IK, Cloughesy TF, Mischel PS: PTEN-mediated resistance to epidermal growth factor receptor kinase inhibitors. Clin Cancer Res 13:378-381, 2007[Abstract/Free Full Text]

25. Ma BB, Oza A, Eisenhauer E, et al: The activity of letrozole in patients with advanced or recurrent endometrial cancer and correlation with biological markers: A study of the National Cancer Institute of Canada Clinical Trials Group. Int J Gynecol Cancer 14:650-658, 2004[CrossRef][Medline]

26. Tabernero J, Rojo F, Jimenez E, et al: A phase I PK and serial tumor and skin pharmacodynamic (PD) study of weekly (q1w), every 2-week (q2w) or every 3-week (q3w) 1-hour (h) infusion EMD72000, a humanized monoclonal anti-epidermal growth factor receptor (EGFR) antibody, in patients (pt) with advanced tumors. Proc Am Soc Clin Oncol 22:192, 2003 (abstr 770)

27. Ng SS, Tsao MS, Nicklee T, et al: Effects of the epidermal growth factor receptor inhibitor OSI-774, Tarceva, on downstream signaling pathways and apoptosis in human pancreatic adenocarcinoma. Mol Cancer Ther 1:777-783, 2002[Abstract/Free Full Text]

28. Zhao S, Chen X, Lu X, et al: Epidermal growth factor receptor signalling enhanced by long-term medroxyprogesterone acetate treatment in endometrial cancer. Gynecol Oncol 105:45-54, 2007[CrossRef][Medline]

Submitted January 19, 2008; accepted May 13, 2008.

CiteULike    Complore    Connotea    Del.icio.us    Digg    Facebook    Reddit    Technorati    Twitter    What's this?

This article has been cited by other articles:

				J. E. Ang, R. N. Shah, M. Everard, C. Keyzor, I. Coombes, A. Jenkins, K. Thomas, R. A'Hern, R. L. Jones, P. Blake, et al. A feasibility study of sequential doublet chemotherapy comprising carboplatin-doxorubicin and carboplatin-paclitaxel for advanced endometrial adenocarcinoma and carcinosarcoma Ann. Onc., November 1, 2009; 20(11): 1787 - 1793. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Purchase Article View Shopping Cart Alert me when this article is cited Alert me if a correction is posted Services Email this article to a colleague Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Save to my personal folders Download to citation manager Rights & Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Oza, A. M. Articles by Fyles, A. Search for Related Content PubMed PubMed Citation Articles by Oza, A. M. Articles by Fyles, A. Social Bookmarking                            What's this?